He needs you to be okay
You can't answer him
You are not okay
42 notes
·
View notes
shanks (maternal) lore drop be upon ye
Ancestors came from Hardrada, island of a violent group of sailors in the New World. Hardrada and Elbaf were very close allies and shared similar cultures in the days before the Void Century (The God Elbaf and the God Har are viewed as the same, simply under different names). Given how far they traveled, there are remnants of Hardrada along the Grand Line and in many of the Blues as many chose to settle elsewhere.
Shanks' comes from a long line of Priests & Priestesses who advised Hardrada's royalty: each had 10 followers beneath them
Prior to the start of the Void Century, Hardrada made contact with the Great Kingdom and the Priest at the time swore the serve those with the initial D. and, supposedly, in return, she was taught Conqueror's Haki by them
Fast forward to the Void Century; Hardrada's royalty refused to take part in the war and wished to side with that would become the World Government
The Priestess at the time, Velleda, was not happy with this and when she spoke out, was banished from the island,
Velleda never left the island and instead journeyed into the mountains and had the sword Gryphon forged (supposedly with a dragon's flame) and then slayed the dragon. Legend has it that Velleda's hair was not originally red, but that it turned that color after this, and many began calling her Akagami afterwards.
She returned and overthrew the royalty of Hardrada and named herself the new Chief. Given the island's heavy warrior culture, Hardrada eagerly joined in the war.
Following their defeat, the newly formed World Government took over Hardrada, and the Gorosei focused on flushing out those with Velleda's blood. Many fled to other islands in hopes of escaping the WG's wrath. Bounties were put out on those with Red Hair and they were hunted down and often scalped for their hair.
Elbaf sheltered many Hardradans during the hunt, including Shanks' ancestor, Folke, one of Velleda's descendant's and the current bearer of Gryphon. After ransacking Hardrada, the World Government began snooping around Elbaf, and the Giants offered to hide him, but Folke turned himself in so long as the WG agreed to his terms. He requested that they remove the bounties on those who remained and to let Hardradans and their descendants live in peace, promising himself and his descendants in return.
Seeing Velleda as the root problem of Hardrada, the WG agreed and escorted Folke and his family to the Holy Land where they were to be kept as a slave. Hardrada was left alone.
Impressed by Folke's power and abilities, the Five Elders began to feed lies and manipulate them. They were kept isolated from their people and culture and were bred with a person of choosing to keep their bloodline going. Gyphon was passed down the family line and, eventually, Folke's descendants were used as protectors of the Celestial Dragons and the Holy Land.
The Five Elders began to dispatch the Akagami on missions to hunt down the Devil Fruits to gift to Celestial Dragons and were often sent in search of notable fruits such as the Gomu Gomu no Mi, which continually slipped away. Gryphon became bloodthirsty for Devil Fruit users as the centuries passed and those with red hair were seen as vicious killers throughout the seas. Shanks' family moved from slaves to being a well-loved pet of the Celestial Dragons.
Shanks' mother, Astra, was well loved. The Celestial Dragons would take her places and dress her up to their liking. Portraits of her remain, hidden away from the Five Elders and Holy Knights. Though powerful, Astra's social skills were lacking, typically coming off as emotionless. During most of her young adult life, she fulfilled the roles expected of her.
Astra learned of her familial connection to Hardrada for the first time after meeting Rocks D. Xebec. This news stunned her as she and her ancestors had been kept in the dark regarding their history for centuries. She feared questioning her role to the Gorosei and the Holy Knights and bit her tongue, but continued to learn more of her past by seeking out Xebec over the years.
Xebec told her how the Celestial Dragons had never cared for her. That she was being used for her abilities and they were punishing her for what her ancestors did. He applauded her ancestors for their actions against the WG and that Hardrada was once a great and powerful nation that had become weak. That she should be ruling Hardrada and that he would treat her well if he were in charge.
As Astra grew older, Figarland Garling requested her as his wife due to her strength and hoped to produce two children. An heir for her duties and an heir for his. The Five Elders agreed and the two were wed.
When she became pregnant, Astra fled, Xebec's words in her mind. She went to Hardrada, hoping her people would take her back and provide a safe haven to keep her from the Five Elders and Garling, but most shuttered their windows and closed their doors. Their current Chieftain refused her entry and demanded she return to the Holy Land. Distraught, Astra destroyed the capital city, killed their Chieftan, and fled elsewhere.
Though she managed to keep herself hidden, Garling eventually tracked her and Shanks down and brought him to the Holy Land.
(1095 spoilers ahead)
Garling brings Shanks with him during the Native Cleaning Festival at God Valley, where he plans to kill Astra. Though he does end up succeeding, Astra manages to sneak Shanks into a treasure chest during the chaos of Xebec's battle with Roger and Garp, in hopes of Xebec and his crew picking him up.
10 notes
·
View notes
Tried my first eidolon hunt today! Just teralyst. Solo bc no one else joined the bounty, and i got 3/4 of the way to capturing the damn thing before the game crashed on me
So uhh
Yep
I think I’m just gonna make do with an ungilded 1-2-1 amp for the rest of my time in this game bc out of “get rank 5 with Solaris United before you can even think about ranking up with Vox Solaris” and “fight another ten eidolons,” the most fun option by far is “neither”
2 notes
·
View notes
me before finishing bop to the top: it’s gonna flop and that’s okay because stats don’t matter and i had fun writing it
me posting bttt: hell yeah baby!! completion RULES
me after posting bttt: actually everything sucks ass because no one engaged with my writing at all and i have nothing near completion so no finish lines to power me through and now i just can’t seem to scrape together the energy to care enough to write
3 notes
·
View notes
are we back to not being able to not like things
0 notes
𝐃���𝐀𝐑 𝐅𝐔𝐓𝐔𝐑𝐄 𝐇𝐔𝐒𝐁𝐀𝐍𝐃, 𝐉𝐉𝐊 𝐌𝐄𝐍 —
a small series of Jujutsu Kaisen men as your husband !
☆ OUR STARS : Gojo Satoru, Nanami Kento, Geto Suguru, Choso Kamo, Aoi Todo, Toji Fushiguro, and more !
━ REQUESTED BY : none
━ WARNINGS : none
ෆ PIXIE'S NOTE ! : were back again at daily posting 🙏🏻 to my pookies who supported me, y'all made me giggle and kickin' my feet in my bed last night 👉🏻👈🏻 love lots!
GOJO SATORU, as your husband !
• Gojo being your husband is no different from being your boyfriend — he still gotta be that same person you dated few years ago, though he became more serious about situations and decisions because you guys are married but his goofy, annoying, clingy side is still there — I mean when he met you and been with you for like two weeks your caller name is already set as 'wifey'.
Gojo who totally acts like a mom when you leave for work, he is like a freaking HOUSEWIFE —
"honey!" he sings as he walks into the living room seeing you brush your hair Infront of the mirror, getting ready for work. "hmm?" you responded and quickly turns your head at him — he's wearing a this is what an awesome husband looks like apron which made you too stunned to speak, "I created a bento for you." he smiles as he hands out a nicely wrapped bento box which was really new to you because it's always you who keep creating bentos for him, usually when he leaves for a mission.
"thank you, honey." you say softly with a warm smile as you accept his bento that he specially created for you, he can't help but to feel like a love sick teenager seeing you smile like that. He officially takes the position of being a housewife 🫡
Gojo who couldn't stop talking about the future he wants with you like nonstop — this man would talk about having three million carbon copy of him with you and would name them after megumi, yuji, nanami and basically all of his friends, students, and dead relatives 🏃🏻♀️💨 — I FEEL LIKE HE GOTTA BE THAT TYPE OF PERSON.
Gojo always flexes you everyday and YOU are his hyper fixation — argue with the wall, he gotta be the type of man to say "she's my wife." randomly when he's talking to an old friend he haven't seen for a long time. HE WILL BE THE HUSBAND WHO YOU WILL SEE WEARING "I LOVE MY WIFE" TYPE OF SHIRT WITH THE UGLIEST FONT AND PHOTO TEMPLATE EVER. Once a person mentions your name he ain't gonna shut the fuck up.
I just know this marriage go'n be like Ryan Reynolds and Blake Lively's relationship 🙏🏻 ABSOLUTELY RANDOM TEXTS FROM HIM, UPDATING YOU TOO MUCH.
2:32 pm
gojo : shitting at the mall cuz i don't have anywhere to shit on.
gojo : [sent an attachment]
gojo : i miss you my wife, my beautiful wife.
gojo : [sent an attachment]
gojo : [sent an attachment]
gojo : your very handsome husband ❤️
2:40 pm
you : stop spamming me messages love, im at work 🙏🏻
gojo : why? is it turning you on 😏
you : that's a photo of your feet.
Gojo who became a seriously hands on person when you told him that you're pregnant — when he has missions with yuji, megumi, or maybe nobara and you told him that you're very tired to do anything today he will be like,"okay kids, I got to go I have important things to do." and dashed away before they could say something and mf arrived at yalls house within a second.
Gojo who cried when he carry his baby for the first time, he was sobbing like hell — girl dad? boy dad? BRO HE IS BOTH ‼️ "okay we'll name this one suguru and this one-" he is going to come up with the most ridiculous names, probably the worst one was his dead ancestor.
okay seriously, Gojo would be a full time dad after his children were born — he will always stay at home as much as he can, having twins isn't easy plus he's trying to help you with his full power and make sure you don't feel alone through this.
"gojo.." you grumble as you felt his presence disappearing next to you at bed, you open your eyes and sees he wasn't there which led you to stand up and start looking for him — you walk out of the bedroom and noticed that the twin's bedroom door was open so you check it out.
in your suprise, gojo was in the rocking chair with the twin's in his arms peacefully sleeping and he is snoring like hell. You can't help but smile seeing this moment, it warms you heart. You quickly grabbed your phone and took a quick photo, this is what you exactly wished for.
Gojo who couldn't stop posting you and his little angels and his fans are absolutely living for it, it's like his day wouldn't complete without posting cute photos of his angels and of course, you as well. Gojo is indeed a Facebook mom —
; gojosatoru
tagged : @y/n.instagram | fam time 🤍 !
liked by megumi.22 and 8,957 others
itaaa.yuji | I volunteer as a tribute to babysit them 🫡
nobaraaa | CUTIES.
shokoleiri.7 | adorbs
─ REBLOGS, LIKES, AND COMMENTS ARE APPRECIATED FEEL FREE TO REQUEST!
5K notes
·
View notes
I Want to Hold Your Hand | Aaron Hotchner
Pairing: Aaron Hotchner x bau female reader
Summary: Hotch sends you home and you almost die, which only makes him realize how much he truly loves you.
Word count: 2.4k.
Tags/warnings: hurt/little comfort; season 1 Hotch my beloved <3; canon typical violence; Haley and Jack don’t exist in this universe oopsies; angst with happy ending; Hotch is a baby; probably very inaccurate medical talk bc all I know is from Grey’s; not beta read + English isn’t my first language so good luck with that.
Author’s note: remember when I said I was probably done writing for a Hotch? Turns out all I had to do was stop taking my antidepressant 🙄 anyway, don’t get your hopes high. I just needed to take a break from my never-ending Spence fic so I wrote this. Which is basically a rewrite of what happened with Elle. I just wanted to make Hotch suffer a little so I hope you like it!
MASTERLIST
A few hours ago, Aaron kissed the top of your head and sent you back to the hotel with a police officer.
Now, he was in a hospital waiting room with his heart in his throat, hoping the doctor would show up with good news.
You’d been attacked in your hotel room, and it was his fault.
“They’re gonna set up a bed for you in her room.” Jason walked in with a cup of coffee for Aaron. His fourth one already.
“She’s… not out of surgery yet,” Aaron shut his eyes. “We don’t know if —”
“The hospital chief, I know him.” Gideon sort of smiled. “I asked him if he could go check on her. All I know is that they’re closing her up now.”
The words began to sound far and faded as if Aaron was underwater. His vision blurred and his legs would’ve given up if he wasn’t sitting down already.
It was his soul returning to his body.
He didn’t want to get his hopes high, though. If they were closing you up it meant you were alive, but nothing else. There could be a hundred things wrong with you while being alive.
All he could do was nod and put his hands together over his lips like a prayer.
You were alive.
“The doctor should be here with the updates any minute now.” Jason sat next to Aaron and gave him a gentle tap on his back.
Gideon knew. Even when Hotch hadn’t told anyone about his feelings—not even you—he spent most of his day with profilers so of course the best one in his team knew about it.
“I’m heading back to the hotel soon,” Gideon continued. “See what the hell happened. Why… How did they let the unsub enter her room. Garcia should be landing soon. We need to check every security camera.” He smacked his tongue in disappointment and shook his head.
Aaron rose from his seat and tried his best to at least let his shoulders relax but every bit of him had turned into concrete.
“Where are Reid and Morgan?” He asked, pacing back and forth and stretching his neck from one side to the other. Even in moments like this, he needed to know where the rest of his people were. Especially in moments like this.
“Back at the local PD,” Gideon answered.
“JJ?”
“She’s talking to the hotel manager, making sure none of the employees makes any declaration to the press before we catch the guy.”
Aaron nodded, and soon, the doctor walked into the room with the updates.
“Surgery was a success,” he began. “We managed to repair all the damage and save her lung. Now, she flatlined once in the ambulance and then again during surgery so her brain has been through a lot.”
It wasn’t the time to profile anyone, but the way the doctor couldn’t keep eye contact for longer than two seconds told Aaron he was aiming at something more serious.
“Just tell us.” Aaron rubbed his thumb with his fingers.
“She’s not breathing on her own yet and according to her EEG, her last exam, her brain is swollen. It may take her a while to wake up.” The doctor gulped. “If she wakes up.”
Aaron’s entire world crumbled once again. He pinched the bridge of his nose and walked to a corner to pull himself together.
This was his fault. You might never wake up and it was his fault.
“When can we see her?” Gideon asked for him.
“You can see her now but… you need to be prepared. A machine is breathing for her. There’s a tube down her throat and it might be a lot to look at.”
Just picturing you like that turned his stomach upside down.
God, if you don’t ever wake up—
“She’s gonna wake up.” Penelope’s voice entered the room and so did the light she carried everywhere.
She was one of Aaron’s comfort people. If Penelope was there, there was hope.
“Garcia,” Jason said in a don’t tone.
“She’s strong.” Penelope walked up to Hotch anyway. “And people wake up from comas. Miracles happen and—” Her eyes filled with tears once she touched Hotch’s arm to get his attention. “She needs us, she needs you. And we need her.”
Garcia also knew, apparently. And if she knew without being a profiler, everyone else knew.
“I found this.” She handed Hotch a Polaroid picture of you. You were leaning on Garcia’s desk, your arms folded over your chest and with your sweet, sweet smile. There was the hope. “I took it a while ago and kept it on my desk along with the others but…”
Aaron took it with a shaky hand. You were mesmerizing.
“García,” Gideon insisted.
A nurse interrupted to let them know they could see you now.
“You go,” Gideon said to Hotch, taking a step back. “Just call me if anything changes. Garcia, you’re coming with me.”
“Yes, sir.” Penelope gave Hotch one last hopeful smile before following Jason out.
Aaron looked at your photo again and took deep breaths to gather himself as walked to the endless hall that took him to you.
“We’ll set up your bed in a few.” The nurse smiled at him, gesturing for him to go in. “She looks good. It might not look like it because of all the machines but she’s doing good. She’s a strong woman.”
Aaron said a quiet thanks before the nurse left.
It was just you and him.
The steady beeping of the machine brought him a sense of comfort—it meant you were alive—yet his feet were hesitant to take him next to you. He stood at the door for a moment, watching you from afar.
As the doctor had said, it was a lot to look at. It reminded him of the last time he saw someone close to him like this: his father. The difference was that back then, he couldn’t wait for his dad to die.
Today, he’d found himself praying multiple times to a god he wasn’t even sure existed most times.
He dared to move and when he reached your side, he almost crumbled. You had a few bruises on your left cheek, your knuckles were split—you even had a broken finger, and you looked beautiful as ever. He wished he could see the twinkle of your eyes, hear your voice, catch you smiling at him.
Guilt brewed at the pit of his stomach again. He should’ve gone with you. He should’ve been with you.
He lifted one hand to stroke your head and tears welled up as soon as his skin touched yours. His chin quivered and he sniffled quietly as tears threatened to spill. He used the heel of his hands to dry them away. He couldn’t cry, even if you were in a coma and couldn’t see him like this—broken. You believed people’s energy had effects on others, and you needed him to be strong. He needed to be more like you.
His bed was set soon after, right next to you. His eyes were heavy, and his muscles were sore. Even then, he couldn’t bring himself to lie down. He was scared to close his eyes. What if you died while he was asleep? He stayed sitting down, holding your hand and never losing sight of you.
“It’s raining,” he said out loud, talking to you. “Every time it rains I think of you.”
He smiled at the memories. You’d shown up at his office for your interview drenching, and he was smitten from the very first moment he laid eyes on you.
“Agent Hotchner,” your perky voice caught him off guard. No one inside the BAU building was perky—besides Garcia.
You stood by the door, both hands behind your back waiting for his signal to come in.
“Please.” He gestured with his hand to the seat across from him.
He took half a second to study you quickly. Raindrops were gathered over the shoulders of your blazer and your mascara was a bit smudged under your eyes.
“Forgot your coat, agent?” He commented, peeling his eyes off you and reading through your resume.
“Didn’t think I’d be raining by the time I arrived, sir. I don’t keep an umbrella in my car either. I apologize for my… appearance.”
It wasn’t your appearance that got you on his team, it was your outstanding resume. It made him wonder why you chose to apply to the Behavioral Analysis Unit instead of staying at ViCAP. Your performance there was impeccable.
“I wasn’t feeling comfortable there anymore,” was your answer. “And I want to seek other paths, sir. And I know I’m a good fit for your team.”
You started the very next day, and he partnered up with you to keep an eye on you during your first cases. You were a quick thinker, were fast on your feet, and stayed calm under critical situations.
Not once he felt at a disadvantage in the field for working with the new kid, which only showed him how good you naturally were. He was drawn to you and it wasn’t just because of your professionalism.
It was your fast food order. It was the first joke you ever made that only made him laugh. It was your perfume, the way you spoke with your hands, and how you raised your brows when making a point.
Everything about you made him take a deep breath. You made him dizzy. Lightheaded. Drunk.
Exactly how he felt right now while holding your hand, except that now, the room was spinning at the mere thought of losing you.
“I love you,” he murmured, bringing your hand up to his lips and kissing your bruised knuckles with shaky lips. “I love you.”
He’d never said it before. He didn’t know he did until now.
“God, I love you so much. From the moment I saw you, you lit up my life. You made it better, made me better.” He kept talking to you, hoping that his voice would heal everything inside you. “I can’t lose you. I won’t make it.”
Please wake up. Please wake up. Please wake up.
The rain stopped, the hours passed, and the sun never came out.
It’d been two weeks and he’d already made the habit of reading you at night.
“Studies have shown that playing music they really like and talking to the person in a coma increases their chances of waking up,” Spencer had said the day the entire team came to visit you.
Most nights he read case files. Others, he liked to read poetry.
You still hadn’t woken up, but the music, the poetry, and the flowers didn’t stop.
“I hope you don’t mind if I read something by Neruda,” Aaron said as he sat on the chair next to you. “Maybe not Neruda.”
It was one of those nights where hope had watered down with his tears.
He put the book down next to you and held your hand. He hadn’t stopped holding your hand; he hadn’t stopped kissing it either. He sighed deeply and stood up to draw the blinds, turning his back to you.
A loud smack against the floor startled him, making him turn around. The book he’d left next to you had fallen. He didn’t think he’d left it at the edge of the bed, but he picked it up without much curious and went to put it where it was.
Your hand twitched when he grazed your knuckles casually.
Then it twitched again—harsher—and a soft whimper came from your chest. That sound definitely came out of your body.
Aaron was quick to check on you, towering over you and watching you closely. Your eyelids started to move and the next thing he knew, he was making eye contact with you.
Those beautiful twinkling eyes took his breath away.
“We need a doctor in here!” He was quick to react, pressing the call button.
Nurses stormed inside and moved him out of the way to assist you.
“She’s awake. She’s fighting the tube,” was all he heard before a thousand tingles rushed through him.
You were awake.
Your doctor arrived soon after to examine you and Aaron stood there as they took the tube out.
You coughed and writhed with discomfort.
“Can you tell me your name?” Your doctor moved a small flashlight in front of your eyes.
You blinked a few times and searched around the room. Your eyes landed on Aaron. “Hotch?”
Your soft voice traveled to him and enveloped his heart, mending every bit that was broken.
“Hi,” he merely said.
You shook your head and said your name instead. Your doctor asked some more questions like your birthday, where you worked at and what was the last thing you remembered, and the entire time your eyes were trained on Aaron.
“It’s vague.” You took a sharp breath. “I think I was attacked but I don’t know how. I can assume by this unglued scar, though.” You put your palm on your chest.
“We’re still going to do some tests,” Your doctor said. “But you’re great. Pupils are responsive, your lungs sound healthy and there are no signs of brain damage. No memory loss. No speech loss either.”
“How soon can she go home?” Aaron asked, taking another step closer. He finally stood by your side, and you reached for his hand.
This was you. Sweet and caring even at your worst.
“I’d like to keep her under observation for a couple of days, then she can go. But just so you know, you can’t fly for at least two weeks after open-chest surgery.”
The doctor gave you some other indications before leaving, then it was just the two of you as it’d been for the past two weeks. Though now he got to see the twinkle of your eyes, hear your voice, and catch you smiling at him.
“What’s wrong?” You asked, tilting your head to the side like a puppy.
“I sent you away and—“ he raised his brows.
“Don’t.” You squeezed his hand. “Don’t do that. Don’t… blame yourself.”
“I should’ve come with you. I should’ve— god, you almost died. You almost died,” he repeated in a whisper, shutting his eyes with pain.
The guilt was still there.
“But I didn’t.”
“I was so scared,” he admitted, daring to look back at you.
“I… don’t remember much. Just bits and pieces but I do remember that I wasn’t scared. I think. I… channeled you at that moment.” You laughed. “I remember thinking, Hotch wouldn’t be scared, he would put up a fight, so I did. I fought the guy, which got me almost killed but I wasn’t scared.” You lifted your hand and cradled his face, rubbing your thumb over his cheek. “You have a beard.”
He chuckled. “Barely.”
“It looks good. I like it.”
He didn’t like it much, but he was grateful it was there so you wouldn’t see how hard he was blushing. He poured you some water and handed it you to distract himself from it.
“Where are we?” You then asked, taking a sip from the straw.
“Seattle.” Aaron raised his brows while licking his lips.
Last time you two were in Seattle, you’d kissed for the first time.
“Oh,” you mirrored his smirk. “So that’s gonna be like a three-day road trip back to Quantico?”
“It’s either that or two more weeks in Seattle until you can fly there,” he responded.
“Both sound amazing, don’t you think?” you scanned his face up and down and heat rushed to his cheeks again. “Thank you for staying with me, Aaron.”
I love you, he thought.
“How could I not?” he said instead.
Never said there would be a love confession now did I 🤭 But don’t worry, hotch confesses his love during the road trip <33333 also the title is a The Beatles song bc he played The Beatles a lot while reader was in a coma. And bc he held her hand a lot.
I hope you liked it!!!!
1K notes
·
View notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
To raise a child
✧ jing yuan x gn!reader ft. yanqing (platonic)
✧ based on the asks: 3 requests asking for a family fic with jing yuan and yanqing
✧ synopsis: raising a child is always hard, even when you're a long life species with a lot of experiences.
✧ contents: established relationship, fluff, found family trope (a.k.a my one weakness with every media), yanqing & reader have a slight rocky start, mentions of other characters, sentences in italics are readers thoughts.
✧ a/n: i'm not gonna chuck angst into a found family trope unless i feel particulary miserable, they just gonna have a good ole time being parents to a yanqing from when he was a wee babie to the lieutenant he is today - also a lot of this is my own interpretation SINCE I DON'T GET A CRUMB ON HOW THE HELL THIS MAN FOUND MY BABY. not beta-ed like usual i'm sorry.
The first time you were told about Yanqing's existence was when you were not onboard Luofu, which honestly made the first meeting between the two of you a lot worse.
"... Pardon, he found what now while I'm away?" you stare bewildreded at the messenger before you while clutching the letter Jing Yuan had written to you - you can practically hear his easy-going voice resound in your head through the words before you.
"What do you mean he suddenly picked up a whole child?!"
Safe to say that the Luofu were turned upside down by the time you came back to the ship. Rumours spread amongst the citizens, gossip between the storytellers and the newsboard retelling the latest news and constantly updating on any new "information" they had gotten.
To say you got stopped at every corner before you even stepped foot back in land was an understatement. You practically had a crowd waiting for you - it was only by the assistance of Yukong that you had managed to worm yourself out of the crowd and hightail home.
Maybe it's because Jing Yuan knew you would come home first, or maybe it's because he was aware that you had a lot of questions for him. Which was why you had gotten a text prior to landing with the single message of:
"Decided to take the day off today <3"
Safe to say he was left on read.
"Jing Yuan, what has gotten into you-" are the first words that leaves your mouth when you slam your entrance doors open, only for your eyes to widen when Jing Yuan is already waiting for you at the foyer. Hands behind his back and sporting his signature smile, but your gaze isn't at your lover before you.
Rather it was on the smaller child that was hiding behind his legs, he was by no means scared of your sudden appearance you noticed. Rather, he was sizing you up and down with a fierce gaze, almost like a lion cub who had just found its first prey.
The glare made your previous anger and confusion fade into a more surprised shock, rendering you speechless on how to proceed further. Jing Yuan steps in after seeing your anger dissipate upon seeing the fierce boy, raising a hand to ruffle Yanqing's hair before he directs his gaze back to you who is still staring at Yanqing in mild surprise.
"He's a feisty one isn't he?" is what he utters softly, and it's the slight exhaustion in his voice that causes you to let your guard down and put aside your confusion and need for answers aside.
Right now there's a young child before you, a child that you don't know the lineage of - but a child that Jing Yuan himself had picked up and stood his ground against public opinion for.
And Jing Yuan didn't do things without reason.
But you're well aware that he's also the kind to not tell you much as to why he had done a few decisions. As futile as you know it is, you would still try to get something out of him later. But for now, you would have to try to give a better impression of yourself to this kid who you're pretty sure sees you as anything, but a person with good intentions.
... What do you say to a child that is currently holding animosity towards you?
Seeing your distraught face makes Jing Yuan let out a chuckle, glancing down at Yanqing who is still staring fiercly at you, "They're not someone you should be on guard with. That's my spouse, they're just surprised by your sudden arrival is all, Yanqing."
So his name is Yanqing.
The reassurance from Jing Yuan makes the young boy relax a bit, but you can still tell he's very much on guard against you, "... I'm Yanqing," he mutters quietly.
The two of you seem to have a long way to go from the first encounter.
"... What were you thinking?" you question the moment Jing Yuan slides the door to your bedroom shut, you had spent the majority of the afternoon cleaning up a spare room for Yanqing to sleep in after the meeting while the two had headed out to prepare the paperwork for Yanqing to be offcially be recgonized as a Cloud Knight.
"... I saw potential?" he tries, but with one glance at your direction and being faced with your quirked eyebrow makes him let out a sigh instead, reaching a hand behind his head to pull the red ribbon tying his hair back.
He doesn't say anything as he makes his way over to you. Neither does he utter a word when he lets his entire weight fall on top of your own, the noise of surprise you let out making him chuckle, rubbing his face onto neck, "W-Wait, hold on. There's a literal child in this house now, what are you-"
"Dear, what are you thinking?" Jing Yuan snorts before you finish your sentence, wrapping his arms around your waist before flipping himself over so that you're laying on top of him, "Our schedule clashed together too much that it's been 2 years since I last saw you? And when I meet you again you looked like you were going to pull my head off of my own body, this is quite frankly the first instance where I get you all to myself," he explains, raising an eyebrow at your gradually reddening face, "Whatever you were imagining is beyond me, darling."
"... Shut up and tell me the truth already," you murmur before burying your face in his chest, lifting a closed fist to lightly hit his arm when you feel his chest rumble with his constrained laughter.
"I didn't lie when I said I saw potential. Despite his young age, Yanqing is quite gifted with the sword," he starts after a brief silence, fingers drumming along the spine of your back, "But it would be more accurate to say I'm preparing the future generation?" he muses out loud, sounding unsure himself which makes let out a chuckle, "Wow, I'm sure lady Fu Xuan would be delighted by the news of your possible retirement."
"I'm afraid I'll have to disappoint our Master Diviner for another few decades unfortunately. She's still far too young to take up the mantle of the general."
You hum, raising your head up from his chest to make eye contact, Jing Yuan directing his gaze from staring up at the ceiling to instead stare at you as well, "Next time you're thinking of picking up a kid, give me a heads up? Or else you're going to end up on the news again like today with the headlines of you committing infidelity."
He laughs, hoisting you further up his body to peck your lips, "Please, I won't be picking up another child anytime soon. But maybe I need to show the citizens that I only have eyes for one person if they were swayed this easily by the apperance of one child."
"... Please don't say something that embarassing in front of Yanqing."
"See, you're already being a great parental figure."
Great parental figure my ass.
Is what's currently running through your mind as you're once again, left alone with Jing Yuan's prodigal apprentince. it's been a few months after Yanqing's first arrival, and the relationship between the two of you seem to still be threading on thin ice.
Your relationship with the young prodigy hasn't gotten worse, but it has in no way improved either. Whenever Jing Yuan is not present amongst the three of you, Yanqing becomes extra reserved and takes extra caution to not bother you - which makes any attempt to even talk to him 10 times harder than it has to be.
Yanqing is out in the garden, brushing the fallen leaves into a neat pile while you're sitting by the living room table doing paperwork. And yet, ever since Jing Yuan had stepped out for some urgent business, the two of you haven't even spoken a single word to each other.
Yanqing was at an age where you didn't need to give him constant attention, but with the way you two had started on the wrong foot it felt a lot harder trying to get closer to him - mostly because the boy himself tries to not be a burden on you, which in a way has become a burden.
Not to mention, Jing Yuan spends the most time with him training him personally - so the time you spend with Yanqing is close to nothing compared to your lover.
The odds are truly against you at the moment.
At this point, the new paper scroll that you had rolled out were becoming useless with how long you had pressed the ink filled brush on it's surface, the gradual circle of ink stained paper growing with each passing minute.
Topics you can talk about.. Jing Yuan mentioned he was great with a sword, but it's been ages since I've held a sword myself till the point he's probably better than me...
Were you always this awkward with children?
Glancing at the clock, you notice it's almost time for your meetup with master Gongshu over at the Artisanship Commission. So with a reluctant sigh, you glance down at the paper scroll before you - that has long been ruined before you put the brush away and roll the scroll back up.
"... Yanqing I'm about to head to out to the Artisanship Commission, can you..." your voice dies down when you see the boy whip his head around the moment you mention the Commission. And although he tries to hide it, you would be a fool to not notice the sparkle in his eyes at the mention of where you are going.
"... Do you want to join?" you end up asking instead.
You've never seen his facial expression change so much in just a few seconds. First you could tell he wanted to agree, but then you're pretty sure he managed to figure out why you were going and didn't want to be a burden, but still wanted to go. You soon saw hope come back to his eyes, presumably remembering that you personally asked, but you saw the same hope dwindle down when he probably thought that you asked just to include him.
The sight made you laugh, "... A child is a child after all, no matter where they are," you whisper quietly to yourself, "You won't be a bother, Yanqing. And wouldn't it be better for you to look around the Luofu a bit? I'm pretty sure Jing Yuan has only brought you to the Cloud Knights training area after all, we can even stop by Cloudbreath Sleeves to take your measurements so that you can get some tailor-made clothes and not Jing Yuan's old clothes."
That seemed to be the only reassurance he needed.
You're pretty sure Yanqing hasn't noticed that your meeting with master Gongshu ended 15 minutes ago. Neither has he seemed to realize that the two of you have spent the next 15 minutes just observing his every reaction to the swords on display.
His eyes seemed particulary glued to an iridescent blue sword with a black handle, master Gongzhu giving a low whistle beside you, "He's got a good eye."
You roll your eyes, "Send me the invoice later," you reply back before stepping towards the awestruck boy, "Why not bring it home with us?" you ask, Yanqing jumping slightly in surprise, his head turning around with widened eyes, "I can't possibly ask that of you, I can just save up-"
"You're staring at it like it's your first love, Yanqing," you chuckle, reaching out to grab the handle, twirling it around before reaching for the scabbard right underneath where it was displayed - sliding the sword inside.
"Consider it a gift, for future endeavours."
He blinks, taking the scabbard from your hands, staring at the intricate design weaved into the metal - and you notice the faint tears forming at the corners of his eyes before the boy leaps into your arms to give you a hug, "I swear I'll treasure it, thank you!"
Perhaps too shocked by the sudden hug, you fail to realize that master Gongshu had quickly snapped a picture of the scene and sending it to a certain general.
Qingzu had to stop the very same general from storming away from the Divine of Foresight to head to the Artisanship Commission the very next minute.
"... Well the two of you seem to have gotten a lot closer these past few months," Jing Yuan comments the moment he noticed the position you were currently in. You merely glared halfheartedly at him, but Jing Yuan made no effort to help you - instead walking over to bend down to peck your forehead, careful to not wake the child asleep on top of you.
"I told him to head home before me since I still had affairs to tend to, didn't think he would immediately collapse on top of you and doze off," Jing Yuan remarks with a laugh.
You had one hand supporting Yanqing weight on top of you so that he doesn't topple over, so you decide to use your other hand to reach over and flick Jing Yuan on the forhead - a flick he moved away from with a smirk, "He just dozed off mid-talk too. He was talking about your recent spar match before he just fell asleep," you say, "And to think he vehemently denied not needing a nap after a training session because he's not a child."
Jing Yuan lets out another laugh at that, effortlessly wrangling Yanqing away from your hold and hoisting him up in his arms without manaing to wake him up, "Well if you treat him like an adult, he'll show the temperament of a child as well."
"You should try to get some rest as well, dear. We can just order something from Aurum Alley later," Jing Yuan suggests, to which you merely nod to, standing up to stretch your limbs, "Join me then, I'm sure our dozing general is quite tired too."
"My, what an alluring offer. Can I assume that there's something more-"
"Don't push your luck."
here's the 3 requests that wanted a family fic - i actually struggled a bit with how to do this, but alas - i just know future me will conjure something up again so have this as a teaser HAHA
2K notes
·
View notes
Showed Me (How I Fell In Love With You)
masterlist
summary: dean helps you up your flirting game, but there’s really only one set of eyes you want on you.
paring: dean winchester x female reader
rating: R for language
word count: 2.7k
warnings: language, implied sex/nudity, strands of hair falls on reader’s face
author’s note: you probably already know this but sideblogs (like this one) can now answer comments!! super excited about this update and fingers crossed the next one is for sending asks lol 🤞💞
music: showed me (how i fell in love with you) by madison beer — i was listening to this song and kept imagining dean, idk
Dean always had incredible luck with women. He could go into a bar crowded with guys and walk out with the only woman—the bartender who’d been dodging men all night.
You, on the other hand, could go into that same bar and end up going back to the motel alone. It bothered you; what in the hell were you doing wrong?
So, you did the unthinkable—you asked Dean to help you get better at flirting.
That’s how you ended up here at the bar with Dean; he was showing you how to play pool. You had protested the idea of him “teaching you” something you already knew, but he claimed it was important.
“You’re standing wrong,” he told you when you were about to break.
“Uh, no I’m not?”
“If you’re trying to win the game, you’re doing great. If you’re trying to get your opponent to fuck you, you’re failing miserably.”
“Thanks,” you grumbled.
“Hey, you were the one who asked me for help!” He shrugged. “If you want to back out now-”
“No, I don’t want to back out,” you sighed. “I’m fucking desperate at this point.”
“So, are you gonna do what I say, then?” he asked, folding his arms over his chest.
“Yeah,” you mumbled. “How am I supposed to stand?”
He walked up behind you and put his hands on your hips.
“Stick your butt out a little,” he instructed and you did as he asked. “Alright, now when you bend over,” he moved his hands up and forward, resting them on your lower chest, “you’ll want to point your breasts in the direction of the person you want to attract.”
“What if he’s standing behind me?” you asked.
“Then his eyes are gonna be glued to your ass,” he replied, not getting the message. “If he’s standing behind you then focus more on the actual game, and less on where you’re pointing your boobs. Trust me, though, if he’s standing in front of you, he’s gonna be trying to see down your shirt, now…” he walked back around to the other side of the table. “Bend over, and before you hit the ball, make eye contact with him.”
“Okay…” You bent down and lined up your shot before looking up and into Dean’s eyes.
“Perfect! If you look at him kinda like through your eyelashes, there’s exactly one thing that’s suddenly stuck front and center in his mind.”
“And this works on…all guys?” you asked, still looking at him through your lashes.
“If he was standing where I am and didn’t want to fuck you, he’s either related to you or just not into chicks.”
“Good to know,” you mumbled, mostly to yourself. You were about to start the game but a few strands of hair fell on your face.
“Don’t move,” Dean said before he hurried back to where he had been before and tucked the hair behind your ear for you. “Now, since he’s already thinking about that one thing, is that something you want him to think about even more?”
“Um, yeah,” you said quietly.
“Alright, pout your lips,” he instructed. He moved his hand down from your ear and tugged your lip out a bit. “Perfect, that’s gonna draw his attention to your lips.”
“So, now I start actually playing the game?” you asked, not sure if he had any more pointers for you.
“If you want. Or we can go over to the bar where there are three different guys that have been eyeing you the past ten minutes.”
“Really?” you stood up straight, whipping your head around. You saw the guys he was talking about and they all quickly looked down at the drinks in front of them. “Let’s go to the bar, then.”
“So, now that you know all those guys are interested,” Dean said as you both took your seats at the bar, several stools away from the other people already there, “you need to pick one.”
“Isn’t that the easy part?” you laughed a little.
“Oh no, most guys are monsters.” Dean shook his head, motioning the bartender over with his hand. “What’re you drinking?” he asked, looking at you.
“Just a beer’s fine,” you said, a little confused. Usually when you, Sam, and Dean went out drinking you each ordered your own drinks. Dean took initiative and ordered two beers. “And I know before taking someone back to my room I have to do the usual tests; holy water, iron, and silver.”
“Not those kinda monsters, sweetheart,” Dean said. “The guy on the far right has a little motor home keychain attached to his keys. Given the fact there’s a dilapidated RV parked outside that looks like a serial killer’s lair, I’d say he’s a creep.”
“Well, what about the guy in the middle?” you asked.
“I heard him talking with someone on the phone in the bathroom earlier about the fact his ex-girlfriend doesn’t know she got the clap from him.”
“Dear lord,” you groaned, making a disgusted face. “What’s wrong with the guy on the left?”
“Well, uh…” Dean started, looking at the man you were talking about and trying to find something wrong with him. “Nothing. If he comes over here, I’d say it’s worth a shot.”
“Shouldn’t I go and talk to him?” you asked.
“Oh no! No, no, no! Bar like this, pretty girl like you; he’ll think you’re a hooker.”
“Oh.”
“I mean, unless you wanna make a couple hundred bucks tonight?” he teased, earning a smack to his upper arm. “I’ll take that as a no,” he laughed.
“I’d make at least four-hundred,” you scoffed.
“Look, you’re cute and sweet and guys tend to turn their heads when you walk by them. Now, for your next lesson, take a look around the bar and tell me how many women you see.”
You looked around, counting in your head. “Five, including me and the bartender,” you said.
“And how many guys?”
“I’d say like twenty at least?” you estimated.
“Exactly,” he said. “See, at least half of those guys have their eyes on you. When we were playing pool earlier I guarantee you they’d have done anything to be where I was.”
“So…what’s your point?”
“You’re way above any of these guys’ leagues.” He shrugged. “Which is okay, but you need to know that you’re too good for them, just a fact. They’re spending their Wednesday night in a bar looking for a hookup, you came here to get a drink with your friend. So, like I said, you are in fact way out of their leagues.”
“You really think so?”
“Please tell me you’re joking,” he laughed a little then looked at you and realized you were serious. “Oh dear god, yes! Not only are you fucking gorgeous, you’re smart, funny and a total badass! I mean you killed two vampires this morning!”
“Thanks, Dean.” You smiled.
“Of course,” he replied. “Now, before we head back to the motel is there anything else? You know how to kiss someone, right?”
“Ha, ha!” You smiled sarcastically. “I know how to kiss, Dean. But, I actually do have a question.”
“Shoot!”
“What about…the friend zone?”
“You wanna know how to friend zone a guy?” He furrowed his brows.
“No, how do I get out of the friend zone?”
“Oh.” He nodded. “That’s, um, I’m actually not sure. And I didn’t think you had friends?”
“Again, very funny Dean,” you laughed somewhat sarcastically. “What if I’m good friends with a guy and I really like him, but I’m scared to tell him because I don’t want to lose the friendship?”
“Look, Sam loves you but he doesn’t see you…that way,” he said.
“It’s not Sam, dumbass,” you said. “I have plenty of friends! And there’s this one friend, who’s a guy that I really like. I don’t think he feels the same way, but it’s driving me absolutely crazy that I can’t just tell him.”
“I, uh, I don’t know. I mean, I always think the guy has more to lose if that situation goes south, cause he’ll always be attracted to the girl but she might…get bored with him.”
“But what if the guy doesn’t like me back? What if I tell him and he says ‘gross, you’re like a sister to me’?”
“If he does see you as a sister, he’s not gonna say ‘gross’ when you tell him how you feel?”
“How do you know?”
“Cause I know Sam and he’d be lucky to have a girl like you.”
“It’s not Sam, you moron!” you exclaimed, a little louder than intended.
“…Garth?”
“What if the guy I really like is also really dumb?” you asked.
“I mean, I wouldn’t say Garth is dumb…”
“Oh my god,” you groaned. “Yeah, never mind.” You put your face in your hands for a moment before starting to drink the beer Dean had ordered for you. He watched you with furrowed brows and it felt like an eternity (really it was about sixty seconds) before he suddenly broke the silence.
“Holy shit!” he exclaimed. “Is it…me?”
“I’m sorry,” you said, looking over at him. “I didn’t plan on letting that slip tonight, I swear.”
“But, it is me? You like me?” Dean asked, you nodded. “Oh my fucking god!”
You couldn’t tell if he was happy and you were beginning to really worry.
“I’m sorry,” you said quietly. You turned on your chair to leave but he gripped your upper arm and kept you in place.
“No, don’t—fuck! I feel like I just won the fucking lottery and I just need a second to catch up.”
“Wait, you’re happy? You…You like me too?”
“Oh yeah,” he nodded, “I may be stupid but I’m not an idiot.”
“Well…” you teased.
He rolled his eyes, still smiling; “Just let me kiss you, already,” Dean muttered. He put his hands on your cheeks, stood up off his chair, leaned toward you, and kissed you deeply. His hands moved to your shoulders then down to your lower back as you put your hands on his cheeks.
“Wait,” you mumbled, pulling back slightly.
“What’s wrong?”
“Nothing, you’re incredible! I’m just now realizing how many creepy guys are staring at me.”
“Told ya,” he said, taking a look around the bar.
“Could we, maybe…head to your motel room?” you asked somewhat nervously.
“Are you sure?” he asked.
“Hundred percent.” You nodded vigorously, looking at his lips then up and into his bright green eyes. “Unless…you don’t want to?”
“Oh I definitely want to, I’ve wanted to since Sam and I picked you up after he left Stanford,” he said.
“And you didn’t say anything? Dean, it’s been like ten years?” You furrowed your brows then noticed he actually seemed a little embarrassed. “For the record, I’ve wanted to kiss you for about twelve.” His eyes widened.
“What? Wow, I guess we’re both a little stupid,” he laughed a little before leaning in for another kiss.
“Excuse me, Winchester?” You quirked a brow, looking at him.
“I mean, you’re smart, so smart,” he rambled a little. “And sexy, so fucking sexy.” He kissed you and you kissed him back, smiling against his mouth. “Let’s get the hell outta here, sweetheart.”
“Mmh, just another minute,” you mumbled, not wanting to stop kissing him.
He pulled away after a moment, both of you smiling.
“My god you’re beautiful.” He smiled, putting a hand on your cheek.
You hopped off the stool but stayed looking into his eyes; “You’re so fuckin’ hot, Dean Winchester,” you mumbled and kissed him again, pulling him down by the collar of his jacket.
He pulled out his wallet and was about to pay for both drinks but you stopped him.
“What’s wrong?”
“If you pay for my drink then this would count as our first date,” you said.
“Huh, I didn’t think of it like that,” he replied. “Alright, we each pay for our own drinks.”
“Exactly.” You nodded and took out your own wallet, each of you leaving a ten on the counter. “Now, shall we go to your motel room?”
“I’m sharing a room with Sammy,” he said.
“My motel room it is.” You pulled him down again and kissed him.
“Lead the way.”
**
You woke up to the sound of Dean snoring lightly behind you and a smile formed on your lips as you recalled what had happened only a few hours ago. You felt Dean’s arm snake around your waist and he pulled you closer to him.
You assumed he was awake now and you turned to kiss him but he was actually still snoring. The thought that he wanted you closer to him even when he was sleeping made your smile deepen.
A wave of calmness washed over you, followed by an unnerving idea; how serious was Dean when he said he liked you?
Did he think this was a one-and-done situation? Were he and Sam just gonna drive off in that beautiful Impala and leave you to start hunting alone?
You hadn’t hunted alone since re-connecting with the Winchesters back in ‘05. Before that you’d been hunting alone or with Dean while Sam was in college. Before that you’d hunted with your dad, who occasionally worked with John.
You honestly didn’t really remember the first time you met Dean. You were both just kids and you blocked out a lot of your childhood due to the fact you’d been hunting your whole life. (It was actually a similar story to Dean’s—after a monster killed your mom, your dad became obsessed with hunting and seemed to forget he was a father with a four-year-old in the back seat of his pickup truck.)
What you did remember was the first time hunting alone with Dean. You were twenty-two and (finally) not hunting with your dad when you ran into Dean who was also hunting alone. He had recently had some kind of falling out with Sam, who had been at Stanford a couple years already. You remembered how Dean reacted to the fact you were hunting alone.
He was genuinely worried for your safety and insisted he hunt with you for a while. You took him up on the offer and spent a couple months together before parting ways but still staying in touch.
You were drawn back to the present when Dean let out a breath of air as he stirred awake.
“Good morning,” he mumbled, a smile on his full lips when he opened his eyes. He sat up on his elbow and tilted your chin up with his finger. “My god, how are you so beautiful?” You giggled a little before he bent down and kissed you.
He sat up further and slipped an arm under you, bringing you to the center of the bed. He caged you beneath him by putting his hands on either side of you as your hands went into his already ruffled hair. You brought him back down and kissed him again, his left hand moving again and trailing down your side, bringing your bare thigh up to graze his own.
You could tell where things were going so you stopped him, “Dean.”
“Y/n,” he mumbled back.
“Dean, wait,” you said quietly.
“What is it?” he asked, looking down at you.
“How, um, how serious is this?” you asked.
“What?” He furrowed his brows a little.
“Is this a one-night thing?”
“Oh,” he realized. “Um, it can be, if that’s what you want.”
“Is that…what you want?” you asked.
He looked into your eyes and slowly shook his head negatively, your smile returning to your flushed face.
“I was kinda thinking this would be at least a two-night thing,” he said, showing off his adorable smirk and making you roll your eyes a little. He bent down and kissed you. “Maybe a three-night thing.”
“A four-night thing?” you teased.
“I think you’re gonna be stuck with me for a lot longer than that, sweetheart,” he mumbled into your mouth.
“You really think?” you asked, smiling.
“Hate to break it to you, but I’m kinda in love with you.” He stopped kissing you, realizing what he said. “I, uh, I mean, not—fuck, I really am. I’m sorry.”
“Dean,” you interrupted his spiraling, “I’m kinda in love with you too.”
“Oh thank goodness,” he whispered and kissed you again.
1K notes
·
View notes
━━ wellie elliams
pairings : streamer!ellie williams x reader
warnings : use of yn, mentions of using weed/nic, lowkey self inserted uhh, more focus on ellie than ellie x reader
cr : @idontgetanysleep & @animatedglittergraphics-n-more
a/n : guys i really enjoyed doing this, had a thought of ellie's reactions to read fics about her, her edits (esp with the ai audios, shout out to akemi, i love her) & fan arts
DAILY CLICK
DONT BUY TLOU
WAYS TO HELP PALESTINE
👾 starts off doing streaming just for fun & thinks to herself that no one’s gonna watch it until people actually enjoy watching her play.
🎮 definitely play minecraft and would argue with KIDS on roblox and get competitive with them while playing.
🕹️ OBSESSED WITH FORTNITE LITERALLY A FUNDRAISER TO FORTNITE
👾 definitely would say this "i can cook, clean and carry you on fortnite" to flirt with girls
🎮 she definitely has a cat(s) and people would always want it on the stream
🕹️ i can totally see her raging while playing valorant lolll and would definitely waste money on the skins too.
“okay chat, should i buy it? nah, im just gonna buy it” the chat floods with saying no but will she listen to you guys? no.
“okay, i just bought it! watch my aim get better chat” her aim DOES NOT get any better lol but at least the skins are pretty!!
👾 she’s surely shy at first and won’t show her face, hell even her hands !! she just shows what she's playing and just talk
🎮 would try to be social with her “fans” as much as possible cause she likes to hang out with them.
🕹️ would do a face reveal after she hit the milestone!! and people would go CRAZYYYYY. i mean who wouldn’t, right? it’s ellie williams!!!
👾 she probably would be active on twitter more and sometimes on tiktok and rarely on instagram (just to update story and her feed)
🎮 tweet the most unhinged things YET doesn’t get cancelled because somehow all of her tweets are kind of relateable…
🕹️ other than streaming her gameplay she would definitely do some reaction, play her guitar and sing, reviewing things that are so useless & stupid
👾 talking about reactions, SHE WOULD TOTALLY REACT TO THE EDITS, ART AND FICS ABOUT HER (she thought it was funny and some of the fics are BEAUTIFULLY WRITTEN)
smelliewilliams : OH NO SHE KNOWS
iloveellie69 : uhh yall better hide !!!!
livelaughloveellie : ellie pls dont react to it 😇
simpforels : FOR YR OWN SANITY!!
“chat, you’re going crazy” she scoffed.
few minutes later…
“oh wow, that sure is something! haha uhm…”
"the technology is getter scary, how does she makes it sounds like me. like does that not sound like me actually saying it?? it's really impressive" her reacting one of the edits with ai audios that sounds like her
“YALL ACTUALLY REALLY GOOD AT DRAWING”
🎮 she appreciates all of your edits, fics and arts! would totally do friday fanarts or something like tom felton would do lol!
🕹️ people BEG her to do vlogs, cause it would be fun and silly vlogs!
👾 her music taste is 👩🍳 💋, source? trust me bro.
🎮 people would want her to do a room tour cause somehow she keeps her room clean & tidy but also a really cool room
🕹️ small lights >>>>>> big lights
👾 people would be shocked if they knew how smart ellie is 😭 a major nerd if you ask me ! there's no doubt that she starts to share some fun facts that she knows & takes some online quizzes to prove that she's smart
🎮 would totally go on omegle and just troll or make new friends
🕹️ that is where she met you !!
you were bored one night and decided to go on omegle just for fun and you met her there.
although ellie's platform is big, she still doesn't know half of the influencers or streamers so her chat goes CRAZY when she sees you and is like
matchalvr : OMG IS TGAT YN ????
smelliewilliams : ELLIE YOURE SO LUCKY
justanormalgirl : MY TWO WORLDS COLLIDING
“wait a second, are you yn?” she asked
”that’s me”
“why is my chat going crazy about you?” her eyes scanned the chatroom.
“hold on, you do streaming too?”
👾 started to play with you more and she would occasionally join your stream and support you there if she can't play (since the timezone sucks)
🎮 people start shipping you two and one-day ellie liked an edit of you and her (which is super hot and the audio is boaf? BOAF!! , pls get what i mean 😢) and the fandom went insane
🕹️ the two of you started to get close and plan to meet each other sometime in the future
👾 LOL WOULD TOTALLY DO THE “when the gc makes it to the hang out” TIKTOK, the gc is being JUST the two of you 😭
🎮 she would either have an energy drinks, juice or water on her table.
🕹️ her sleep schedule is FUCKED UP, that’s explaining her dark circle & eyebags.
👾 love when people greet her at public place, she just love meeting her fans
🎮 oh im pretty sure she goes to the twitch con (?) thingy and would probably go with you as your date hehehehehehehhehehehe
🕹️ have figurines and legos displayed in her room
👾 super open about her using weed & nicotine (to sleep)
🎮 is open minded and an open book
🕹️ would do "my anons dark secrets confession" thingy
👾 OH SHE WOULD DO ASMR FOR FUN & people actually enjoyed it lol
🎮 she would play dress to impress with you
🕹️ STREAMING TOGETHER WITH YOUUU
👾 when the two of you are officially dating, both of you wear "i love my hot gf" every single streaming session
🎮 she loves matching bro so matching avatar in games
🕹️ would talk about you 24/7 EVEN WHEN SHE DIDNT MEAN TO
"oh me and my gf just-" , "chat, me and yn are-"
elsyngfs : OKAY ELLIE WE GET IT!!!!!!!!
ynssimp : i get it ellie, i too would talk abt her a lot
ynaalyn : WHERE DO I FIND THIS RS GUYS
idwtowatchellie : BRO UR R A LOSER GF
smelliewilliams : gosh imagine if they're not ldr...
in conclusion, she's literally a loser lovesick lover girl
REMINDER !!
that neil is a zionist and therefore dont buy his games, doesnt matter remastered or not !!!
before you leave, have you DONATE TO PALESTINE today? ITS FREE TOO !!
667 notes
·
View notes
a safe haven l ten
Post Outbreak! Joel Miller x Female Reader
series masterlist l previous chapter l next chapter
summary: After a long night, Joel and Ellie take you home.
warnings/tags: 18+ ONLY, MINORS DNI. (TW) THIS CHAPTER CONTAINS MENTIONS OF DOMESTIC VIOLENCE, MENTIONS OF AN INJURY SUSTAINED FROM AN ACT OF DOMESTIC VIOLENCE, PREGNANCY, CONVERSATIONS SURROUNDING PREGNANCY LOSS . PLEASE HEED THE WARNINGS. Ellie and reader are very close to each other, Joel deals with feelings of guilt, Joel and Maria make nice, Joel gives reader a bath and washes her hair, food consumption (i am just gonna apologize to my lactose intolerant folks right now, trust me i must pretend with you), both reader and Joel have some big feelings, reader mentions her deceased father, angst, soft and domestic Joel, fluff.
word count: 5k
a/n: i have not updated this series since october. :l i feel a a mixed bag of emotions updating after all this time, but most of all, i am grateful to know there are a couple of people out there who are still invested in this story. to anyone who has been waiting: truly, it means the world that you have shown me patience, support, and kindness. believe me, i am going to be seeing this story to the end, and it is all thanks to those who continue to show this lil story of mine a whole lotta love. special shoutout to the loveliest human @mrsmando who made me this beautiful mooodboard every single time i got stuck during this chapter, i looked at it and it gave me the boost of inspiration i needed. thank you mimi <33
this chapter is fairly tame, the next chapter is already in the works, and there are a couple of time jumps coming. overall, we are down to the last handful of chapters. let’s finish this story and give these two the ending they deserve, shall we?
“What the hell is taking Tommy so fucking long?” Ellie whines. She’s sprawled out on the couch with her head in your lap, and her arm draped over her eyes. Her feet are hanging, dangling over the edge of the couch at an odd angle after you’d warned her not to get muck from her sneakers on the linen fabric. Despite Joel insisting over and over that she head on back to the house, she had stubbornly refused, not wanting to leave your side. “It’s been over two hours! He’s taking fucking forever, man. What’s the fucking hold up?”
Joel bites back a sigh, masking his own impatience. Or at least, he tries. He’s grown just as restless as the kid, if not more. Much like Ellie, he’s desperate. He’s itching to take you home already, almost too anxious to watch you take that first step over his threshold, and into your new life with him and with Ellie. He aches, aches, to get you settled into the place where you would be spending the remainder of your days with one another, where you would be safe, and loved in the way you deserved to be loved—the place where he would cherish and adore you until his final breath.
“Don’t know,” he answers, his voice sounding rougher, more gruff than usual. Reaching up, he scrubs his hand down the side of his face, adding tiredly, “He might be a while longer, kiddo. It could be another hour, could be more. Like I already told you, s’probably best if you just go on and head back to the house without us, alright?”
“No. I’m not walking out that fucking door unless she’s with me.” She pauses and pulls her arm away from her face for a moment, just long enough to throw a teeny glare his way. “Unless you’re both with me. The three of us go home together, or it’s no fucking deal. Got it?”
He shakes his head in utter exasperation.
“Ellie, we’ll be right here down the fuckin’ road—”
Her hand shoots out and she flips him off.
Just when he’s about to chastise her, he stops himself, clamping his mouth shut. It’s pointless.
Kid’s too goddamn hard headed for her own good, and Joel knows he’s just wasting his breath with her.
“I’m sure he’ll be back soon,” you reassure them both, weaving your fingers through her hair to scratch at her scalp in an effort to soothe her. “Right, Joel?”
He meets your exhausted, worn down gaze from where he’s standing across the room, and his heart lurches in his chest. As the guilt begins creeping in, he’s forced to look away. He can’t imagine the living hell you had been through over the last twenty four hours alone. And the worst part about it was the realization that last night, while he was fast asleep in bed just a couple of houses up the road, that fucking bastard had his belt wrapped around your throat.
Joel feels sick to his fucking stomach all over again.
Horrifying, vividly real images of you helplessly trapped underneath Luke scratching and clawing at the leather around your neck with trembling fingers, struggling to breathe oxygen into your burning lungs as he tugged it tighter and tighter through the buckle flash in his mind, a gruesome nightmare turned into reality.
Exactly how far had Luke taken it?
Until you had grown too weak to keep fighting?
Until you almost lost complete consciousness?
Until he noticed the life threatening to leave your eyes?
Is that when he had finally stopped pulling on the belt?
Joel shudders, a bitter taste climbing up his throat as it sinks in. He could have lost you—and his unborn child.
This shouldn’t have happened.
He shouldn’t have let you walk away that night.
This wouldn’t have happened if he hadn’t let you walk away from him that night.
“Joel,” you say his name, quiet and weary.
His head snaps back in your direction and he glances at you, almost missing the subtle shake of your head. It is a silent warning telling him not to go there, though you know by the tight clench of his jaw it’s too late for that.
Joel makes the futile attempt to hide it, but he sees it written all over your face—you know what he’s thinking because you know him like the back of your own hand, and you just know he’s placing all of the blame for what happened to you on his own shoulders.
But can you honestly fault him for that?
How can you expect him not to feel like he is somehow responsible for this? Just how the hell is he supposed to make himself believe he hadn’t failed you?
Joel promised—he had fucking promised you—that he wouldn’t let anything bad happen to you. He had sworn to keep you safe, made a vow to protect you from Luke, but here you are, your soft, delicate flesh marred with the painful evidence of yet another one of his failures.
And it was all because he had let you walk away on that fucking night.
He should have done something.
Even if it meant running the risk of you never speaking to him again—even if you never forgave him, spent the rest of your life angry and hating him for going against your wishes. He should have something.
“Joel—”
“Be right back,” he mutters, lightly shaking his head.
Shoving away from the doorframe he’s leaning against, Joel pivots on the heel of his boot and starts down the hallway. He walks into the kitchen where he finds Maria standing at the counter, tapping her fingers against the smooth, laminated oakwood as she waits for the coffee she’d offered him a few minutes ago to finish brewing. She’d offered to whip up a quick supper, but food was the last thing on everyone’s mind.
“Tommy’s been gone for a couple hours now. Girls are startin’ to get real tired of just sittin’ around waitin’ for him to come back,” he tells her, exhaling the sigh he’d held back in the living room. “What do you think could be keepin’ him so long?”
With her back still to him, Maria reminds him, “Well, he did mention he was going to round up the council and get them together for an emergency meeting.” She lets out a sigh that matches his own—it’s been a long night for her, too. When the last drop of dark roast drips into the glass pot, she carefully takes the pot by the plastic handle and pours the steaming coffee into a speckled, white and blue ceramic mug. “Do you take it with milk and sugar?”
“No thanks, that’s alright,” he declines as politely as he can.
“I also have cinnamon if you’d like?”
“Plain black’s just fine.” He gives her a nod of gratitude when she hands it to him. “Thank you. And I don’t just mean the coffee, but for, uh—for bandagin’ up my hand for me, too.” He clocks the brief look of surprise on her face and almost laughs. He doesn’t blame her for being taken aback, because truth be told, so is he. Since he’d met Maria, he had known she didn’t trust him as far as she could throw him. There was something of a mutual understanding between them, a silent agreement they had made to keep each other at arm’s length, to only interact when it was absolutely necessary.
Never did he think he would be standing in her kitchen, thanking her for patching up his hand, and for making him a cup of coffee out of the kindness of her heart.
His brother wouldn’t believe it.
“Don’t mention it.” Crossing her arms over her chest, she leans back against the counter. “How’s it feel, by the way?”
“S’fine,” he replies, shrugging. “Nothin’ I can’t handle.”
There’s a momentary silence. A taste of tension lingers over their heads, and he knows at one point or another, he’s going to have to address the affair, the very reason everything had unfolded in such a terrible manner.
Guess now’s as good a time as fuckin’ any, he thinks to himself with an inward sigh.
Joel lightly clears his throat. “Listen, since we’ve got a minute alone, just the two of us, I was wonderin’ if, uh—if we could talk ‘bout somethin’? If that’s alright?”
“Of course.” Maria gives him the floor.
“I know that she—” Pausing, he shuffles from the heel of one boot to the other, his ears burning hot. He had known it wouldn’t be an easy conversation to have, but he underestimated just how uncomfortable it would be, regardless of what she already knew. “I know she told you and Tommy all ‘bout us, and ‘bout our relationship. See, the thing is, the first time I saw her—”
Again, Joel stops, the burning sensation now radiating, spreading from his ears to his face and down his neck, flushing his skin a deep, deep shade of pink. Unable to meet his sister in law’s gaze, he glances down into his mug, as if he will somehow find the right words to say somewhere in the depths of his coffee.
“It was never my intention, y’know,” he finally says after a minute. “Goin’ after a married woman. I swear, I never meant to fall for her. I just fuckin’ did. I think I might’ve fallen for her long before I even met her,” he confesses. He feels himself darken to a shade of maroon under her curious stare. “And somehow, for reasons I ain’t all too sure I’ll ever understand, she fell for me too.”
Maria raises an eyebrow at him. “Look, I’m not judging you, Joel,” she assures him, shaking her head. “If that’s what you’re thinking. I’m not judging her, either.”
He looks up at her, blurting out, “You’re not?”
She moves her hands to cradle her swollen middle. “Do I wish you two had handled everything differently?” she answers her own query with a nod of her head. “Oh, I’m sure we all do. But I’ve known her for a long time now. I know the kind of woman she is. And I’m starting to see the kind of man you are.”
“And what kinda man is that, Maria?”
He waits without the slightest clue as to what she could possibly say.
“Since you came back to Jackson, I’ve chosen to keep my distance from you—but make no mistake, I’ve been watching you like a hawk since day one. Waiting for any signs of trouble. Waiting for you to fuck up. Waiting for you to give me a good reason to throw your ass out of this community because I didn’t trust you. Not after all the things I was told about you.”
He snorts. “You goin’ somewhere with this?”
“You are not who I thought you were,” Maria admits, smiling wryly. “I’ve gotten to see a different side of you. You pull your weight around here by doing your job and doing it well. You stay out of trouble—for the most part. And more importantly, I have seen the way that you’ve stepped up to be a father figure to Ellie. It takes a good man to do that, Joel.”
“Think that’s the nicest fuckin’ thing you’ve ever said to me,” he muses, setting his mug down on the counter. “I stepped up because I love her. I love them both. Those two, they’re the best parts of me. They’re the reasons I keep goin’ and now I’ve got another reason on the way.”
Maria smiles, but it vanishes as quickly as it appears.
Catching her hesitance, Joel asks, “What? What is it?”
“What comes next is not going to be easy,” she warns him, lowering her voice. Even with the living room a fair distance from the kitchen, she doesn’t want to run the risk of you overhearing her. “For as hard as we’re going to try to contain the fire, it will spread, and everyone in this town will find out about everything—including the affair. People are going to talk, and believe me, they’re going to have a whole lot to say about it, Joel.”
He can’t help but roll his eyes at her.
“Think I can handle some fuckin’ gossip, Maria.”
“I know you can. But I’m not sure if she can,” Maria tells him, quietly. “It worries me. She’s been through a lot in just one night alone. I don’t want her stressing anymore than she already has. She is in a very delicate stage of her pregnancy right now, Joel. If she’s not careful, she could have a miscarriage. She had one about two years ago when her father became sick—” Observing his lack of a reaction, she realizes, “You knew that already.”
“Yeah,” he sighs. He knows where she’s going with this. “I did. She told me ‘bout it.”
“It makes her chances of having another one higher—”
Joel doesn’t even allow himself to think of it happening to you again. “I get it,” he interjects, trying not to sound too curt. “I’ll make sure she takes it real easy, alright?”
Lifting a hand off her belly, she reaches out and takes a hold of his forearm, gripping it tightly.
“Promise me something, Joel. Promise me that you’ll look after her,” Maria pleads him, gently. “Please. After everything she’s been through—I need you to promise me that she’s going to be in good hands with you.”
He nods. Without thinking, he places his hand over hers in an unexpected token of affection and reassurance. “You have my word, Maria. I’ll take good care of her.”
She gives his arm a grateful squeeze, then glances over his shoulder at the clock on the wall. “It’s getting pretty late. We don’t know how much longer Tommy’s going to be with the council. Why don’t we just go ahead and call it a night?” she suggests. “We can all get together first thing in the morning at your place to talk about it.”
“Yeah, good idea,” he agrees. “She really needs to rest.”
Maria gives his arm another squeeze.
“Go on then, Joel. Take your girls home.”
“Finally!” Ellie exclaims with a dramatic flail of her arms as she shoves through the front door.
“Alright, kiddo. Get your behind upstairs and into the shower,” Joel instructs her, flipping on the lights in the foyer. “Y’smell like fuckin’ horse shit.”
She lifts the collar of her shirt to her nose, takes a whiff, and makes a face. “Yeah, I won’t argue with you there,” she mutters. She toes off her dirty sneakers and leaves them beside the door before dashing up the staircase, taking two steps at a time.
He shouts after her, “And don’t use up all the hot—”
“Yeah, yeah, I fucking know the rules, dude!”
Moments later, you both hear the shower going.
“Little shit,” he grumbles.
You exhale an amused huff through your nose.
Joel withdraws his arm from around your shoulders and reaches for your hand, lacing your fingers together. “C’mon, darlin’.” He guides you up the stairs and down the hallway into his bedroom where he switches on the light before proceeding to lead you over to his dresser. “I’ve got a bunch of shirts in this top drawer here,” he says. Dropping your hand, he pulls it open for you and gestures to it with a jut of his chin as he takes a step backwards, moving out of the way. “Go ahead and pick one to sleep in tonight. Want you to be comfortable, so help yourself to whichever one you want, sweet girl.”
Nodding, you begin to rummage through the drawer, unaware of the moment he slips away. You reach for a t-shirt, but then a plaid green flannel catches your eye. You pluck it from the drawer, running your fingers over the soft, warm fabric. “Is it alright if I wear—?” You turn around, stopping mid sentence when you realize he’s no longer standing behind you. Puzzled, you follow the sound of running water into the bathroom where you find him kneeling beside the tub. “Joel? What are you doing?”
“Runnin’ you a bath.”
You notice the bloodied bandage beside him on the tile floor. “Joel, are you serious?” you scold him. “Maria just patched your hand up for you.”
“S’okay, peach. I can rewrap it when we’re done.” Joel sticks his injured hand under the faucet to check the temperature, the cold water soothing his cuts. Once it turns warm, then hot, he pulls out his hand, waiting for the tub to fill halfway before shutting the faucet off and rising to his feet. “C’mere, sweetheart.” He rolls the sleeves of his shirt up to his forearms, then beckons for you with both of his hands. “Let’s get you washed up.”
You remain standing by the door. “Joel, you don’t have to do this for me.”
“I know.”
“I’m capable of washing myself—”
“Yeah, I know that too,” he says, chuckling. “S’only fair, darlin’. Don’t you think?”
That’s when it hits you—how this moment is mirroring that night you had cleaned Joel up after you and Ellie had brought him home from the clinic with an injured shoulder. He allowed you to take care of him, and now, he was looking to do the same for you. And all you had to do was let him.
“But your hand—”
“Will be just fine,” Joel persists, stubbornly. “It’s nothin’ but a few cuts and scrapes. C’mon—or else I’m gonna march right over there and get you myself, peach.”
Knowing Joel, you certainly wouldn’t put it past him to throw you over his should and carry you to the bathtub.
“Fine,” you relent with a small sigh of defeat.
Setting his shirt down on the sink, you slowly walk over towards him and whirl around, letting him help you out of your knitted cardigan. You finish undressing yourself, inhaling a deep breath as you muster up the courage to turn back around and face him—when you finally do, it feels like a punch to the gut to see the heartbreak in his dark brown eyes, the subtle tremble of his bottom lip. You don’t have to look at yourself in the mirror to know it looks about a hundred times worse when you’re not wearing clothes.
Keeping your arms down at your sides, you fight every urge to cover yourself up. You’ve never felt so fucking vulnerable.
Clearing his throat, Joel holds out his hand. “C’mere.”
You accept it, and he helps you into the tub.
“How’s the water? S’not too hot, is it?”
You shake your head and he leans forward, kissing your temple so sweetly, your eyes flutter closed.
He washes your hair first, then takes a clean washcloth, lathering it up with a bar of milk and honey soap—the same soap he would smell on your skin all those nights. Admittedly, Joel preferred castile soap, but switched it when he found himself missing you during those weeks you were apart from him, when he needed the comfort of your scent. He is gentle with you, so gentle, as if he’s afraid you’ll shatter into pieces in his hands.
As he lightly drags the washcloth up your back and around your neck, you stiffen, prompting him to freeze too. “Fuck. Baby, did I hurt you?” he asks, and you hear the slight panic in his tone.
“No,” you say quickly, desperately trying to swallow the lump rising in your throat. “No, you didn’t hurt me. It’s just—” Every overwhelming emotion slams into you all at once, and you can’t seem to figure out which one to feel first. Humiliation? Fear? Relief?
The water sloshes around you as you pull your legs up to your chest and wrap your arms around your knees, giving yourself permission to feel them all. Bowing your head, you begin to sob quietly, hoping that Ellie, who is just down the hallway, won’t hear you crying again.
Joel says nothing. Washcloth still clutched in his hand, he leans forward over the edge of the tub and wraps his arms around you, pulling you close, or at least, as close as the barrier between the two of you will allow him.
“Joel,” you choke, trying to push him off. “Stop it. Your clothes, they’re getting all wet.”
“Hush. Don’t fuckin’ care ‘bout my clothes,” he croaks, and for a second, you swear he’s about to cry too. But he doesn’t. He holds himself strong. Tugging you closer against his chest, he buries his nose into your soaking wet hair, whispering his reassurance. “You’re okay, baby. You’re safe, my sweet girl. I’ve got you, alright?”
He pulls back slightly, dipping his hand into the water, placing it on your lower belly.
You look down, your eyes glazing over his bruised and battered knuckles. Proof that Joel Miller really would do anything for you.
“I know you do,” you say, softly. “I know you’ve got me, Joel.”
A while later, you’re dried, dressed, and composed. You follow Joel out of the bathroom and back into his room, where he has you take a seat on the bed. Noticing you had missed a button on his flannel shirt, he does it for you. He plants a kiss on the top of your head and says, “Give me a minute while I change.”
He peels off his wet clothes, being careful so as not to further agitate his sore, injured hand. After changing into a pair of gray sweatpants and an old, faded black t-shirt, he turns around only to find you’re sitting in bed underneath the covers.
“Sorry,” you apologize with a nervous chuckle as you rest your back against the headboard. “It just looked so warm and cozy—and it smells like you. I couldn’t resist making myself comfortable.”
Joel pads over to the side of the bed. He leans over, planting one hand on either side of you as he dips his head and brushes his lips against yours. “Ain’t got no reason to apologize, baby,” he assures you in a gentle murmur. “This is your bed now too, peach. This is your room. This is your home. Alright?”
Home.
You’re home.
He touches the tip of his nose to yours, and then draws himself back up to full height. “There’s somethin’ that I’ve gotta take care of downstairs, peach. I won’t be too long,” he promises.
It’s almost midnight. Joel goes about the kitchen and he prepares you the quickest meal that he can think of. He plates the sandwich he’d thrown together and pours a glass of cow’s milk—he’s always sure to keep a pint of it in the refrigerator to make the kid her oatmeal in the mornings.
He heads back upstairs, only to find that while he had been gone, Ellie had joined you, making herself a little too comfortable on his side of the bed. He stands there at the door, watching the two of you.
“Hey, so is it true babies can hear stuff while they’re in there?” Ellie questions you, curiously.
“Mhm,” you reply with a nod. “They can hear music, for example. Voices—”
“Voices?” She smushes her face into your stomach and he hears a muffled, “Hey, dude!”
You giggle. “Ellie, I think it’s still a little too early.”
“When do you think it’ll be able to hear me?”
“I’m not too sure. In a few months, maybe?”
Ellie lifts her head, humming. “You know, I bet there’s baby books in the library,” she tells you as she sits up. “I’ll have Dina help me look for one tommor—oh shit.” She stares at you with wide eyes. “Dina! How are you going to tell her and Talia about Luke?”
Joel grimaces. He hadn’t thought of that, either.
“I—I’m not too sure.”
“You have to fucking tell them. Dina has to know about him. She has to know what a piece of shit he is, and so does Talia.”
Sensing your discomfort, Joel steps into the bedroom and intervenes before she can say another word. “Ellie, get to bed. S’late.”
“But—”
“Don’t make me tell you again,” he warns her, sternly.
She huffs, rolling her eyes. “Fine.” She climbs off the bed and on her way out, she eyes the plate in his hand. “That chicken?”
“Turkey. And it ain’t for you, it’s for her. So scram, kid.”
“Couldn’t have made me one while you were at it, old man?”
“Ellie, if you don’t get outta here right now—”
“Alright!” Ellie holds her hands up. “I’m leaving. Jesus.”
She disappears, closing the door behind her.
“Pain in my ass,” Joel mumbles, shaking his head as he walks over and carefully perches himself beside you. He hands you the plate. “Here, darlin’.”
“Joel, I appreciate this, but I’m really not very hungry.”
“Maybe not, but y’gotta eat,” he insists. “Baby needs it.”
Thankfully, you accept it without further protest.
“I’ll have Ellie get your things tomorrow,” Joel states as you’re eating. “Maria can go along with her since she knows the house. They’ll get your clothes and whatever else you might need outta there.”
“My father’s belongings.” You accidentally talk through a mouthful of turkey and bread. Swallowing, you tell him, “I have some boxes of his stuff in the basement. But they’re way too heavy for either of them to carry.”
“I’ll take care of that for you.” He reaches up, wiping a breadcrumb from the corner of your mouth with his thumb. “I can ask Tommy to give me a hand. Don’t you worry, peach. We won’t leave your dad’s things behind, I swear it.”
Relieved, you shoot him a grateful look, then polish off the last few bites of your sandwich.
“Here,” he says, offering you the glass of milk. “Figured it’s good for you, and good for the baby. Y’know, since it’s got calcium and…stuff.” He shrugs sheepishly, no clue as to what he’s talking about. “Vitamins, right?”
Nodding, you grab the glass and take a reluctant sip.
“You hate milk,” Joel realizes, raising an eyebrow.
“I do,” you admit with a laugh. “But you’re right. It’s good for both me and the baby, so cheers.” And with that, you somehow force the entire glass down.
He sets the dishes aside on the nightstand, figuring he can take them downstairs first thing in the morning.
Without bothering to rebandage his hand like he’d told you he would, Joel turns off the lights and climbs into bed with you. “All those nights wishin’ I could bring you home,” he muses as you curl into his side. “Wantin’ nothin’ more than to hold you in my arms in this bed. In our bed.” His arm slips around your shoulders, a laugh rumbling through his chest. “Almost doesn’t feel real, darlin’.”
Tilting your head, you nuzzle your nose into the scruff of his beard, prompting him to laugh again. Then, he remembers his conversation with Maria, and his smile fades from his face, his lips pursing together.
You catch the sudden shift in his demeanor.
“Joel? What’s the matter?”
“M’fine, baby. It’s just—” He hesitates. “From this point forward, I need you to let me handle things.”
“What do you mean?”
“I don’t want you gettin’ all stressed out, alright? I don’t want to run the risk of you—” He’s unsure of how to say it.
“Of me losing the baby,” you finish for him, quietly.
Joel winces, knowing he was wandering into sensitive territory. “Yeah. I—I really don’t want that to happen.” He pauses. “Maria mentioned to me you’re in a delicate stage. When do you reckon you’ll stop—how long until you don’t gotta worry ‘bout it?”
“After twelve weeks, my risk isn’t as high. If I make it to the second trimester in six weeks, then my chances of having another miscarriage are lower.”
Though you speak calmly, he clocks your anxiousness.
You’re worried, and he’d be lying if he said he wasn’t fucking worried out of his mind too.
Being a father at his age wasn’t ideal, but he wanted this child. It was part of him, and more importantly, it was a part of you.
Joel squeezes your shoulders. “I only ask ‘cause I was thinkin’ that, y’know, once we get to that point, maybe I can go ahead and start buildin’ the baby’s crib.”
“You’re going to build the crib?”
He nods. “And the highchair too. I can even make you a diaper changin’ table if y’want one.”
“Joel.” You can’t help but chuckle. “Our worlds were just turned completely upside down. You just found out that I’m pregnant, and you’re already thinking about building furniture? Aren’t we getting a little ahead of ourselves?”
“Hey, those things take a whole ‘lotta time,” he says in defense of himself. “Besides, winter’s right around the corner and I don’t wanna be out in the garage freezin’ my fuckin’ ass off. If I can get a head start now, I can have them all done in the spring by the time the baby comes.”
You fall silent.
“What’s on your mind?”
“I’m really scared of losing it,” you confess. “When I first took that pregnancy test, I wanted nothing more for it to be negative. Now, I’m terrified I won’t make it past my first trimester again. I really don’t want to lose it. I want this baby, Joel.”
He turns his head, meeting your eyes in the silver light shining through the lace curtains over his window. “S’why you’ve gotta let me handle things, darlin’. Okay?”
“Okay.”
“C’mere, my sweet girl.” Joel presses his lips to yours, murmuring against them, “I love you.”
His declaration comes with natural ease.
And so does yours.
“I love you too, Joel.”
438 notes
·
View notes
R U MINE? feat gojo satoru (II)
gojo satoru has got to be the picture definition of a stereotypical college frat boy. he’s cocky, loaded with his daddy’s money, and dangerously handsome. it seems like common sense to stay away from him since you’ll never get more than a one-night stand out of it.
that’s why you choose to turn a blind eye once you’ve come to the horrific realization: you’re in love with him. and you’re just itching to ask…
“are you mine tomorrow? or just mine tonight?”
IMPORTANT: this is part TWO (and the final part) of the r u mine? mini series. make sure to read part one of this fic before proceeding! :)
content: 5.4k words, afab!reader, rich college frat boy gojo, SMUT (fingering & unprotected sex.. wrap it before u tap it kids!) ANGST, (i listened to deftones while writing the breakup era LMAOO i was in my feels 😔) gojo "everything reminds me of her" satoru is really going thru it, idk how to feel about the ending tbh, cheating implications, kinda proofread ig, more emo gojo (u luv to see it)
author's note: guys. where do i even start?? first of all, thank u for all the support on the first part of this mini series!! we also hit 100 followers on this blog so tysm for supporting me n my writing <3 here's the long awaited part two (n also the finale) as i promised that i would get it out over the weekend! just a quick announcement that i may be a little bit more inactive from here on out.. mainly because classes r starting again nd im starting to get busier. i do have more fic plans though, (and a geto smut in my drafts? 👀) so i'll make time to write when i can! happy reading and thank u for all the support on this silly little series :)
tags: @soley613 @feariteriu @bear-likes-mushrooms @96jnie @keilaq1 @whydohumansss @luftyluft @fatbootymuncher (bold = i'm unable to tag u)
reblog and interact for a kiss ;)
everything’s been hazy.
you don’t really remember how you got home– you either waved down a cab or walked until you somehow found your house. either way, the alcohol is worsening the pounding in your ears. the straps of your dress are clinging terribly against your skin–you want to take it off, you want to wear something more comfortable, you want to just go to sleep, preferably forever… but you can’t bring yourself to.
you can’t even bring yourself to move.
so the rumors really were true? but why did gojo pursue so far just for you? why did gojo say those words to you when you spent the night together? why did gojo try so hard to convince you that night that he wanted to have sex with you because he loved you–and not solely because he wanted to have sex?
why did gojo lie to you?
another series of pings sound throughout the room, and you finally move to silence your phone. the noise is all so overwhelming. why the hell is your phone blowing up?
you check your notifications–mostly dms from people you don’t know, either asking if you and satoru were dating, or questioning you about what the hell happened at the party. you know that you’re gonna be the subject of gossip once you’re back at campus, and you hate it.
you were surprised at the numbers once you scrolled down your notification list a little further. ten missed calls from satoru, accompanied by a series of fifteen panicked messages. you open it, and you stare sadly at his contact photo and name, remembering the fond memory behind it. once you two actually started dating, you were merciful enough to add a heart next to his name, and even updated it to “toru”. he was elated at that.
you think you can barely even call him gojo now.
the most recent message was barely sent a minute ago. like it was on cue, you see the bright headlights pull up outside of your door. you wanted to sink into your couch and never resurface ever again.
you hear suguru’s car door open and close, and then frantic knocking outside. you walk to the door while sniffling, looking through the peephole just to confirm your suspicions. it was satoru.
“i can hear you crying through the door, y/n. i know you’re there.” he takes a deep inhale, and the tears start rolling down your cheeks again once you hear the complete and utter vulnerability in his voice. you just don’t know what to believe anymore. “shit, i’m crying too. well, i’m gonna explain myself even if you don’t care enough to listen to me. uhm, believe it or not, what happened at the party wasn’t my doing… at all. when you went to use the bathroom, this girl went up to me and started flirting with me, like she was waiting for you to leave or somethin’. i was g’na tell her to go fuck off but she pushed herself on my lap and before i could do anything about it you walked in and it was just all horrible timing and- god. i know it sounds unbelievable, right? you must think i’m terrible right now.”
“you don’t have to believe me. if i were in your shoes i wouldn’t know what to think either. i’m just… explaining what happened.”
there’s a long period of silence between you and satoru, aside from the occasional sniffling on both ends. you don’t know what to say. you want to believe him. you want to do nothing more than to open the door and let him hold you in his arms again, but you just don’t know what to think anymore. you poured your entire heart out to a man who you knew you shouldn’t be messing with, and now you don’t know who or what to believe. you feel like a fool, and you’re just tired. so damn tired. the silence feels asphyxiating, like it's tearing your relationship with satoru further and further apart the longer it draws on.
satoru is the first one to break the silence. “i’m guessing from the silent treatment that you don’t believe me. it’s okay, y/n. i’ll wait an eternity for you to forgive me because i’ll always choose you- fuck… over anything, and i hope you know that.”
your mind is a mess, and satoru’s words make it even messier.
i’ll wait an eternity for you
i’ll always choose you over anything
you put your head in your hands and sob. it hurts.
a minute passes–gojo hears you get up from where you’re sitting behind the door, and his heart fills with hope.
“i just… i just don’t know how to believe you, gojo.”
his heart breaks when he hears the door–presumably to your bedroom–open and close, leaving him alone with his shattered heart. his heart breaks when he takes in your voice, noticing how weak and exhausted you sounded. he wonders how much you’ve cried just from this past hour alone. his heart breaks once he realizes that he’s alone with his thoughts again, alone with the voice in his head that was berating him for not being able to prevent all of this if he hadn’t frozen up and just pushed her away the second that girl started flirting with him. finally, his heart breaks once it registers that you called him gojo–the last name that he shares with his corrupt and money-crazy family… the family he tries so hard to get away from. it was also the name you called him during the days that you barely trusted him.
now, he’s back to square one, and he has none of your trust again. this time, satoru swears that he’ll do anything in his power to get it back once more.
you didn’t come to school today.
there’s been nothing but radio silence on your end. gojo has sent you countless messages over the weekend asking how you’ve been, with the occasional desperate voicemail where he tells you that he loves and misses you. you’ve turned off your read receipts, so gojo doesn’t even know if you’ve seen his texts or listened to his voicemails. he’s concerned for you, even though he knows that he’s the reason behind all of this. he was hoping to talk things out with you today.. but you weren’t even here.
one thing gojo knew about you is that you cared deeply about your academics, and you wouldn’t miss attendance even if you were sick. it pains him to know that he was the reason that you weren’t here today. you were avoiding him, and he felt helpless.
he’s talked to geto—and the best advice that his best friend could offer was to “find proof that you didn’t cheat on her.” he’s right, though. the last thing you had said to gojo was that you don’t know how to believe if he’s telling the truth or not. gojo has absolutely no idea how to prove his fidelity to you, since words clearly weren’t enough. it frustrates him to no end.
gojo now knows that he feels absolutely lost. all when he’s not with you.
it feels nerve-wracking to walk the halls.
he remembers telling you the night that you slept together that he’d learned over time to drown out the rumors about him. he learned not to care about what other people thought about him, and he eventually became unaffected by the school’s gossip.
however, this time was different.
this time, he finds it difficult to drown out the rumors when he hears your name in them. he flinches every time someone whispers your name and his as he walks the halls, feeling that all eyes are on him. “i heard y/n and gojo broke up…” “they were dating?!” “yeah.. i didn’t believe it at first, either! apparently he…”
he doesn’t want to hear it, so he walks a little faster. it hasn’t felt this suffocating to be on campus in a while.
maybe that’s partially why you didn’t show up. rumors are hard to ignore if you don’t know how to shun them out.
gojo lets out a sigh. he decides that he’s going to ditch the rest of class. you weren’t here, he couldn’t talk to you, and he felt he was gonna go mad if he heard your name spoken by someone again, so he turns to leave, but flinches as he feels a hand lightly tap his shoulder.
“gojo-san?”
he turns around, with a girl that he’s never seen before standing in front of him… not that he pays attention to them in the first place, though. he raises his eyebrow in question, and the girl looks so nervous she might pass out. “i have to tell you something-“
“if it’s a love confession or whatever, i don’t want to hear it-“
“-no!” she flushes a deep shade of red, and he fights the urge to roll his eyes. she coughs awkwardly at his expression. “um, no.. it’s not that. please, just give me two minutes in the library. i have something to tell you.”
he decides to entertain this girl for a bit. he’d be lying if he said that he wasn’t curious about what she had to talk to him for. gojo sighs and says, “two minutes. that’s all you’re getting.”
“this is about the party last friday, no?” he says while taking a seat near one of the tables. he feels sick just being here. he’d never gone to the library before meeting you–as he had no reason to go here at all. then, he started accompanying you everywhere as he tried to win your heart. “study dates” were frequent here, and he even remembers forcefully changing his contact name and number on your phone during one of your dates.
gosh, everything literally reminds him of you. he can barely live like this.
she takes a seat across from him, and she shamefully nods at his words. “i went to the party on friday, and i just want to say i’m sorry-”
gojo gets up to leave. he can’t do this. he doesn’t need anyone’s pity. pity can’t change the fact that you still won’t talk to him. she panics as gojo is about to walk away. “wait!”
the librarian tells her to quiet down, and she mutters an apology. still, she persists. “please, just wait for two minutes… i need two minutes to explain myself. you promised you’d give me that.”
she stares at gojo, who hasn’t left yet, and takes that as her opportunity to speak. “i was a friend of… her,” he doesn’t need an explanation to know who she was talking about. “the reason why she came up to you was because of a dare i told her to do. she’s had a crush on you for a while now, so of course she was willing to flirt with you.”
“um, that was the dare, by the way. my friend told me to record it, because we were all drunk, and we thought it would be funny. just another memory to laugh at in the future, right? we didn’t know you were dating the girl you were with at the party. sorry but, we assumed she was just a fling… or something… we didn’t know she was your girlfriend.”
“yeah, i was dating the girl at the party.” gojo scoffs, and he feels his anger bubbling up again. “then your friend had to do that stupid dare, and she won’t fuckin’ talk to me now.”
“i’m sorry-”
“i don’t need your apologies. is that why you came up to me? to apologize so you don’t feel guilty about what happened anymore?” gojo sneers. he was right, though. guilt is ridden all over her face, and she can’t even meet his eyes. he’s about to leave, thinking that this entire conversation was useless, but gojo thinks back on what she said earlier.
“...my friend told me to record it…”
he turns back to look at her, which surprises her, to say the least. “hey, you said you recorded the dare, right?”
“uhm, yes.”
“so you still have the video?”
“it should be in my camera roll somewhere-”
“if you came here to apologize to me, then you should send me that video.” she looked a little horrified at his words, and gojo could almost laugh. “what? i’m not gonna do anything bad with it, god.”
she thinks about what gojo’s intentions could be with that video, and her eyes light up in recognition as she connects the dots from what he said beforehand. i was dating the girl at the party… then your friend had to do that stupid dare… and she won’t fuckin’ talk to me now.
she nods in understanding. this is the least she could do for him. she pulls out her phone, looking for the video, and says, “i hope you two make up soon, gojo-san.”
gojo satoru walks- no, runs out of that library with determination. determination as he finally has the video evidence of what happened at the party–his saving grace so he could finally get you to forgive him.
you miss him.
you miss him like hell, actually, and you blink at the messages he just sent you in complete disbelief.
you didn’t show up to class today because you were afraid. you were afraid to see satoru again, yes, but you were also afraid of what everyone else would say about you. the party was one thing, but the after-effects and the rumors were something completely different. you didn’t have the mental capacity to deal with that, unlike satoru, so you stayed home. all because you were afraid of what would happen on campus.
you just wish things would go back to how they were before… all of this happened. you didn’t want to admit it, but you’ve read all of satoru’s messages, and you’ve listened to all of his voicemails. you’ve cried to them. and it hurts because you’re still torn apart in the midst of your own feelings. and now, satoru wants to talk to you, because he’s been wanting to do nothing but fix everything between the two of you.
the doorbell rings, and you almost jump out of your skin.
you didn’t even know if you would open the door or not. despite that, you felt your body moving on its own, like you were relying on your own instincts. you washed your face to get rid of the dried tears on your cheeks, brushed the tangles out of your hair, and dressed into something more presentable. the next thing you know, you’re leaning against the wall next to the front entrance. your shadow is visible underneath the door, so satoru knows that you’re here.
“hi, y/n..” he sounded so nervous that you almost laughed, but you felt equally as terrified as him. “i have something to show you… uh, on my phone. if you don’t want to see me, it’s fine, i’ll just send it to you, but i’d really prefer if you open the door and we’ll talk about this inside-”
your hand is already reaching the door knob before you can even think about it. it’s such an impulse decision that you look at him in surprise once you open the door. it’s the first time you’ve seen him ever since you were at the party. it’s only been three days, but you can’t help but notice how his eyebags are more prominent, his eyes are a little redder, and he looks nothing short of exhausted.
“hey,” he manages to breathe out, his eyes meeting yours. “can i come in? please?”
you nod, too stunned to say anything, and he exhales in relief as he walks in. the two of you sit on the couch, and gojo notices how you’re keeping your distance from him. it breaks his heart a little.
he looks for the video on his phone and gets ready to show it to you. this is it. his last ditch effort for your forgiveness. he’s really fuckin’ hoping that this works. “i got this video from a girl who came to the party. it’s a recording of, um, what happened.”
he hands the phone over to you, and you take it skeptically, still choosing to keep silent. you press play, and you watch the recording. a shaky hand holds the camera, and the person behind it says, “holy shit, she’s actually doing it!” they're presumably talking to their friend, and the camera focuses on a girl walking over to gojo. your heart is pounding, eyes widening in recognition as you stare at her... the one who caused all of this in the first place.
the all too familiar girl comes up to him, saying something out of earshot. when gojo looks at her, completely uninterested, she pulls that move. the scene you saw at the party before you ran out. tears fill your eyes again, and you almost want to stop the video, but your interest is piqued at the next part.
..this… this part was something that you didn’t see. gojo angrily reacts at the girl’s move, with her falling on the floor as she looks at him, stunned at how furious he looks. the person behind the camera gasps, continuing to record out of shock as a crowd of people turn to stare at the two. geto eventually comes into the frame and takes gojo away from all the chaos. the video ends there, and you grip gojo’s phone shakily.
holy shit.
tears roll down your face, but this time, they’re tears of relief. you waste no time in hugging satoru, crying your heart out as you bury your face in his neck. you’re happy. you’re so fucking happy, and so relieved knowing that he didn’t lie to you. of course he didn’t.
“m’sorry-” you sniffle into his shoulder. gojo is so shocked at what was happening that it takes him a second to hug you back, but when he does, he starts crying. “m’so fucking sorry i didn’t believe you-”
“shh, it’s okay, it’s okay…” he says, and you only hug him tighter. “m’so tired, you know that? these past three days fucking sucked. i’m just so glad you’re in my arms again, fuck-”
“-i love you, i love you, i love you so fucking much, toru.” you repeat, laughing as you kiss him all over his face. it’s been a while since you said that to someone. you wipe his never-ending tears away, still in disbelief, and whisper, “you’re real. right? you’re actually here with me right now ‘nd i’m not dreaming, right?
“i’m very much real, baby.” he says, putting his forehead against yours as you take in his features again. “god, i missed that pretty face so much.”
he finally closes the gap between you two, pulling you into a much needed kiss. it’s a kiss filled with so many emotions–desperation, happiness, relief. satoru thinks his heart is finally whole again. he’s missed you. he’s missed you so fucking much, and you’ve missed him too.
you’re like an anchor to satoru. the light of his life that keeps him grounded. and god, he’s been apart from you for too long.
you reposition yourself as you’re deepening the kiss. you’re on his lap now, and you wrap your arms around his neck, tugging on his hair in desperation. “oh yeah? ‘y gonna do anything about it?"
“of course i am,” he says, hands roaming underneath your shirt as he caresses your bare waist. fuck. he needs you. right now. especially after thinking that he was about to lose you forever–for something that he didn’t even do. “i’m gonna show you just how much i missed you, baby.”
gojo can’t let you go.
you’re in your bedroom, and both of you waste no time undressing each other. he takes you in–all of you, in awe of every crevice of your body as he trails his hands further down your waist.
god, you’re so beautiful. “i can’t believe i almost lost you.”
his words are shaky, like he’s still uncertain that you’re real and you’re in his arms again. he can’t seem to break himself away from you, almost like you’ll disappear if he lets you go. “but i’m here now, toru.”
“i’m here to stay, and i’ll never let you go again… ‘m yours,” you whisper, and your words set a fire in him, fueling his body with nothing but desperation. desperation to have you right here, and right now.
he wastes no time in plunging two of his fingers in your cunt, and he groans at just how wet you are. “satoru-”
“fuck, you’re so wet… and it’s all for me,” he mutters, spreading your legs effortlessly when you try to close them, thighs shaking in pure pleasure. he adds another finger, and you already feel stretched to the brim, and you haven’t even taken him in yet. the thought of his cock inside of you makes you even wetter than you already are, and you look up at satoru with eyes full of lust and desire. “missed you so much, baby. missed you and your pretty little cunny,”
his fingers are long, and you whine at how full you feel right now. you’re so loud, and you don’t even care. right now, it’s just you and satoru finally feeling each other again. it’s only been three days, but it feels like you’ve been apart for years.
everything about this was filthy. from your erotic moans and the way your cunt squelched against his fingers… not to mention the vice grip you had on them- fuck, satoru thinks he can cum untouched just from watching you like this.
“haa-” you whimper when his fingers curl and hit that spot in your cunt that you can barely seem to reach on your own. it’s exhilarating, and only fuels the growing heat in your stomach. “toru- don’t stop- please, i’m close-”
“really?” he taunts, and it feels so fucking good–your head is numb, and the only thoughts filling your head are thoughts of satoru. the pleasure is too much, and you try to get away from him, but he keeps you in place, curling his fingers faster as punishment. “don’t run away from me, baby… be a good girl and just take it, yeah?”
“toru- fuck- i’m gonna cum, please-” you’re on the brink of release, but suddenly, he stops, ruining your orgasm. “no- wait-”
he pulls his fingers out, and you whine at the loss of stimulation. you were so close–why did he take that away from you? you try and swat at his hands, but he just takes his fingers and puts them in his mouth, locking his eyes with yours with a sly smile. “you taste so sweet, i can’t help it,”
“aww, is my baby mad ‘cause she didn’t get to cum?” he coos sarcastically, caging you in between his arms as he tilts your face up with his finger. “too bad… the only thing you’re cumming on tonight is on my cock.”
and with that, he eases his painfully hard member into your walls. your insides hugged him perfectly–it was like you were made just for him. you gasp once he’s fully sheathed himself inside of you. his fingers were already a lot to take in, but his cock was something completely different. he moans your name, barely keeping his cool. “fuck- you’re squeezing me so tight,”
“missed everything about you, baby. i need to hold you, please,” he pleads desperately, clasping your small hands against his. the size difference alone between the two of you almost makes him cum, but he holds himself back, choosing to bask in this intimate moment. he’s missed every part about this. “you ready f’me?-”
“-just fuck me, satoru, please-” he doesn’t need another confirmation from you.
he can’t bring himself to hold back. next thing you know, he’s fucking you into the mattress, and you feel the headboard shake at how fast satoru is going. fuck–you feel every part of him, every part of his cock as it slams against your tight hole. he’s so big, you feel yourself gasping for breath, and you moan out loud as you notice the prominent bulge forming in your stomach. it’s him, it’s all him, and it’s driving you mad.
satoru follows your eyes in the midst of all of this, and he watches everything in fascination. he decides to be a little mean, and presses his free hand against your stomach–it feels so good, you could almost scream at the pleasure. “you feel that, baby? that’s all me inside of you, hmm?”
“please-” the onset of pleasure feels so overwhelming, and tears fill your eyes. you feel an oncoming orgasm coming, and you know your release will hit you like a tidal wave. your heart is pounding, but satoru only grips your hand tighter and fucks you even harder. “oh, fuck!”
“m close, baby. are you g’na cum too?” he manages to say between pants, and you somehow nod, mind hazy and your release only coming closer. you feel your eyes rolling to the back of your head. “cum inside of me, toru- please- i need to feel you-”
gojo groans at your words, and you both cum together. you ride out your high, screaming as you spasm around his cock, the pleasure overfilling your senses until you’re trembling from it. he fills you up, staying inside of you as the two of you catch your breath. everything’s hazy, and you’re barely aware of your surroundings… it takes you a few minutes to recover.
“angel, are you with me?”
“yeah, fuck, just… give me a second.” you say, and gojo thinks that he would gladly give you all the time in the world if you needed it. he pulls out of you with a hiss, and his warm seed drips out of your cunny. it makes his cock twitch, but he knows that you’re probably not considering a round two right now.
when you come to your senses, you notice satoru–who put his clothes back on already, wiping your legs down with a rag. his touch is so soft, like he’s afraid to break you, unlike how he handled you just a moment ago. you look down and notice the bruises starting to form on your legs and waist. satoru looks guilty as he stares. “i didn’t go too rough with you, did i?”
“not at all,” you reassure him, and you see him soften up a little. “it felt really good, actually… thank you, toru.”
“s nothing. you know my girl only gets the best,” he teases, and you laugh. “i’m gonna go get you some new clothes and some water… i’ll be back, okay?”
you nod, closing your eyes again as satoru leaves the room. he’s back in two minutes, and he’s gently changing you into new clothes that he found in your drawer. you’re so tired that you can hardly move, so you let satoru do all the work. he caresses all of your bruises, apologizing again even if you already said that it was okay. he’s so gentle, a swift juxtaposition to what just happened beforehand, and so soft with you. once you’re clothed again, he brings a glass of water against your lips, and you greedily gulp it down as he keeps a hand on your back. he places it on the nightstand once you’re finished, and you grab his wrist after, tugging him back to the bed. “lay with me for a bit, toru.”
satoru doesn’t hesitate, laying down next to you on the bed and placing your head against his chest. your breathing is back to normal, and you feel his heart thumping against your ear. you wrap your arms around him, and satoru thinks that this moment is so domestic that he can’t help but daydream. he looks at your face, memorizing every feature about you with a lovesick look in his eyes. you’re so beautiful, so perfect, and he’s just so fucking glad that he didn’t lose you.
satoru thinks he could wake up to this everyday.
“you’re starin.” you say with an amused look on your face. gojo doesn’t even try to play it off. “what’s on your mind?”
“nothing. i just… love you so much, y/n.” he says, pulling you closer and kissing your forehead. satoru would trade anything if it meant that this moment wouldn’t end. “m so glad you chose me.”
“i think it’s the other way around,” you tease. “you chose me. ever since you saw me at the party, you’ve done nothing but try to win my heart.”
“how could i not? there was just something different about you compared to everyone else.” he reminisces about that night at the party, and how far he’s come with his relationship with you. he remembers that night like it just happened yesterday.
you sigh, almost like you were thinking about that night too. you pull him into a kiss, finally finding the courage within you to say a proper “i love you.” to the man who meant the world to you.
“i love you too, angel.” he says, and you snuggle into him tighter. “you know i’ll always choose you…”
“..from this life and into the next. i’m so glad you gave me a chance, y/n. i’ll forever be grateful to now be called your husband. i’m the luckiest man ever knowing that you let me into your life, and i’m the one who gets to read these vows to marry you. i cannot wait to spend the rest of my life with you. i love you so much, y/n gojo.” he’s crying. gojo satoru is crying, and he’s hardly ever cried before. though, that changed after he met you.
the last time he cried was during pre-k, and now he’s done it time and time again… all because of you. he cried once during your first argument with him, another during the night he thought he’d lost you forever, and then another when he finally had you in his arms again once he proved his innocence… and now, during his wedding, when he finally gets to call you his wife.
and when you share your kiss at the end of the ceremony to symbolize your togetherness, you hear all your friends cheering. mainly shoko, utahime, and geto. if you showed this very scene to shoko during your university years, she’d call you crazy, saying this would never happen. gojo satoru was once a man who’d never willingly committed in a relationship before, but you came into his life and you changed everything about him. it was like magic.
you pull away from the kiss, wiping his tears away and whispering against his lips, drowning out the crowd, “thank you.”
for memorizing all my favorite foods so you could buy them for me. for walking me to class every day. for making me fall in love with you that one day at the park. for waiting for me to slowly love you even when i was scared to love. for waiting for me even if i didn’t trust you. for loving me. for proving those rumors wrong. for proving that satoru gojo is actually capable of falling in love and pouring his heart out to the one he loves the most.
for everything that you have done to love me.
it was like gojo could hear all of your unspoken words. he smiles, letting one more tear roll down his cheek, and says, “it’s all worth it if it’s for you.”
thanks for reading <3 -kami.
2K notes
·
View notes
Needy
summary: peter comes across sex pollen on one of his missions
cw: choking, fem! reader, squirting, choking, a little degradation, daddy kink, dom! peter
a/n: ITS FINALLY OUT AHHHHH
you were a nervous wreck
peter had gone on a mission and you had yet to hear from him since he told you that they arrived at the warehouse where the mission took place. he was usually very quick to let you know when he was on his way back and give you updates, but you haven’t heard a word.
it was a fairly simple mission with low level villains. it was a classic hideout bust which tony usually took you guys on to practice real combat. it’s been about four hours and you had yet to hear from him. usually the most difficult of missions would take two and a half hours.
you were pacing around the compound as you awaited their arrival; the other avengers attempted to comfort you but you were just worried sick.
it wasn’t until much later that you heard them arrive, and you ran quickly to the entrance ready to scold peter for not texting or calling however you were met with a frantic tony.
“get banner we have a situation” he pants out and you’re quick to do as he says; getting the scientist and bringing him to the ship.
however, as you attempt to hop on after bruce you are stopped by tony.
“sorry kid but i don’t think you should see him right now” he says as he blocks the door way.
“what the hell happened tony?” you wonder with a little anger at being stopped. you make out peters voice as you hear him whine.
“she’s here, i can smell her, fuck princess need you so bad, so hot fuck- baby need you” he groans and your eyes go wide at his tone of voice.
“so i guess i have to explain now huh?” tony groans as he steers you back into the compound.
tony then tell you the tale of him and peter’s encounters in the warehouse where in a last attempt to get away someone threw a bomb that was composed of a high end “sex pollen” which increases libido to the point of pain, and unfortunately your boyfriend was subjected to it while tony’s suit was able to filter it out.
“sooo, he just needs sex?” you piece together as you and tony sit across from each other.
“well, i would say yes but i’m not sure what the pollen combined with his genetic composition would entail, he might be in a frantic state of mind that would cause him to injure someone” he explains.
“and hopefully banner will find a cure” he sighs out as he moves to presumably find bruce and help with a cure.
“and where is peter now!” you yell after him.
“like hell im telling you!” he yells back causing you to groan.
and that’s how, with a few bribery’s on your part, you ended up pittering down the hall at the dead of night in nothing but shorts and a tank top on your way to fuck pollen out of your boyfriend’s system.
you can hear his panting through the door. soft whines and moans are all that can be heard through the door as you walk towards the room.
he was going insane, his hand pumping his cock at any thought of you he could conjure up: you on your knees pretty mouth wrapped around his cock, you on your back; legs wrapped around his waist as he pounded into you, you on your hands and knees as he fucked into you from behind.
what noises would you make? how would your cute little face look? could he get you to squirt on him? how-
his thoughts are interrupted when he hears a door open; and immediately as the door peers open his senses go into overdrive. his body heats up and his cock stands at attention.
he was consumed with the thought of you
“peter” you gasp out as you look at him. he looked desperate, sweat covering his body and his face. he had a red flush that trailed down to his heaving chest and it was hard to ignore his flushed cock that looked painfully hard; as it bobbed against his abs.
“baby” he whines out panting softly; he was so damn needy and he knew that if you stood in the room for too long he wouldn’t be able to control himself.
“princess fuck- you gotta leave or else im not gonna be able to control myself” he pants out as he closes his eyes throwing his head back. he releases small whines as he waits for your response; selfishly hoping you would stay and help with his issue.
“no baby im gonna help you; gonna make it better okay?” you respond as you inch closer to him. he groans at your words skin heating up further at your promises.
“o-okay baby, but i don’t know if i’ll be able to hold back” he mewls out breath picking up in pace; as his anticipation increases.
“it’s okay peter; just do whatever you need” you say as you approach him hands moving to him cheeks, and he moans at the small touch. he looks up to see a soft smile gracing your beautiful face;
he almost felt bad for what he was about to do.
he quickly moves his lips to yours before moving his hands to your ass, as he grabs handfuls of it pulling at the fat before slamming his hand down. you yelp at the contact and he groans into this kiss. your tongues are sloppily battling as need drives your actions.
he pulls away and leans over as he whispers a small “jump” and you comply. he catches your legs as they wrap around his waist and he moves you to the bed with ease before laying you down.
he leans to hover over you as he moves his lips back to yours again; his hands planted by the sides of your head. you two continue the intense exchange before he pulls away making you whine.
he moves to stand before pulling your shorts down; moaning at the sight of your bare cunt that was already drooling on the sheets.
“aww this poor pussy; look at her crying all over my sheets, she’s been missing daddy huh?” he smirks as he strokes his cock moving to position himself in front of your slit. you whimper at the filth that comes from his mouth; causing more arousal to soak his sheets.
“been missin’ your cock daddy need you in me” you moan out moving your hips as you attempt to catch the tight ring of your cunt on his cock.
“fuck- naughty thing, you know i’d eat that cunt but i need to be in you right now, okay baby?” he pants out as he explains his reason for skipping his usual extensive foreplay; even though you were practically begging for his dick he still assured you of his actions making your heart swell.
he waits for your agreement and when he catches you nod your head he moves his hands to capture your legs folding them back into your chest as he situates himself between your thighs.
he moves one hand from your leg to alight himself with your little cunt; he taps the fat head of his cock against your clit before moving to your hole and pushing in.
he moans as his tip sinks into you; you felt like heaven. he felt like he was gonna fucking bust, but fuck he needed more.
he continues to bully his fat cock into your soaked pussy as he inches into you. you moan at the stretch; your cunt struggling to accommodate him despite taking him many times in the past.
“shit baby- fuck so good, need you to relax so i can fuck this pussy right, need you to be good and take this dick, shiiiit” he moans out as he moves one of his hands down to rub at your little clit so you can take more of his dick. he feels you flutter around him and it allows him to slide into you with more ease, and with one surge of his hips he bottoms out causing you to squeal.
“ah- feel you here daddy” you babble out as you grab the hand that was on your clit, and moves it to your throat. he groans at your actions before tightening his grip on your neck causing you to moan.
“fuck- you’re such a little slut, just waiting for someone to pound this pussy; need someone to make you go fucking dumb” he groans out as he pulls his hips back leaving only the tip of his cock in your pussy before slamming his hips back into you; bottoming out again. he continues to repeat the process at faster intervals, as he moans at the clutch of your cunt. you almost scream at the rough treatment; drooling and babbling as he fucks you dumb.
“fuck yeah baby girl needed this fucking cunt” he moans out as he pounds into you. the quiet of the compound in drowned out by the squelch of your tight cunt as he fucks into it, your slick leaking from your cunt making his dick shine in the light as he pulls out of your heat.
“hear how fucking soaked you are baby? this pussy is so excited to see me” he mocks as you hear the obscene sound of your moans and the wet pats of his hips slamming into yours.
your body reflexively inches back from his brutal thrusts as your legs shake in his hold; your hips leaning away from his cock causing him to growl.
“nuh uh baby girl, be good and take this dick” he sneers as he grabs your leg pulling you back towards him as he continues to wreck your poor cunt. at the feeling of being manhandled your cunt flutters around his dick causing him to chuckle.
he moves his hand from your throat to your clit before pressing down and rubbing tight circles. your pussy squeezes down on him at the action and he knows you’re close.
“fuck! m’ gonna cum please daddy fuck, s’too good” you babble out as tears soak your vision. he laughs at your admission before leaning down over you.
“you better hold it baby” he smirks as he removes his hand from your clit. this causes a sob to leave your throat as he continues his brutal thrusts; the stimulation of his cock fucking into your pussy still leaving you on the edge of an orgasm.
“you’re gonna cum when i cum baby; this is about daddy after all” he sings as his hips still momentarily grinding into your g-spot causing your eyes to roll into the back of your head as you tremble in his hold.
though it doesn’t last for long and he resumes his brutal pace. he fucks into you with long hard thrusts as the tip of his heavy cock abuses your g-spot. he groans as he looks down at your cunt struggling to accommodate him; your cute little cunt twitching as you strive to be good and hold in your orgasm for him. you were his good girl and his good girl deserved his cum.
his moans become more frequent as his abs tense and he knows he’s close.
“fuck- baby be good and cum on this dick” he moans, and as soon as he finishes his sentence you cum with a squeal. your pussy gushes as you squirt on him in streams; soaking him and his dick.
at the sight he moans out before burying himself into your pussy and pumping you full of his cum, and for the first time in hours he feels relieved.
that is for a few seconds as you two come down from your highs before the tingling feeling returns and he stiffens inside you.
“sorry princess but it looks like we have more to do” he smirks as he softly rocks his hips.
the next morning
“y’know we worked really hard on that cure just for you horny kids to fuck all night and keep the compound up” tony remarks as he walks into the kitchen with you and peter in it.
“im so sorry mr. stark” peter stutters out; his face a bright red.
a complete contrast to how he was fucking you last night
“it’s fine kid as long as you’re alright” he says as he grabs a water and walks back to where he came
“and i hope you used a condom kid! i don’t want little spider-man’s running around” he yells on his way out causing both of you to groan.
taglist: @enthusiastic-french-toast @spideyslemons @ally0405 @scvrltparker @enaraism @guitarromantic @anonymously-nerdy @sunnyteume @hvnnibvni @hollandsgoodgirl @crazy4books1 @annesunlight @s-enku
15K notes
·
View notes
secret admin| charles leclerc social media au
pairing: charles leclerc x reader
newest ferrari admin is starting to show favorites and the fans desperately try to put two and two together (alternate caption: ferrari admin loves to confuse the hell out of ferrari fans)
scuderiaferrari
liked by yourusername, charles_leclerc and 311,988 others
scuderiaferrari for the charles girlies, thank you rivayacht for this content
view all 2,860 comments
danielricciardo any excuse to take your shirt off...you’re turning into russell george
paddockgf ...we’re getting a lot of charles content lately...
babyvetx i’m not complaining
yourusername nice
yourusername
liked by charles_leclerc, paddockgf and 848 others
yourusername montreal dumpp
view all 98 comments
yourbestfriend i thought you quit coffee
yourusername i need it to keep up with the boyz
yoursister miss you 💗 also tell c i say hi
yourusername lol
scuderiaferrari
liked by yourusername, carlossainz55 and 387,937 others
scuderiaferrari our boys❤️❤️
view all 1959 comments
f1 the boys in red❤️
88ricrode0 not yourusername doing damage control bc she tweeted she loves Charles💀💀
julyseb the tweet’s deleted!!
88ricrode0 MORE DAMAGE CONTROL
carlossainz55 we look good charles_leclerc
liked by yourusername
yourusername
liked by charles_leclerc, scuderiaferrari and 983 others
yourusername bonjour
view all 103 comments
yourbestfriend oh look she’s still drinking coffee
danielricciardo you left Montreal 4 days ago
yourusername french is my first language you idiot
youngpiastri WOAH hold up is that charles that has to be charles
f15ever i think that’s his watch???
gaslygirlies she’s sneeeakkyy
yourusername lol ya’ll are REACHING
foukart not y/n liking her own post from the ferrari account💀
liked by yourusername
yourusername added to their story
paddockgf
liked by charles_leclerc, yourbestfriend and 2137 others
paddockgf meet y/n y/l/n, aka the girl who either works with ferrari or is besties (or more) with Charles Leclerc, we haven’t quite figured it out yet... 🤔🤔 leave your thoughts below
view all 152 comments
yourbestfriend did you submit these pics yourself? yourusername
yourusername you’ll never know
yourusername jk i have no idea how this page got these pictures lmao
ameera are we not gonna talk about how charles liked this post
youngpiastri no we’re defo gonna talk about it😍😍
oscarpasta so does she work for charles or is she dating charles
yourusername i work for McLaren
liked by charles_leclerc and landonorris
scuderiaferrari
liked by paddockgf, danielricciardo and 20,559 others
scuderiaferrari cheesin’
view all 1,692 comments
landonorris ferrari’s newest driver?
carlossainz55 she’s not taking my seat
danielricciardo i don’t remember seeing y/n in the driver line up
paddockgf something tells me she posted on the wrong account
mclaren admin reveal?
yourbestfriend lmaaaao nice one yourusername
post has been deleted
yourusername
liked by charles_leclerc, landonorris and 1,139 others
yourusername oops (still cheesin)
view all 113 comments
paddockgf confirmed: ferrari admin ✅✅
yourbestfriend you’re an idiot, a cute idiot, but still an idiot
charles_leclerc i keep telling her that she’s not being careful
yourusername it was bound to happen eventually
landonorris so..NOT ferrari’s newest driver?
scuderiaferrari we wish
landonorris someone take away her access to the ferrari instagram account
charles_leclerc added to their story
yourusername
liked by charles_leclerc, yourbestfriend and 1,271 others
yourusername life update: I will never be a professional tennis player
view all 241 comments
danielricciardo i’m sure you handle charles’ balls just fine
yourusername please keep your comments on my post g-rated, thank you
saraf198 did not have danny ric confirming y/n and charles’ relationship on my 2023 bingo card
yourbestfriend you’re not even trying to be secret now
yourusername i don’t know what you’re talking about
F1WagUpdates screaming and crying we love this
charles_leclerc at least you posted on the right account this time
yourusername i deserve a raise for that
scuderiaferrari you do!!
landonorris stop commenting from the ferrari account
yourusername stop telling me what to do
charles_leclerc
liked by yourusername, pierregasly and 419,883 others
tagged: yourusername
charles_leclerc 🖤❤️
view all 2,891 comments
pierregasly did you get permission to post this?
yourusername yes, he did
paddockgf FINALLY
yourbestfriend ugh love you guys
scuderiaferrari the paddock’s cutest couple
yourusername 🥺🥺
landonorris please for the love of god, someone take away her access to the ferrari instagram account
request are open
3K notes
·
View notes