Explore Tumblr blogs with no restrictions, modern design and the best experience.
Fun Fact
BuzzFeed published a report claiming that Tumblr was utilized as a distribution channel for Russian agents to influence American voting habits during the 2016 presidential election in Feb 2018.
Hi everyone! We are so happy to hear that so many of you are excited to join us!
Even though some of us mods have been talking about this since last year, we didn’t factor in the fact that a lot of people weren’t expecting a Jegulus Big Bang and some questions regarding fic ideas have popped up. As is detailed in our FAQ, in order to maintain anonymity when we are doing artist and writer pairings, we require all fic ideas to be new.
That said, as this is our first year and we popped up without much warning, we have discussed within the mod team and have decided to allow people to submit ideas that they may have posted about or discussed in online spaces before, within reason.
If you have a fic idea and have briefly discussed it on Tumblr, you have until sign ups open on May 1st to scrub mentions of the idea from your blog. The sooner the better. Any works that have already had a chapter posted or been extensively promoted are still ineligible for the fest. However, if there’s an idea you made a couple of posts about you are free to delete and choose that idea for your big bang fic!
If the Jeg Big Bang continues in the future, we won’t be allowing this again—but there’s always going to be some teething issues on the first run! Once again we are so thankful for all the responses we’ve had, and are so excited to hear everyone’s ideas!
hello! i love your art a lot and one of the first i saw was your ‘not all transsexuals are perverts’ piece. i recently started doing linocutting and was wondering if i could turn the quote into a patch for personal use with your handle on it? i saw the other similar ask but i worried the specifics were too different!
WOO, finally got this ref chart together! the art's actually kinda old by now (I started this back in february) but I didn't feel like redrawing everything outside outfit changes sooooo,,,,,my apologies 😅 here's the main cast! you can find individual refs in this masterpost
What exactly is this AU about?
Twin Runes is essentially a comedic crossover AU between the universes of Deltarune and Undertale. No fancy nicnacs. Just the characters being their chaotic selves. But there might be some darkness lurking up ahead...
When is the next comic?
The comic updates most Sundays at 6:30 PM Central European Time.
Why is this AU called Twin Runes?
The name is more or less a play on the typical naming format of most AU's by featuring the "Runes" part. There are no literal Twin Runes. The whole name is more of a stand in for Undertale and Deltarune as parallel worlds. Hence the "Twin" part.
When does Twin Runes take place?
This AU takes place between a hypothetical Chapter 3 and Chapter 4 of Deltarune. On the Undertale side of things, it takes place post neutral route just as Frisk was about to deliver Undyne's letter to Alphys.
Is the player a thing in this AU?
The player lost control over both human children as soon as Frisk entered the world of Deltarune.
When Chapter 3 and 4 are released, will it affect the story?
Any chapters after Chapter 3 won't affect the story in the grand scheme of things. If possible, I might make a reference to Chapter 3, but all in all Twin Runes created a new timeline so to speak.
What's up with Kris' and Frisk's hair?
The red bits of their hair is more or less a representation of their souls. That in turn is also why Chara doesn't have that feature. They are soulless. It's a stylistic choice.
What's that thing on Kris' chest?
It's a scar they got from tearing out their soul.
And why do they have weird lines all over their body?
Both Kris and Frisk's anatomy resemble that of ball-jointed dolls. They appear just as markings across their bodies. Think of them as elaborate birthmarks. Kris and Frisk are still made of flesh and blood, but are in fact hypermobile. The reason as to why they do is still a little secret :)
People here like to refer to these markings as "puppet limbs".
You can get a better look at them and the scar in this artwork
Why does Kris have braces?
This is why:
Why is Dark World Frisk green?
Frisk changes their main sweater colors with Kris when they enter the Dark World.
Can other ghosts see Chara? (pre Darkner transformation)
No, only Frisk and Kris are able to see Chara.
IS KRIS NOW FRISK'S COUNTERPART OR CHARA'S????
:)
So, was Chara in the locket all along?
No, Chara possessed the locket to become a Darkner.
Where are Jevil and Spamton? Are they in Castle Town?
The Fun Gang have already fought these two in the previous chapters and added them into their inventory. Outside of that little dream sequence, neither will be making an appearance.
Is anyone from Undertale Yellow gonna make an apperance?
Outside of a tiny cameo from Clover (that has no greater bearing on the story) no one from Undertale Yellow is going to make an appearance.
Is (insert character here) gonna go to the Dark World/underground?
With the way the story is going to play out, only the main group will be heading to this new Dark World. The rest of the story will be taking place there.
Is the Group Project miniseries canon to Twin Runes?
It was made before Twin Runes was conceived and before I had any idea I would make a series. It is it's own self-contained story.
So it is NOT canon to Twin Runes, but You can read it here:
1 - 2 - 3 - 4 - 5 - 6
How did you come up with the idea of Twin Runes?
Twin Runes is an offshoot of a separate script I wrote. It's a similar concept but turned on its head. The funny moments in that script made me just continue what now is the start of Twin Runes. I pretty much just wanted to see if I am actually capable of drawing a comic to begin with. So... in a way Twin Runes is my first attempt at a comic ever. If I ever finish Twin Runes, then I know I can tackle turning that mammoth project of a script into a comic too.
In the grand scheme of things these two projects are sister series. They have A LOT in common and even share similar plot elements. When Twin Runes is over you will automatically also know certain mysteries of The Other Script.
What is The Other Script?
As of this moment I call The Other Script: "Lost in the In-Between". At its core it's an inverse of Twin Runes. I.e. Kris falling into the underground and being aided by Frisk on their quest to return home. The story and jokes are a considerably more grounded than in Twin Runes and so are the characters. Though they do have their moments from time to time. The overall mood of that script is a lot darker in nature and it's a 200+ page passion project of mine.
Am I allowed to make fanart?
ABSOLUTELY! You are very welcome to make fanart if you feel like it. Please let me know if you do by tagging me, so I can share it with everyone to see so that you get the appreciation you deserve :)
Can I use the funny faces you draw for memes or for private stuff with friends?
That's what they're here for :)
Is there x ship in this comic?
The focus of the story is not on shipping. If it's in the game it will very likely be mentioned or brought up, but that's about it.
What pronouns do you go with for the human children?
I try to stick as close as possible to the games so I use THEY/THEM FOR ALL OF THEM WITHOUT ANY EXCEPTIONS.
Asks will open for 24 hours after a new comic has been released. Your questions will then be answered over the course of the week.
Try not to submit multiple asks. If necessary, just keep everything in one post.
Keep in mind that I receive AL LOT of asks, so not every question can be answered...
Questions containing spoilers will not be answered on principle. Wouldn't be as fun if the surprise was ruined, right?
Before leaving an ask (mostly for everyone who's new), please make sure to read the FAQ section above. A lot of times your question might have been answered already :>
I love memes and dumb jokes as much as the next guy, but try not to spam
It probably goes without saying, but please stay civil. I want to give everyone the respect they deserve, and naturally like to be treated the same way.
Please be mindful about drawing requests. It is understandable if you're eager to see a certain character drawn in my style, but I do not like to be bombarded by requests. The more it happens, the less likely I am to do it. Be kind and ask nicely.
Don't use other people's posts that I reblogged to ask me questions! It has happened before and I do not wish to see this!
The following are ref sheets of characters that don't have established Dark World forms yet (as of writing this comic). The list will be updated as soon as a new character enters the Dark World.
Here you will also find references of characters that might appear as surprise cameos, or maybe even completely new faces...
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
WritingWithColor FAQ: How do I start writing a character of color?
First, be mindful that no race, culture, or ethnicity makes one inherently predisposed to certain emotions or personalities, despite what stereotypes or TTRPGs may suggest. We are all humans who share the same range of emotions and ways of thinking, even if we have different values.
Understand that there is no single template for a good [race, ethnicity] character. A person’s social, economic, and geographical background influences their life and values just as much as their race, culture, or religion. Consider: a Black American boy who grew up in a California mansion versus a Black American boy who grew up on an Illinois cornfield versus a Black boy who grew up in an apartment one city over. All three will have very different privileges, disadvantages, and outlooks on life.
Further reading (WWC x NaNoWriMo):
The Do’s of Writing PoC
Properly Coded: Creating Characters of Color
3 Ways to Show a Character's Culture
---
This Q&A is an excerpt from our General FAQ for Newcomers, which can be found in our new Masterpost of rules and FAQs. For more general resources on POC representation, check it out!
head up if you don’t want tumblrs partnered ai companies automatically scraping your blog for image datasets, you need to manually opt out.
You can’t do this in the app rn (apparently you can but I couldn’t find it so you might have to update), only the desktop version or web browser on your phone. It will also need to be done for every sideblog you have.
You find it by opening up your blog settings > scroll down to visibility > prevent third party sharing
As an aside, I’d thoroughly recommend opting out of having your blog scraped, even if you’re not an artist. Afaik Tumblr hasn’t explicitly stated which companies they’ll be partnering with, but the vagueness of that wording is really alarming.
These datasets use a lot of selfies for photorealistic results, moderation of who has access to these datasets is notoriously ass, and a lot of AI engines are being used to generate pornography and racist imagery (you can see this rn with the rise of ai generated propaganda). While ‘your likeness is used in an awful generated image without your consent’ IS a worst case scenario, it’s a really upsetting one. Protect yourselves.
What art style are we looking for? What is the estimated timeline? Will you get paid? we answer them here!
We will be answering more questions and posting them in the days leading up to the artist application form opening. So if you have questions, use our inbox, or you can fill in our interest form and leave them at the bottom. And if you have queries for the frog, you can leave them there too. He is very busy, so keep that in mind.
Find the interest form here.
Our Artist Application form will open on the 12th of January 2024.
text version under the cut
What type of artists are you looking for? And are you after a specific style or a range of styles?
We are looking for artists who can create pieces with fully rendered fairies and a background within the specified schedule. These can be digital artworks that are flat colour artworks, paintings, a mixture, or another style entirely.
We will also accept mixed media and traditional artworks, but they will need to be scanned at a minimum of 300dpi.
~
When you sign up for an artist position, are there any requirements to be a part of the team?
E-mail communication is required (discord is optional).
You must have a PayPal account to receive payment.
You must be able to communicate comfortably in English.
You must be 18 or older at the time of signing the contract by the 16th of February.
~
For artists accepted into the zine what would be the timeline for completing and submitting artwork?
Our current schedule for the artists requires concept ideas to be submitted by Feb 16th, and the final version by May 16th! Progress check-ins will be on Feb 29th, March 21st, and April 11th.
(In the image there is also a table including this information as well as the final submissions date being May 16th)
~
When the zine is for sale, where would the profits go to (charity, zine admin, etc.)?
We are aiming to hold pre-orders in June/July of 2024, with a flat fee paid to all contributors and additional proceeds split between contributors and mods.
Our priority is to make sure each contributor is paid fairly for their work. If sales do well enough, 20% will be used for future books and projects, and 80% split between taxes and fees, production costs, contributors and shipping costs.
~
Is this physical or digital and will there be prints of the art available? Got any merch ideas planned to go along with the zine?
Both physical and digital! Our goal is to make a 210 x 148 mm (A5) perfect-bound soft cover book.
We also plan to add some paper merch, including prints of some of the art from the book. Additional merch ideas include stickers, sticker sheets and bookmarks.
I know we've all established that you're just a master at typohraphy 'n unique/funny ways to format speech but, like-
I need to know how you come up with TD's dialouge. I feel like y'just have to be on a completely different mental wavelength to even conceptualize speech like this.
My best guess is that I was inspired by a mix of Half Life's G-Man's speaking style, Portal 2's Space Core's aimless rambling, and freeform jazz/eccentric poetry, where thoughts and sentences are broken down into repeating fragments.
"I would like an apple please, how much would it cost?"
Becomes
"Apple! Many. Would enjoy. Me. Would. How?how much. Many cost. Much? Many much?? How. Would it. Cost. Have. Apple. Red. Apple.! For boy. Me! Would like. Apple. Cost? Cost? Cost? What"
Another way to describe it is that your train of thought normally goes from A to B to C, but TD is so scatterbrained his train of thought goes from A to B to C to B to C to A to D to C, and it happens so fast his speech can't keep up with it.
My brain isn't.. THAT messed up, but I think I have a little brainrot of my own that causes me to blank out in the middle of my sentences, ramble, etc. If I didn't speak carefully and just voiced my stream of consciousness, it'd honestly just sound like a slightly more coherent version of how I write Tails Doll's speech.
ayyyyy so i’m at the bottom of the askbox, and old timers on this blog know what that means!
time for the countdown to the next openaskbox event!
Openaskbox streams are when i get to the bottom of my request inbox, during which the askbox will open for the first time in months and everyone gets a chance to yeet up to three free requests my way. there’s a few rules you gotta follow for your request to be considered, but I’ll post more about that on the day of.
I will endeavor to do as many requests as I can during the event (which lasts between 4-6 hours) on stream so people can hang out, chat, ask about calligraphy and the like whilst listening to some tunes.
When time’s up, the askbox will close again and I’ll use the remaining hundreds of unanswered asks to fuel my regular 4 posts/day (28/week) queue card post schedule until the next time we run dry.
This time it’s sort of a weird day bc its a Monday, but I’ll hopefully see plenty of you Saturday January 20th at 3pm to 10pmish EST on the usual twitch channel
hii!! i dont think ill ever get enough of your art honestly, the shape/forms and colors in your art is soooo nice to look at (especially your pokemon designs)!! im wondering if you'd be open to sharing your planning process and stuff for that? have a wonderful day, thank you!!! 💖💖
This was requested by many people. I wouldn't call it a tutorial due to being rather simple, but I hope you enjoy it anyway!
There are multiple methods for referring to those who use no pronouns, shown below. (Examples here taken from this page, a very good resource.)
Use names or initials instead of pronouns
I talked to him yesterday → I talked to Sky yesterday.
She is really beautiful → Soph is really beautiful.
Her graduation starts soon → J's graduation starts soon.
Passive voice
He answered the phone → The phone was answered.
Wen takes good care of her cat → Wen's cat is well cared for.
Rephrasing the sentence (circumlocution)
Lior did it all by himself → Lior did it all without any help.
Gael talks in his sleep → Gael talks while sleeping.
Replacing a pronoun with a descriptive noun or phrase
She landed the plane safely → The pilot landed the plane safely.
This is Lea, she is into painting → This is Lea. My friend is into painting.
She argues that… → The person who started this discussion argues that…
Dropping pronouns
Did you buy Tex her gift? → Did you buy Tex a gift?
Yes, I bought it for her. I will give it to her tomorrow. → Yes, I bought it. I will give it tomorrow.
Why not just use they/them?
For many people who use no pronouns, the issue with they/them pronouns is the implication of a neutral gender rather than no gender. Nonbinary people have often been lumped into a “third gender” category, and for agender/genderless people, this feels just as restrictive as having to “settle for” a binary gender. They/them pronouns can feel like being forced into another category, especially as the popular perception of people outside the binary has become a monolith, and can be very dysphoria-inducing.
Who can use no pronouns?
Anyone! Most commonly, this specific way of expressing oneself is used by agender/genderless people, but anyone can use no pronouns if that’s what that person wants.
Can I include you in group pronouns? (Example: They all went to the beach.)
It’s up to the person whether or not that’s alright, but I’d wager most of us would say that yes, that’s fine! It can’t hurt to ask.
Are second person pronouns alright to use?
Same as above. Most would find it perfectly fine, but if there’s ever doubt, please ask!
Isn’t that transphobic?
When asked for sincerely, this is not transphobic. Some transphobic people might say they “don’t have pronouns” in order to make fun of trans people. There is a big difference between someone genuinely stating their preferred pronouns (or lack thereof) and being transphobic.
Are you trolling?/Is this satire?
No, this is not a joke or an attempt at making anyone look bad. If you asked if this is satire, I also urge you to take a look at what satire actually is and it’s history as a form of comedy. Trolling and bait are not satire.
Aren’t you harming the community with this?/This will make transphobes think we're stupid!
I am, by definition, a trans person just trying to be comfortable. I am part of the community. While people inside the community can definitely harm it, expressing myself in a way that makes me most comfortable is not harmful towards anyone. If transphobes think I'm stupid, I can't stop them. They'll think I'm stupid no matter what.
How do I try these out for myself? I think this might be for me!
Here's a website that allows the user to input a name and ask for no pronouns in a sample sentence. No matter your conclusion, I wish you the best on your journey of discovery!