I’m LightQueen, i own the tiktok account lightqueen093 that is a dedicated fan account of @aroacesafeplaceforall :D
I go by any pronouns and asks about me is fine but that doesn’t mean i’ll give away info about me easily :)
Tags i use:
#lightqueen
^^ my own posts
#aroacesafeplaceforall fan
^^ stuff about that account
52 notes
·
View notes
Hello, I'm Fab/Cody and I draw cats! 😼
I am a primarily digital artist ✍️ I post stuff of furries, warrior cats, ocs, transformers, mlp, basically whatever I'm into! :] I use photoshop and sketchbook pro to draw.
the tag for all my art is #codysight art
my content is mostly 15+ for blood/gore and some mild suggestive stuff I've posted here and there
You may use my art for icons/pfps, headers, etc just nothing commercial and please credit + link back to me 👍
MY SIDEBLOGS:
@codys-condiments <- blog for unrelated reblogs/misc stuff
@fabsfightcats <- warrior cats design blog
@perceptors-receptor <- transformers sideblog, almost entirely rbs
extra: here is my current catsona's reference sheet!
OTHER SOCIALS:
CARRD
INSTAGRAM
YOUTUBE
AO3
DEVIANTART
ART FIGHT
TIKTOK
TOYHOUSE
(I am mostly active on here and Insta, these r just my other public accs with this username)
24 notes
·
View notes
「 ✦ emma ✦ 」 she/her. minor. capricorn. intj. australian. ferrari girl. books. i post about my writing sometimes, sometimes - cause im too lazy to write. reader for life. pinterest whore. music lover. firm believer in sarcasm. percy jacksons gf. aaron warners wife. damon torrance and joey lynch defender forever. in depth intro
sideblogs: @seaweed-brain-here [percy jackson] @jameson-hawthorne [jamie hawthorne] @thegoodwitchcoven [group music blog] @the-ballad-of-us [public writing blog - i have a secret one just send me an ask if you want to know it :))] @leclair-leclerc [f1 side blog] yeah ik i have a lot lol
inspired by @nqds
22 notes
·
View notes
Always looking for mutuals <3
Fandoms I'm in currently:
Twenty One Pilots
Pre-Split P!ATD (Ryan Ross specifically)
Stardew Valley
Saw (all movies apart from Spiral)
ATLA
Dan and Phil
you'll probs see others too, I post whatever interests me.
You can find me on Ao3 here: https://archiveofourown.org/users/Ippyhaj/profile
I also shitpost alot, you can see those under the #shitpost tag, feel free to follow just for my ramblings.
We don't have to have fandoms in common along as you're cool, I don't have anything against minors but if I ever post 18+ content I will tag it and trust you will not look at it, please respect that.
Tags:
#my posts #shitpost #asks #my poetry #fanfic
21 notes
·
View notes
𝐁𝐀𝐋𝐋𝐀𝐃 𝐎𝐅 𝐀 𝐇𝐎𝐌𝐄𝐒𝐂𝐇𝐎𝐎𝐋 𝐆𝐈𝐑𝐋
🐰ྀི₊˚⊹ ──── soamericns blog !
𝐓𝐇𝐄 𝐆𝐈𝐑𝐋 𝐈𝐕𝐄 𝐀𝐋𝐖𝐀𝐘𝐒 𝐁𝐄𝐄𝐍 ! ry. 𝜗𝜚 she/her , american , november 10th. oscar piastri’s irl wife! avid pinterest user! cuntry girl, ill yap your head off if you let me. fave drivers are op81, gr63, aa23, & ln4.
🦢ྀི ₊˚⊹ ──── masterlist !
𝜗𝜚 ( you are in love ) ── op81. sfw. oscar piastri is head over heels for his best friend, though he keeps his feelings a secret until his first formula one gp win.
𝜗𝜚 ( he said baby that’s what he called me ) ── op81. sfw. oscar’s plans for a date for him and his girlfriend after feeling bad for being busy all week, but ignoring how tired he’d been turns out to not be the best idea.
🐈ྀི ₊˚⊹ ──── important info !
𝐋𝐎𝐕𝐄 𝐈𝐒 𝐄𝐌𝐁𝐀𝐑𝐑𝐀𝐒𝐒𝐈𝐍𝐆 ! I only will write about f1 most likely. i don’t write anything to explicit or nsfw so don’t expect that! i’m newer to tumblr so i’m still working out how to use it but once i do i’ll prob open up requests!
𝜗𝜚 i love to make friends and talk to people so feel free to interact! i will talk your ear off about f1!
©soamericn. 🎀.
21 notes
·
View notes
Meat the artist 🥩
21 notes
·
View notes
Hello to this weird and wonderful community!
My name is Jamie, but I also go by Jay, Tones, Ant, or Tony! Though i prefer to only be called those by mutuals, I don't really mind!
I use any pronouns, but I'm mainly masc leaning so he/him is always a safe bet!
I’ve been on tumblr since 2016-17
I am aroace and gender queer. I am specifically romance repulsed aromantic and aegosexual.
I am Australian! The state can easily be guess but I'm not making it easy!
Currently studying to be a statistician!
I post about; anything and everything, environmental issues, star wars, music, funny stuff and serious stuff!
All are welcome here! This is a safe place!
My main/public side blogs -> here
I'm making a new mutuals list to please reply to this post to be added!
My messy ao3 account, for shit posts but also really good fics -> Agathawouldbeproud26
My serious ao3 account, where i get fancy and pull out the 10K chapters -> You_need_not_apply
22 notes
·
View notes
"I should reintroduce myself. My name is Dan Heng, guard of the Express and administrator of the data bank."
Not affiliated with Hoyoverse.
Please dont bother me unless its something important... that includes you, March.
Rules and general information:
No bigotry.
No NSFW especially with minors, animals and family members.
Satirical suggestiveness is okay.
Mod information:
He/him pronouns.
I use () for OOC.
My replies themselves might be slightly off character, my apologies 😭
Chat along in the tags or brackets!
21 notes
·
View notes
Thou art welcome here my dear friends.
I hope for this blog to be a safe space for all Regressors and Caregivers.
Anons: 🐦⬛🧃, 🎧🐺, 🦌📻, 🧸❤️🩹, 🌟,
🍪🍫💙, 📺🦈, 🥫, 💜, 🪲, ☀️🐚, 🪻,
💫, 🎧, 🐻, 🦝🐾, 🕸️, ☁️, 🪴, 🐶🎀,
🌼, 🎀,
Despite what Velvette or others may say I'm not as old as you may think.
(This blog is run by a minor)
What troubles thee?
(You are allowed to vent but please either put a warning on the ask or DM me)
Please inform me if I ever do or say something (such as a nickname) that makes you uncomfortable, I will not know unless I am told.
Rules: No nsfw interaction, no racism, homophobia, bullying, anti agere/petre, really the basic DNI criteria.
21 notes
·
View notes
Apparently intro posts are important on here so might as well
I'm Ozzie. That's not my real name, but it is what I'd like to be called on here.
I use she/they pronouns but that is subject to change.
I'm aroace. Specifically, aegoromantic/cupioromantic and asexual. (if there is a label for this I don't know it)
I am a minor
I like Hermitcraft, the life series and Empires SMP, but I mostly post about Hermitcraft and the life series.
I'm a swiftie.
My cat, Bramble is the mascot of @aroacesafeplaceforall (hope you don't mind the tag)
I write, but that content is on @c-oswinwrites-x
My tags
#I want garlic bread - I tag everything with this
#*Spontaneously combusts* - absolutely nonsense. Anything in this tag is complete bullshit.
#Racconfriend - posts about my best friend, who for privacy reasons we're calling Raccoon
This is probably shit. Sorry.
23 notes
·
View notes
Welcome to tumblr's own AITA!
The askbox is currently: OPEN
Please submit your own stories to be judged by the court of tumblr! Each story will come with a poll, judgements are as follows:
YTA=You're the asshole
NTA=Not the asshole (the other party is)
JAH=Justified asshole (you’re an asshole, but like, I get it)
NAH=No assholes here (everyone is some level of justified)
ESH=Everyone sucks here (you're all assholes)
INFO=Not enough information to judge (answer questions via reblog or reply, NOT my askbox please!)
Ready to submit yours? Read the FAQ first! (If it doesn't open for you on mobile, try opening it in your mobile browser instead of the app)
20K notes
·
View notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
Hi, New People?
For some unfathomable reason, Tumblr has decided to suggest my blog to brand-new accounts to follow, so I've had a crazy influx of followers who, of the ones that are genuine accounts, probably have no idea what they've signed up for. (sorry.)
Oh, and I also have some new bittern-loving followers who have a slightly better idea but might not know the whole story!
So, here's your chance to escape, if you so choose.
Anyway, I'm Bob! I've been here since like 2012. I mostly make comics, but I also do some prose writing, game dev, and general shitposting. Should you choose to continue following me, you will be subjected to such content as
Canada geese.
Like... a LOT of Canada geese.
Also ferrets, the love of my life. And other art and general musings about my favorite animals, including but not limited to bitterns, grebes, pheasants, parrots, crayfish, eels, every single other type of mustelid, alpacas, etc.
But, because I can't be bothered to make myself a consistent "brand," I also make
Very Gay Comics.
I can't emphasize this enough, because I kinda suspect all those plumbing company blogs didn't know this before following me. I make very gay comics.
I'm working on a new webcomic called Into the Smoke that's gonna launch soon. It's about a gay medium who binds himself to a killer ghost, and I think my new follower with the car financing blog is gonna love it.
Lots more on that soon.
Anyway, I don't want to make a super long post. I just want to make sure y'all understand that if you follow me, you will get
Canada geese
and
Very Gay Comics.
Cool? Cool.
796 notes
·
View notes
She’s just like me fr
806 notes
·
View notes
You're dead.
Or, at least, you should be.
You remember what it felt when the bullet pierced your chest, the blood rushing out too fast, too much to stop.
The man in red smirking above you.
And yet, here you are. Alive. Safe in bed.
One week before the day of your death.
Redo; Rewind is a story about time. Of an ordinary person working an ordinary office job. Sure, you might work for an info broker and, sure, you sometimes (often) commit acts of corporate espionage for said job, but that's just business.
This is something far beyond that ordinary life.
Time travel. It seems you of all people are capable of it. To manipulate time and bend it to your will. It may not be something you asked for, but you need it now more than ever.
Someone wants you dead. And they've already succeeded once. You can't allow it to happen again.
(Please note that Redo; Rewind is currently rated 18+ for depictions of violence/death, references to drug and alcohol use, explicit language, and heavy themes.)
Play as a customizable MC! Choose your MC’s appearance, gender, skills, and more!
Romance, befriend, or antagonize any of the 3 romance options.
Learn how to master your time control ability and use it to your advantage.
Avoid past mistakes and inadvertently come up with new, much worse ones!
Try not to die. Again. And again. And again...
Victor/Victoria Zhang [M/F] - Your boss and owner of VZSystems, the front for their true work as an info broker. Clever, professional, and cold—a classic business major. That's how they appear, anyway. Having worked for them for sometime now, you know that, despite their intimidating appearance, they hide a much softer side underneath. Will you maintain the status quo as employer and employee, or will you cross the boundary set by your positions?
August Astaire [M] - Hitman, assassin, whatever you want to call him, the man's a killer. That much is clear after he put a bullet through your chest. But is that all there is to him? As arrogant and cruel as he seems, you can't help but wonder if there isn't more to him than meets the eye. Maybe if you play your cards right you could even turn an enemy into an ally. But, even if he plays for your team, how much can you really trust him?
Amara Ingram [F] - Your coworker of about two months now. You don't know her well yet, but she seems genuinely kind, with a good sense of humor and a sharp mind. Since being hired, she's quickly earned her place, proving to be an invaluable asset with her skill in engineering and programing. Undoubtedly, someone you're glad is on your side, but could your feelings for her extend beyond the professional?
[Demo] - Available Here! (Last update: March 23rd 2024)
[ROs] - Additional Details Here!
662 notes
·
View notes
Welcome to Ordinor Ultor!
You’ve ruled the Duchy of Akize, the southwesternmost duchy in the Kingdom of Ribaur, for 15 years, since the year 1107 ME.
15 years ago, your Liege had your parents executed for a plot they had no part in.
Despite becoming a ruler while only a teenager, your lands have done well - no thanks to your Liege’s proclamations. Despite the annoying interference, you would have been content to just administer your lands and pay your taxes.
But one day, your Liege goes too far, and wrongs one of your siblings - personally.
You’ve had enough. You and your siblings will chafe no longer under the yoke of that tyrant. You will be free from oppression - whatever it takes.
Choose your character's name, the name of their noble house, and whether they are a Duke (male), Duchess (female), or Dux (enby).
Choose which foreign land your mother hailed from - such as the northern court of Ostroway or the island nation of Sayland.
Pick the type of education you received - were you taught how to use the shadows of Intrigue? How to construct Martial strategies? Or something else?
Interact with your friends and family, possibly including your foreign cousins.
Choose how to deal with your Liege - will they be put on Trial, will you lead an armed Rebellion, or will you take to the shadows to have them Assassinated?
Pick from four gender-selectable ROs - two fellow vassals and two foreign nobles.
Deal with various interest groups - such as the Peasants you rule over, your fellow Vassals, the religious head known as the Hierophant, and more.
Ordinor Ultor takes palce in a low(ish...) fantasy world, with the protagonist's home country of Ribaur being inspired by medieval France.
I'm relatively new to coding, so I can't promise a concrete update schedule yet (also, if anyone has any advice and/or resources for me to use, I'd be very grateful!). That being said...
DEMO BY APRIL 29TH 2024
I hope everyone enjoys!
514 notes
·
View notes