0 notes
Space cat 008 🌌
The space navigator will always help you find the right path. ✨
4 notes
·
View notes
when all hope is lost I come to tumblr, laugh at a few silly posts, and remember that life isn't so bad
1 note
·
View note
oooh an update/minor redesign to an old oc
1 note
·
View note
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
Sharpening Our View of Climate Change with the Plankton, Aerosol, Cloud, ocean Ecosystem Satellite
As our planet warms, Earth’s ocean and atmosphere are changing.
Climate change has a lot of impact on the ocean, from sea level rise to marine heat waves to a loss of biodiversity. Meanwhile, greenhouse gases like carbon dioxide continue to warm our atmosphere.
NASA’s upcoming satellite, PACE, is soon to be on the case!
Set to launch on Feb. 6, 2024, the Plankton, Aerosol, Cloud, ocean Ecosystem (PACE) mission will help us better understand the complex systems driving the global changes that come with a warming climate.
Earth’s ocean is becoming greener due to climate change. PACE will see the ocean in more hues than ever before.
While a single phytoplankton typically can’t be seen with the naked eye, communities of trillions of phytoplankton, called blooms, can be seen from space. Blooms often take on a greenish tinge due to the pigments that phytoplankton (similar to plants on land) use to make energy through photosynthesis.
In a 2023 study, scientists found that portions of the ocean had turned greener because there were more chlorophyll-carrying phytoplankton. PACE has a hyperspectral sensor, the Ocean Color Instrument (OCI), that will be able to discern subtle shifts in hue. This will allow scientists to monitor changes in phytoplankton communities and ocean health overall due to climate change.
Phytoplankton play a key role in helping the ocean absorb carbon from the atmosphere. PACE will identify different phytoplankton species from space.
With PACE, scientists will be able to tell what phytoplankton communities are present – from space! Before, this could only be done by analyzing a sample of seawater.
Telling “who’s who” in a phytoplankton bloom is key because different phytoplankton play vastly different roles in aquatic ecosystems. They can fuel the food chain and draw down carbon dioxide from the atmosphere to photosynthesize. Some phytoplankton populations capture carbon as they die and sink to the deep ocean; others release the gas back into the atmosphere as they decay near the surface.
Studying these teeny tiny critters from space will help scientists learn how and where phytoplankton are affected by climate change, and how changes in these communities may affect other creatures and ocean ecosystems.
Climate models are one of our most powerful tools to understand how Earth is changing. PACE data will improve the data these models rely on.
The PACE mission will offer important insights on airborne particles of sea salt, smoke, human-made pollutants, and dust – collectively called aerosols – by observing how they interact with light.
With two instruments called polarimeters, SPEXone and HARP2, PACE will allow scientists to measure the size, composition, and abundance of these microscopic particles in our atmosphere. This information is crucial to figuring out how climate and air quality are changing.
PACE data will help scientists answer key climate questions, like how aerosols affect cloud formation or how ice clouds and liquid clouds differ.
It will also enable scientists to examine one of the trickiest components of climate change to model: how clouds and aerosols interact. Once PACE is operational, scientists can replace the estimates currently used to fill data gaps in climate models with measurements from the new satellite.
With a view of the whole planet every two days, PACE will track both microscopic organisms in the ocean and microscopic particles in the atmosphere. PACE’s unique view will help us learn more about the ways climate change is impacting our planet’s ocean and atmosphere.
Stay up to date on the NASA PACE blog, and make sure to follow us on Tumblr for your regular dose of sPACE!
1K notes
·
View notes
୨♡ Winter King HCS ♡୧
I am ashamed of tumblr for not making more fanfic of this funky fruit.
We got some general HCS and then some romantic ones under the cut! (I went a little overboard with the romantic ones, hehe!)
Gender-neutral
୨♡ General ♡୧
-Man's self care routine is off the charts
-I'm serious, he has like- 80 different bubble bath concoctions.
-Smells like mint
-or some kind of cold scent.
-I feel like he loves dressing up fancy, so he has a closet full of sparkly suits
-maybe even some dresses if he's feeling special.
-Doesn't actually need to wear glasses, he just likes how they look.
-While he loves his winter wonder world, I feel like he'd enjoy rainy weather more than snow.
-He got rid of all his madness and sadness, yes, but I think he'd cry at something especially cute. Happy tears, y'know?
"Why are you crying, sir? Are you okay?"
"Oh, it's nothing. *sniff* Just those two rabbits that are cuddling."
-He is really bad at any percussion instrument
-like.. REALLY bad.
-His hands are too delicate for such a garish instrument as the drums!
-He loves playing duets on the piano, but rarely has anyone to play with.
-I mean, he could always concoct up an ice creature to play piano with him, but that's honestly quite dull.
-His favorite movie would probably be an old Christmas movie, like It's a Wonderful Life.
-He gets kidnapped by the Candy Queen so often, that occasionally he brings a book or something snuggly to help him wait for his ice scouts to rescue him.
-He once got so bored while kidnapped that he tried to read to some of the mutilated candy people
-That was the last time he saw his favorite book.
-Safe to say he doesn't bring his favorites anymore.
୨♡ Romantic ♡୧
-Will literally spoil his love interest rotten.
-You want that thing you saw earlier?
-Consider it yours
-You'd like for it to snow outside?
-A sprinkle or a blizzard?
-Literally anything, this man will go to the ends of the universe to get you what you'd like.
-Love languages are definitely gift giving and physical touch
-probably acts of service too.
-Loves dancing.
-Loves dancing.
-Whether it be a slow dance or ice-skating, he will take every opportunity to dance with you!
-He adores short people.
-Good, because he's tall as a giant.
-if you're shorter than him, he will no doubt use you as an armrest.
-He always makes remarks on how cute you are.
-Even if you're only two inches shorter than him.
-If you're taller...
-hoo boy.
-Expect him to be all over you.
-figuratively and literally.
-Will want you to carry him everywhere, sit in your lap, rest against you, whatever.
-Just let him touch you.
-He'll talk about how strong you are, how you'd be the perfect chair, etc. etc.
-He does the stupid "How's the weather up there?" jokes.
-Loves your body, no matter what it looks like.
-You're skinny?
-You're easy to carry around and dance with.
-You're chubby or fat?
-Literally will always be holding onto or resting on part of you. He loves squishy people.
-Somewhere in the middle?
-He could not care less. He loves you regardless of what you look like.
-And he makes sure to emphasize his point by complimenting you endlessly.
-He will never leave your side.
-Even if you need space, he doesn't.
-So why wouldn't you?
-Back to our regularly scheduled fluff-
-Candy Queen hates your guts.
-She thinks you're an obstacle, keeping her from the Winter King.
-No doubt tries to kill you.
-Multiple times. a day
-Her plans are always foiled, but if she gets too close to genuinely hurting you, Winter will be so upset.
"Oh, Dearest, please tell me you're okay!"
"You are?"
"Phew. I don't know what I'd do if you were hurt in any way."
-His petnames for you are probably
-Darling,
-Dearest,
-My love,
-There are a lot more, but those are the main ones.
-LOVES kissing you.
-Anytime, any way.
-He finds it adorable when his nose bumps your face.
-Favorite place to kiss would probably be the back of your hand.
-He is a gentleman after all.
-Overall, he just adores you.
-And he sincerely hopes you love him just as much as he does you.
Headcanon requests are open for Winter King! Don't be afraid to send an ask, and be shameless! I know I am! (No smut tho. Some spice is okay, however.)
Have some free WK art for coming this far!
reblog for a beginner writer?
1K notes
·
View notes
Noa and Mae: A Taboo Affair?
Hi, there! Kida checking in again with yet another controversy - you've been warned.
I see a lot of people on Tumblr and Reddit pointing out that a Noa/Mae (#NoMae?) pairing would be at best controversial, at worst beastiality.
I mean, he IS a CGI ape, right?
Not so fast.
I'd like to break down a few points, if I Mae (pun intended!), and address this argument. I'll be using a few of the comments I've seen on the web already to do so, on the part of the dissenters to the pairing.
1st Argument: "Planet of the Apes wouldn't show a kiss between a human and an ape. Ew."
Reply: Oh, they already have, my friend. Not in the full-blown sense, but they definitely did film Zira and Taylor kissing lips to muzzle in 1968. You can view that lovely bit here: https://www.youtube.com/watch?v=gEp7yunwVF8
I apologize in advance for impinging on your delicate simian sensibilities. #sorrynotsorry
2nd Argument: "Why would they even depict a human/ape couple? Humans and apes can't even reproduce in the franchise."
Reply: They can't? News to me. There was a Hum-Ape written into the early scripts and screen tests for Beneath the Planet of the Apes in 1970. Seems the Planet of the Apes franchise truly thought it was worth exploring back then. You can read all about that little guy right here: https://planetoftheapes.fandom.com/wiki/Hum-Ape
Aww, just look at that adorable lack of face-fur!
3rd Argument: "The audience of today isn't ready for that kind of thing."
Reply: And the audience in the 1960's/early 1970's was? I didn't know we became even more conservative 50+ years later. I'll be sure to adjust my high neckline and clutch my pearls in absolute horror at the thought of all of those deviant libertines living before me. Excuse me, I must go confront my parents about this.
BUT, before I do, I do want to point out we seemed to accept an on-screen kiss between Goliath (a gargoyle) and Elisa (a human) during a certain Disney children's cartoon show in the 1990's - anyone remember that?
Disgusting. I bet his breath smelled like rancid pigeon.
Additionally, we have more recent films such as Avatar, The Shape of Water - which won 4 Academy Awards, including best picture (not bad for a human and a fish-man pairing), and Beauty and the Beast.
And hey, if a living monster is not your thing, you could always opt for Warm Bodies. Think female human and male zombie. Necrophilia, anyone?
4th Argument: "Okay, fine, I see your point on the Taylor/Zira thing. But that only worked out because it was a human in a monkey suit, and we all sort of knew that. It didn't make it so strange. As for the other films you listed, well, those creatures don't actually exist so it's out of the realm of true possibility anyway. Noa is depicted as a real chimp, and him getting with Mae just makes it hit too close to home for comfort."
Reply: #Ishetho? Let's take a good look at what a "real chimp" looks like:
He's so damn Chimpy.
Okay, now let's look at our leading man--er, ape:
Looks like Chimpy had a love-child with Owen Teague. #shudder
As you can see, the two are pretty different. Chimpy has a true muzzle and a mouth that curves around it. Noa has a flatter, human face with an actual nose bridge and wider-spaced eyes.
And the EYES. My god. If you don't see the humanity in those baby-blues you might want to get checked for psychopathy. Besides that, Chimpy lacks eye-whites and has rounder eyes than Noa. Additionally, that pronounced brow ridge on Chimpy has thunder clouds gathering beneath it. Don't get me started on the ear comparison between the two, I'm sure it goes without saying!
Anyway, I think it can be safely stated that no chimp alive on this earth looks like Noa. He's too physically humanized to resemble an actual chimpanzee of the typical zoo variety. Thus, I would place him safely in the category of fish-man, the tall, blue cat creatures from Avatar, and those barbaric blue aliens that keep cropping up on certain ice planets in books #ifyouknowwhatImean.
---------------------
All that said, everyone can ship what they want. If you want Noa playing house with Caesar, never mind that trifling little timeline issue, you go with your fine self and write that fanfiction. Create an account on DeviantArt.com and fill it with their anthropomorphic babies who eventually grow up to be the first ape astronauts. Someone out there is going to love it and eat it up, I promise you.
For the points above, this is about Noa and Mae. They've got something, something tangible. Whether or not it becomes canon is yet to be seen.
For now, it lives on in our minds. With our inner eye, we can see it just fine.
343 notes
·
View notes
Some fic because I love your au, Fenton is gender brainrot, and little baby dan cracks me up. Full disclosure, my only familiarity with DC is DP crossover fanfic, and a Batman movie I fell asleep during. (If I had a better grasp on the characters I would totally write more :(( i love interactions) also sorry for the weird spacing. Idk why tumblr did that
~~~~~~~~
There was an empty cardboard box on the table of the Justice League’s main conference room. Taped on the top flap, next to a doodle of Fenton’s logo, was a jump drive.
Heaving a sigh, Batman plugged it in and pulled up his screen on the projector. The drive, which was named “little baby dan’s evil playtime”, contained two files; WATCH_ME_FIRST.mp4 and its-a-secreeeet.pdf. He clicked on the video file, and immediately the projector filled with a blurry close-up of Fenton’s goggles.
After a moment of fiddling with the camera, Fenton stepped back, giving a cheery wave. His lab coat and goggles were a pastel pink, which was new. “Heeeeya, Bats! Whoever else is there! If you’re watching this, you probably weren’t there when I dropped the box off, aaand it’s probably empty.”
He clapped his hands together gleefully. “And Connie, if you’re there, this is payback for cussing around my daughter.” Batman was instantly relieved that Constantine wasn’t on base. Hopefully the situation wouldn’t require Constantine’s expertise. (Or any of the Justice League Dark. Fenton seemed determined to drive them all to an early grave with his casual refusal to acknowledge the supernatural air around him.)
“Now, as you’re all heroes, I’m sure you’re all familiar with the whole,” Fenton paused for a moment, as if searching for the proper words. “”You ate a burger on a Tuesday or something equally inane, and it kickstarted a series of events that led to you going insane and evil and murdering 95% of the Earth’s population and now you must fight your evil alternate self, because your time-controlling cryptid Peepaw said so,” shtick, so I’ll skip the backstory. Say hi to Dan!” Fenton grabbed the camera, and Batman quickly jotted down several notes about the concerning number of things the boy had just said.
The camera swiveled around to show Nightingale, holding a strange beast in a manner that reminded Batman of an “elongated cat meme” Nightwing had shown him when he was still a Robin. The creature bared a maw full of razor sharp fangs at the camera. Nightingale adjusted her grip to hold the creature’s paw and make it wave, which evoked a deep growl.
“Haha, he’d kill me if I did that. Dan likes Nightingale much more than he likes me.”
“Because the worst she has ever done is attempt to shoot me.”
The camera had moved, so Batman couldn’t visually confirm that the deep voice had come from the creature, but the voice didn’t match any of Fenton’s previously revealed companions. “Yeah yeah, her aim sucked back then.” Fenton gave the camera a toothy grin that was only slightly less unnerving than the creature’s. “Dan’s not technically me, he’s much more like Dani, actually, but the world would probably end again if we left him with his other... What did you call him?” Fenton glanced offscreen.
“Bane of my accursed existence.”
Fenton chucked. “The other half responsible for his existence.” Batman added more notes to his file. “So, yeah, Clocky left him with us for a bit to help along his rehab. But a certain psychologist-in-training I know says that repressing rage isn’t healthy, and even without a lot of his powers, he can wipe out most of a city in- what, an hour? We tested it. It was around an hour.”
Everyone present shared a look of deep concern. As if able to see their reaction, Fenton quickly held up his hands in surrender. “Don’t worry! Clocky reset it. Approximately zero people have died from Dan in this timeline.”
“Yet.” Came a furious rumble from off-screen.
“Yes, you’re very scary.” They heard Nightingale coo.
Fenton laughed. “Yeah, we need him- and all of you, -out of our hair for a bit while we concoct more evil plans, and you’re all the least likely to die to him, so you get to babysit! Thanks!”
He reached to shut off the camera before pausing and turning away. “Foley! Which of the furries is the one who really likes animals?”
“Man, do you realize how that sounds out of context?” Foley laughed. “I think Tim said it’s the little one. Damian?”
Fenton nodded and turned back to the camera. “Don’t let Damian try to adopt Dan. Or anyone. Dan will bite their hands off. I mean it!” To emphasize his point, he removed one of his hands.
Batman sighed and added “ability to remove limbs” to a list of Fenton’s powers.
“I’ll include a list of “tasks”” Fenton’s disembodied hand made finger quotes, “we gave Dan to keep him occupied. There’s some at the bottom for you guys. They’re mostly just blatant abuse of his powers for the sake of fun and science. I’d appreciate it if you’d let him mark things off the list and add notes on how it goes. Or you can do it. Or I can steal your cameras. Your choice.”
He thought for a second. “I think you’re supposed to leave, like, pizza money or something, but I don’t think you can get pizza delivered to space. Anyway, thanks for letting me blab your ears off while Dan’s probably committing war crimes for twelve minutes. For your sake, I hope he inherited my interest in space. Good luck! Thanks for babysitting!”
Waving with his still detached hand, Fenton ended the video. Batman closed it and opened the PDF as the few other members present murmured amongst themselves. Most of the pages were filled with a curling script Batman didn’t recognize. The fourth page had a huge, bolded header, reading JP TASKS.
The door opened and shut in half a second as the Flash burst in. “Superman!” The speedster wailed. “I can’t get this thing off of me!”
The Flash waved his arm around, sending small droplets of blood flying as he tried to dislodge the creature sinking his teeth into the speedster’s arm. Batman raised an eyebrow beneath his cowl as Superman quickly lent his super strength in attempt to pry the creature’s jaw open. Dan didn’t budge.
Well, he could certainly see the family resemblance been Fenton, Dani, and Dan. Shaking his head, he turned back to the list.
Task 1: Find Dan. He’s probably attacking someone.
He highlighted the text and crossed it out. This was going to be a long shift.
[Anon, this is me crying over the wonderful gift you have given me. You bastard.]
---
"Do you think Fenton's regeneration powers extend to his..." Green Lantern frowned, trying to remember the word the kid had used but coming up blank. "I dunno. But do you think if we cut off little Dan here, he'll heal back up with no problem?" He gestured helplessly to the scene in front of him. Flash was still screeching about the beast on his arm, and now Superman and Wonder Woman were trying to pry him off. Batman was standing to the side, silently bemoaning the lack of quiet. He just wanted one peaceful shift. Just one. Please.
"I'd like to see you try, hero. And I'm not little." Dan spoke, startling all of them. His grip on Flash's arm tightened, making the speedster squeal before releasing the man and spitting out a mouthful of his blood. Batman noticed that his mouth didn't move despite the clearly spoken words. In fact, when Dan closed his mouth, it was like he didn't have one at all.
"So you do speak!" Superman marveled.
"Of course I do. I am not unintelligent, unlike you lot."
Despite his pain, Flash still made sounds of protest that everyone promptly ignored.
Superman flushed. "I just wasn't sure. It was hard to tell in the video."
"Ah, yes. The video that the Fenton menace sent you. Was there a note for me in the flash drive?"
"Uh, no." In one of his less finer moments, Green Lantern stuttered over his words and moved in front of Batman, obviously lying. Dan merely growled and flew through both men, heading straight for the giant monitor. Batman barely suppressed a shiver. Density shifting? Might as well add it to the list. He could see Martian Manhunter, who was in the back of the room, tilt his head at the display.
Dan ignored the room as he used his entire body to manipulate the computer mouse and scrolled back up to the top of the page. Staring intently at the scribbles no one could make out, the heroes could do nothing but shoot each other nervous and confused glances. More than a few of them jumped when Dan chuckled deeply. Honestly, his tiny body was at complete odds with his baritone voice.
"Maybe rehab will be fun if he's letting me do this." Dan sneered, flashing their reflections a sharp fang. No one wanted to ask what exactly he was in rehab for. The little beast turned his gaze to Batman. "You are the one called Batman, who rules the cursed city, correct?" The dark hero nodded, not trusting himself to say anything. "Excellent. You will be my chaperone for now, just as Fenton decreed it. Good luck, mortal man. Pray, I do not destroy your home a second time."
Without any time to unpack that conversation, Dan promptly disappeared from view. Some blinking text caught his attention, and Batman scrolled back down to the English text, glancing at the next few items on the list.
Task 2: Do not let Dan read his portion of this letter until you have a way to track him. There is no containing him.
Task 3: Keep him with a chaperone at all times. (If you can)
Task 4: Do not let Dan back into Gotham unless you're fine with a sudden decrease in the clown population.
Task 5: Take him for a walk in Death Valley. He likes hunting lizards.
Task 6: Make sure he goes down for his 2pm nap every day.
Task 7: He'll ask for it, but do not give him any burgers for mealtime. It upsets his stomach.
Task 8: Dan gets ONE(1) sweet after dinner before brushing his teeth. Those green pop rocks Batman always carries will do fine; he likes those. :)
A sudden alarm blared from his wristwatch, making Batman tear his eyes away from the screen, indicating an emergency at Arkham. This time, Batman actually sighed out loud. There was more to the list, but right now, he really needed to find their new charge before he killed the Joker, from the sound of it.
1K notes
·
View notes
It is the five year anniversary of Clayfellows today!
In late December 2018 a post of weird little creatures went a little viral on this webbedsite and I threw together a store and a logo ASAP just for the heck of it.
In the wretched year 2020, when my clay space had shut down and I had a lot of time to experiment, I made some hollow stuff with reversible faces and Tumblr liked that too—to the point that in 2021 I had to switch store hosts because fellows were selling out too fast and even double-selling to some unfortunate souls. If you've ever been annoyed by my store: it could be so much worse.
Also in 2021 I started making Polly Pocket-esque sets of large and small guys. I thought that was 2022, but my 2022 growth areas were in fact "multimedia" and "beasts." (had to check the fellows compendium for this one!)
In 2023 I only got one online store update out into the world and people remained, as ever, with a truly astonishing rate of consistency, tremendous sweethearts about it. I also made stickers (big W).
I'm really lucky to get to make these fellows and to meet so many wonderful people along the way. Thank you for supporting them and me.
Here's hoping 2024 contains weirder guys, more commissions, boring infrastructure improvements like damp boxes, and secret schemes.
xoxoxoxo Z!
399 notes
·
View notes
Greediest man in the Stone World.
summary: you've just being awaken by your old friend and classmate, Senku, in a whole new human era. But, who's this young guy claiming you as his?
a/n: waahh, i sincerly apologise if i disappeared...again. i literally forgot my tumblr writing page, and life took a.. strange turn of events(?) kinda. i hope this first ryusui one shot will make me forgive!!!
☆
Dark. And then... a golden beam of light passed through my eyes, blinding me. My muscles began to melt. I felt them sore, as if I had slept in an uncomfortable position all night. Or maybe, for three thousand and fifty years. This was what was brought back to me when I woke up from that sleep I thought was eternal. The first thing my eyes noticed when they hatched was a blinding sun. There was so much green. So much vegetation was not seen even in the well-preserved jungles. Then, a group of boys with familiar and unfamiliar faces. My eyes met his.
"Senku..?"
I uttered that name in a subtle tone of voice, and the boy did nothing but address to me that mischievous grin of his own.
"Yoh, Y/N...we need your help".
[ Time skip...(*ゝω・)ノ ]
"So... you need my dexterity in putting these little pieces together so you can build, um... Repeat it, thank you".
"An oxygen tank" Senku rest, without even thinking of getting that smirk off his face.
His attitude hadn’t disappeared after 3,500 years. Not even when he claimed in front of a professor that their speeches were meaningless.
Here we go again...
Between a sigh and the other I immediately set to work, while in the distance I heard Senku arguing with what seemed to be his colleague.
Just in the middle of my work I felt someone touching my shoulder gently. A delicate touch, like that of a…
"Child?"
The girl in question wore a watermelon helmet on her head, with lenses inserted in the two holes that created a space for the eyes. She made a sound of wonder, her hands to her mouth.
"So, you are new here!"
With a confused look I lowered myself to her level, able to have a face-to-face conversation with the little creature. " I suppose so..? And you are...?" That little girl who didn’t immediately show her intentions and courage was pretty to say the least.
"Suika wanted to welcome you to the Science Team!" she said clearly, now showing me her hand to shake her. I took her, and with a kind smile, I accepted her request. "How kind of you! Since I am now a new addition to your team, can I have the honor to meet my future colleagues and companions?"
Little Suika nodded happily, running in the opposite direction where I was working. Heck. Maybe it was me who was no longer a child like her, but Suika seemed really fast in the race, not giving me a chance to keep up. I didn’t know where he was taking me; we passed through several huts, erected on wooden structures, running as if someone was after us.
The only one chasing her was me. Looking back to see if we’d actually drifted apart, my foot tripped on a double-sized rock. The collision with the stone made me lose my balance; I was ready to crash on the dirty ground and have some bruises all over my face for a few days. Only that never happened. In the instant that I was about to feel my face against the damp soil, two arms wrapped my waists not too strong, but with determination, preventing me from slipping a second time. I didn’t even realize I closed my eyes.
"It’s not even the first day you’re back here on Earth, and you were destined to get hurt. Pff, not very convenient for our team, huh?"
A moment later my eyes sprang to meet his, and those eyes reminded me of an autumn now close to winter. " Well, lady killer, now you might as well put me down. I’m not meant to be your princess." I said authoritatively. His powerful arms let go of my body, and with a little thump my butt bounced off the ground.
What an idiot!
Not only was he now laughing at me with a fat laugh, as if I had just said the funniest joke on Earth, but he didn’t even deign to preseed himself! The blond slightly lowered his head, as I was still on the ground, and with an energetic voice he replied:
"Not yet", later going in the opposite direction, with firm step. Oh, what kind of weird I had in front…
˗ˏˋ ♡ ˎˊ˗
"Become mine! With all my Drago you would become the luckiest woman in the world!"
Somebody kill me...
It had been two months since I had made my unexpected (better to say, unlucky) acquaintance with blondie, who had the name of Ryusui Nanami. With his egocentrism and sheer avarice, he had proved to be one of the most promising members of the Kingdom of Science so far, with great skills for navigation. Apparently he came from one of the wealthiest families in Japan, and he certainly had not lost the habit of being indulged in everything, even after 3,500 years. And since our first meeting, he hasn’t stopped trying once. On every occasion he would give me his flirtations comments (sometimes shabby), he would become handsy, or he would try to buy me with his stupid Drago.
I was not one of those women who was so easily deceived, especially if a situation was about money. He thought I would give in so easily. I was so determined to prove to him the opposite, during these months, that this would give him up. With a gesture of the hand, I pushed him away. " I’m sorry, Ryusui. As I’ve explained many times before, I’m not interested." I took a dramatic break. ".. to you."
He whined loudly like a little baby, fogetting his money behind to get close to me. "You’re making a mistake!"
"I have made many mistakes in my life," I answered sharply.
"Then add another to your long list." I nailed him down with my sharp look, sketching a tight smile. Nothing to do. That man would never wave the white flag in the sky. However, it was becoming a nuisance, and having it close to me like a fin was starting to run out. For the worse.
I had only one idea that could have saved me in that instant, from a near future in which he was no longer clinging to me like an octopus: make him believe he had a chance with me. A bold idea; nevertheless, it had to be tried. Either it will make it or break it.
"Maybe, in the future, you might have a chance…" I implied in a vague tone, already heading somewhere, any, to get him off my back. I could swear to see his eyes shining remarkably with hope, and a new fire, fueled by determination.
He snapped his fingers, his iconic gesture that everyone, by now, had learned to recognize, and if he did, it was because he decided to do something. There were no roads back.
"HA-HA!" His laughter seemed to flow throughout the Ishigami village. Even Senku and Chrome turned to us, with confused scowls, to see what was so funny at the time. But Ryusui found nothing amusing in this situation, except a challenge to complete.
"So be it! I’ll show you how much I’m willing to change your mind. Anything to get the chance to become yours!"
Though I did not turn to look at him, once again, his muscular arms clasped my waists, turning my body to meet his. Face to face. "You, damned Nanami, what do you want now?!" That gesture had taken me by surprise, because he was not used to come so near me, but with his cheeky smile, he kissed me on both the cheeks. A quick gesture that made me blush remarkably in my face, almost to feel it burn under the palms of my hands.
"What the f...?!"
"You don’t know it, but you’re already mine!"
269 notes
·
View notes
Space cat 006 🌌
Kindness that gives hope.
3 notes
·
View notes
I love scrolling through tags for gacha games I do not play. I do not play arknights. i have arknights blorbos based exclusively off tumblr and reading the wiki. Recently i learned about Reverse 1999 and learned that everyone is sapphic! Or an inanimate object. And there is a dog named Pickles. Yes I'm ignoring the men.
Really what I love most about learning about random gacha games is that every single one has an insane plot that is more insane without context. Going through tumblr tags removes all context. Some woman in Arknights ran a science lab doing unethical science and human experimentation for the (fictional) U.S. government and then she got shot into space like Laika the dog. One of her employees uses "I'm just a lil guy" to attempt to get out of ethics investigations. One of the characters you see all over the place, Texas, is Italian. There is a whole group of people who sneak out regularly to attack on titan fight sea creatures and half of them are nuns. One of them is in a loving relationship with one of her alters.
In terms of reverse 1999. There is time travel somehow. They stole Ange from Princess Principal (positive btw), let her time travel, kiss a mafia leader, watch her die, ?????, and now she's in a horror movie but for real. One of the people in the event is a deer centaur only some of the times. I don't know why she seems to be a normal human person in the trailer. There is a dentist named Tooth Fairy who eats real fairies and also has a tooth collection including a tooth from a kid she hit with her Subaru. The protagonist does indeed have a mother.
This has been my PSA for any time I reblog arknights or reverse1999 content I am just tumblr knowledgable of those games. Anyways please tell me all about things happening in your favorite gacha game and just, forget to give me the context.
202 notes
·
View notes
Master of the Mouse
Yes yes there is really filthy shameful smut ahead. Adding this to Tumblr so I can keep my masterlist comprehensive.
Raphael x f!reader x Haarlep
Word count: 3174
Crystal blue water cascaded in waterfalls from feminine statues that surrounded a familiar steaming pool.
You licked your lips, the warm water as inviting as the first time you’d stepped foot into Raphael’s boudoir.
“Back so soon?” Haarlep reclined upon a plush red chaise pushed up against the far wall. The incubus once again wore Raphael’s cambion visage.
Haarlep raised an unimpressed eyebrow, seemingly unbothered by your unexpected appearance. “We did have such a delicious time together.” He gave you a lazy smile. “Although your stamina is worse than Raphael’s, if you can believe it.” Haarlep sat up slightly, grinning at the internal conflict he sensed within you. “Did you come back for more of Haarlep? Seemingly the closest you can get to what you truly desire. Has my master remained distant? How preciously sad.”
Every word, spoken in that infuriatingly exaggerated lilt, hit every insecurity and frustration you’d been battling since your very first visit to Raphael’s House of Hope.
The demon rose with a knowing smirk, rolling his neck and stretching his wings wide. Your pupils dilated as they followed the languid movement, each action made purposefully sensual for your torment.
“I must admit, I am rather disappointed you didn’t follow through with retrieving that little contract of yours. It would’ve made for such a satisfying ending.” Haarlep took one step forward, pushing into your space, the heat rolling off his body already warming your clammy skin. “I may even be free now if it wasn’t for your…weakness.” He trailed a sharp finger down your cheek. “You’ve felt him, I assume? The heady rush in your pliable mortal body as Raphael took me in your form.”
You shivered, remembering.
“Speak, little trifling creature.” Haarlep caressed your neck, nails digging into your skin just enough to raise welts. “I wish to hear your voice. Raphael seems to appreciate when I speak using it.” His strong hand wrapped around your throat, resting gently against your collarbone with a dangerous promise.
“I…” You swallowed thickly, your hand closing around his wrist as he gave your neck a slight squeeze. “Yes, I’ve felt it. Multiple times.”
“It must rankle.” Haarlep laughed, his hand trailing down to your tattered disguise, cutting into the fabric of the dirty bodice. “He chooses not fuck you.”
Your eyes sparked fury and you pushed at his chest angrily, not budging the towering fiend an inch. “You’re just a cheap imitation. How does it feel to have been stripped of any free will and identity?”
You’d made a mistake. Taken one step too far. Only realizing your fatal error when his grip on your throat became suddenly tight as a vice, cutting off your air flow. You scrabbled futilely at Haarlep’s hand, your eyes widening in fear. The incubus’ face was a mask of dark intent, grim and deadly.
You released a jolt of magic, channeling lightning energy into the fiend. He twitched and gasped in pain, loosening his grasp enough for you to suck in several mouthfuls of air.
“The kitten does have teeth after all.” Haarlep sneered, tail lashing. “Be aware in this house we yank them out.”
You withdrew your radiant dagger, taking a defensive stance, drawing an amused laugh from the demon.
“My dear, you were foolish to return.” A new voice joined, the familiar cadence of Raphael. The cambion leaned casually against a marble column; arms folded over the chest of his human disguise. His keen brown eyes observed your standoff with raised brows. “Don’t damage my property.” He straightened and strode to you, addressing you and Haarlep. “Or I will be forced to take drastic measures.”
Raphael gave his incubus a sharp look over your shoulder. You felt the demon shrink back, temporarily cowed.
“Haarlep isn’t as magnanimous as I.” Raphael tucked a lock of hair behind your ear, taking a moment to consider you archly. “You truly have a death wish, my errant mouse.”
“You are impossible to reach.” You said, slightly breathless, the skin on the back of your neck prickling under Haarlep’s glare. “I need to speak to you.”
“Thus, you think it prudent to break into my home, in violation of our contract.” Raphael tucked his fingers beneath your chin and tilted his head at you. “The only reason you are not cinders beneath my feet at this very moment is because you chose to not pilfer my belongings.”
“Haarlep doesn’t count?” You asked, your shoulders relaxing slightly.
“Haarlep never counts.” Raphael answered firmly. “I admit to being pleased by the little surprise you left for me.”
You flushed, though your eyes did not waver from his. “Something you’ve used plenty to your advantage.”
“Naturally!” Raphael chortled, a devious twist to his lips. “Just who do you think you are dealing with, my dear?” He leaned in close, his cheek brushing yours. The air around you grew thick with heated tension. “Surely, this isn’t you complaining?”
“Not exactly.” Your eyelashes tickled your cheeks as you turned your face just enough for your lips to graze the corner of Raphael’s mouth. “Though I certainly have no interest in being second to a demon.”
“Bold little thing.” Raphael withdrew just enough to have a clear view of your face. “I do so like it when my clients have some vim and vigor.”
Raphael took a step back, his eyes roving your body. “Such rags you wear. The better to not draw ire from the residents of my house?” He smiled knowingly at you. “Such a blight upon your body offends me. Remove them.”
He could’ve just snapped your clothes away, baring you in an instant, but it was clear Raphael wanted to savor having you in this position. You slowly began unbuttoning the front of your blouse, heat blossoming pink across your cheekbones as you stripped in front of both fiends.
“Your embarrassment is darling.” Raphael slid a hand across your side, resting it upon your hip. “However superfluous. I’ve seen and felt all of your flesh while my incubus has worn it.”
You gave the devil a measured look from beneath your lashes. “You’ve never yet touched me, however. Not truly.”
“Nor you, me.” Raphael seemed to be suppressing his amusement, cocking his head to the side with a gleam in his eyes. His visage shimmered, wreathed momentarily in hellfire as it grew and transformed into his cambion form. A slightly mocking smirk tugged his crimson lips. “I have it on good authority you prefer me like this. A quaint little quirk I find endlessly endearing, love.” Raphael took a measured step toward you, leaning down until your noses brushed. “Do as I say, to the letter, and you might still get out of this alive. Yes?”
You swallowed, reading the fine line between danger and desire you now tread.
You nodded, nerves fluttering in your stomach. “Yes.”
“Good.” Raphael gave your hip a final squeeze before guiding you towards the familiar bed. “Now, lay upon your back and do not move until I permit it.”
Your obedience was the only option you had left, Haarlep followed and sat at the corner of the mattress as you laid down. You shuffled back toward the headboard until only your feet hung over the edge. Haarlep leaned forward and began stroking along the length of your legs, teasing the inside of your thighs. The demon gave you a deviously discerning look as you shuddered in response to his attention.
You turned your head as Raphael approached the side of the bed, holding a glittering decanter filled with dark liquid. Notes of a rich whiskey wafted on a warm breeze to your nose and your muscles tensed, knowing where this was going.
“Hold still. Don’t twitch, little mouse.” Raphael’s hand pressed firm upon your shoulder, Haarlep moved to hold your ankles together in one hand. “This spirit is hellishly expensive. It would be unfortunate for you if a single drop was wasted.”
With a flourish, Raphael unstopped the glass bottle and tipped it slowly and with finesse. You felt the warm liquid filling your belly button, the drip of it splashing your skin as Raphael finished his pour.
“What a sinful delight you are turning out to be.” Raphael bent over your quivering form. His breath ghosted hot upon your chest. “Now hold perfectly still for me.”
You tried valiantly to remain still, a futile attempt, your skin shivering as his tongue circled each breast and threatened to bite at your pert nipples. You tensed slightly in mild trepidation.
“Good girl.” Raphael murmured and chuckled, knowing exactly the effect his praise had. His tongue moved slowly down from the valley of your chest to your navel. You felt his tongue swirl against your skin as he slurped the whiskey down. Raphael groaned with satisfaction and gave your waist a sharp bite before withdrawing, squeezing your thigh approvingly.
Hands gripped your waist; you weren’t sure if they belonged to Haarlep or Raphael. You were maneuvered like a doll onto all fours, the hands on your waist slid to your neck and hair as Haarlep positioned himself on the pillows beneath your torso, guiding your hands to support yourself on his lap.
You knelt over Haarlep, your fingers digging into the flesh of his thighs, smoothing your thumbs over the various ridges marking his infernal nature. You glanced up at the demon wearing Raphael’s form, hellfire eyes gazing back down at you with a cocky grin.
“Now, pet. Enough words.” Raphael instructed, the bed dipping behind you and his warmth pressing against your rear. “Put that lush mouth of yours to better use.”
The tip of your tongue wetted your lips before you pressed a tentative kiss to the angry head of Haarlep’s member. Precum coated your mouth, the heat of it simmering and stinging your lips.
“Now is certainly not the time to act the part of a wilting flower.” Raphael murmured in your ear, his chest and hips pressing flush against you from behind. His words were laden and dripping with lust. “Pleasure me.”
You obeyed, taking the incubus into your mouth, the answering groan from both fiends reverberating through your own chest. Raphael began toying with you from behind, spreading your thighs further apart with one hand and circling your heat until he deemed you ready.
Raphael pushed his hard length into you, drawing a moan from deep within your throat, the sound choking around Haarlep as the demon guided you by the hair further down against him.
Your body began rocking beneath Raphael’s weight, he hissed against the nape of your neck, unable to reconcile the combined pleasure you and Haarlep were giving him.
“Enough.” Raphael’s hands gripped your hips possessively, partially holding you up as your thighs began to tremble. “Kiss her.” Raphael said, his voice lowered in pitch as he continued to thrust into you.
Haarlep obeyed, withdrawing his length from your throat only to take your lips in a scorching kiss, his hand beneath your chin. Haarlep’s long tongue delved into your mouth, your eyes rolled back in pleasure while Raphael fisted your hair from behind and tugged until your neck arched back for Haarlep’s hand to wrap around.
The incubus licked his spittle into your mouth, not releasing you until you swallowed. The effect was immediate. Fresh heat pooled in your belly. The fiends surrounding you laughed as your sounds of pleasure heightened in pitch, a buzzing molten sensation overtaking your limbs to the point of near collapse.
Raphael’s arms wrapped around your torso, grasping a breast non-gently as he lifted you and pulled your body back against his chest. “There you are.” He purred, licking the shell of your ear as you watched Haarlep begin stroking his cock still shining wet from your own saliva.
Raphael turned your head forcefully to him, licking his way across your jaw before his lips and tongue began tangling with your own. You gasped at the ferocity of his touch, your bodies rocking together, the friction building to a crescendo as the incubus spit coursed through your veins. Turning the edges of your vision white.
“So eager, a perfect jewel in the palm of my hand.” Raphael murmured, taking your bottom lip between his teeth until you whimpered. “My treasure, not yet. You still must be punished for interloping uninvited.”
Raphael withdrew completely from you, gesturing for Haarlep to follow suit. A strangled cry caught in your throat at the sudden absence of pleasure and warmth. You twisted around with surprising dexterity given your current state, glaring daggers at both fiends. You were able to tell which was Raphael by the especially amused smile on the smug bastard’s face.
“Ah, ah.” Raphael raised a finger to you, commanding you to sit back down upon his bed. His tail swished back and forth as a sly grin tilted his lips, showing off sharp white teeth.
You made your displeasure known by the petulant expression you gave him before settling back cross-legged, having no choice but to obey the devil’s every whim.
“Watch and squirm, little mouse.” Raphael kept his eyes on you even as Haarlep began biting and licking down Raphael’s body, deep red as a ripe cherry. “Keep your hands upon the sheets.”
Your gazes locked, your whole body flushing as the sounds of Haarlep pleasuring his master filled the room. You fidgeted, trying to gain some sense of friction, especially after Raphael closed his eyes and moaned low in his throat. “Be still, my dear.” His eyes opened to burn once again into you.
Haarlep continued moving between Raphael’s thighs, his wings stretching to either side as he knelt upon the luxurious rug. Raphael continued voicing his pleasure, to torment you more than anything it seemed.
After what seemed to you an eternity, the cambion pulled Haarlep by the hair away from his body. “Change.” He instructed tersely.
A glimmer of orange light surrounded Haarlep, the fiendish form shrinking into a smaller feminine shape. Your eyes widened as you saw your own visage blinking owlishly back at you, the second time you’d had such a disconcerting view.
The demon had the gall to blow you a small kiss, grinning as the blood drained from your face.
Raphael arched an amused brow as well. “Hands on the bedspread, pet.”
You felt the familiar tingle from the top of your head to the tips of your toes. The incubus in your form turned to face you and pushed their hips back against Raphael’s.
All three of you made a soft sound of pleasure.
Raphael didn’t bother to move.
He made Haarlep do all the work, the incubus riding back against his cock. All the while the cambion’s eyes remained fixed on you sitting meekly upon his bed, your aching fingers twisting in the silken sheets.
You bit into your bottom lip, tasting the iron of your blood. Your gaze became pleading, not able to look away from Raphael’s sharply angled face. His tail wrapped around Haarlep’s leg as he growled a command for them to move faster.
Haarlep bent forward, grasping the bedpost, the lewd sound of lovemaking teasing your ears and making your mouth water.
“Now, your turn to watch.” Raphael spoke, his teeth gritted from the effort it seemed to take him not to spend himself there and then. “Observe how I treat a playmate I actually desire.” He pushed Haarlep unceremoniously to the side and strode to you. His body pressed you back against the mattress as he crawled over you, his massive wings extending and falling either side of where you lay prone.
“Raphael.” You didn’t know what you intended to say, all thoughts silenced as his mouth found yours. All teeth and tongue, demanding a claim to you that no amount of magic could wash away.
He hungrily swallowed your moans and whimpers, his sharp nails digging into the flesh of your hip until beads of blood blossomed. Your hands touched and pressed against the thin flesh of his wings, his body shivering in response as he slowly began grinding down against your writhing hips.
Like the rest of his fiendish body, Raphael’s cock had ridges all along its girth. You experienced the dizzying stretch of your body accommodating his intrusion, the ridges catching and rubbing against your most erogenous parts. Your toes curled in response, your legs wrapping instinctively around Raphael’s torso. He answered with a growl as his sharp teeth found the base of your neck, marking you as his possession.
Hellfire surrounded your twisting bodies. It licked harmlessly against the sheets and your skin, framing the lurid scene in flickering light and shadow.
Pain and pleasure mixed with desire and fear.
Your fingers sought him, wrapping around his lower right horn. Raphael took your wrist and pinned the offending hand to the bed, giving your neck a reprimanding bite. “You are here to serve me.” He reminded you, his tongue soothing over where he’d broken skin. “Careful.”
You wanted to say something witty and stinging as a retort, but your mind was far too lust addled for such a feat.
You were his. He was not yours.
The igneous tension in your belly began seeping down into your legs. Your tired muscles tensed. You cried out your release against Raphael’s neck, clinging to the cambion as his body became the anchor to your own.
Raphael followed soon after, unable to withstand the way your body milked him. His seed burned into you as he slammed against your hips, each thrust drawing a cry of pained pleasure from your aching throat.
Raphael sat up slowly, observing the mess he’d made of you upon his own bed. He caressed a hand through your hair before digging his claws against your scalp, drawing from you a final mewl.
Looking conceited as ever, the devil stepped to the floor and rolled his shoulders, admiring his reflection in the standing mirror. “The wanton woman waltzed blithely to the devil’s den. With the sole aim to feel pleasure beyond mortal ken.”
Raphael grinned at you, self-assured and smug while you continued to desperately catch your breath, struggling to sit up. He tilted his head, gesturing lazily for Haarlep to approach from where the incubus had sat back against the chaise.
“Clean our guest.” With another wave of his hand, clothes reappeared upon Raphael’s form, his appearance collected and coiffed as though nothing untoward had occurred. “I have important business to attend to.” Raphael hesitated a moment, his glowing eyes looking you over then flicking to Haarlep as the incubus walked to where you still lay. “Keep her here. Our time together is not yet done. Oh, and Haarlep…” Raphael’s tone lowered to a menacing timbre. “Speak to Him about this little distraction and I will find out. I demand your silence, or I will personally strip that twisting tongue from your wretched mouth.”
Long fingers snapped and a shower of sparks enveloped Raphael, whisking him from the room and leaving you alone once again under the piercingly judgmental gaze of his incubus.
383 notes
·
View notes
Ophelia and The Orc
writer's block has been hitting me hard and i kind of forgot i created this tumblr but thank you everyone for the comments, reblogs and likes they honestly make me feel like im doing something right <3
Literotica summary: Ophelia gets eaten by an orc
Critiques are very much appreciated
2.8k , orc x female reader
Ophelia watches with big round eyes, her stomach twists and her cheeks heat at the offensive sight. Betsy was a good woman, a good wife and yet here she was on her hands and knees being…savaged by an orc.
She felt sick–betrayed. How could Betsy do this to her husband? To herself? She had children for god’s sake!
The sick sounds of her vulgar moans filled Ophelia’s ears as she watched her breasts sway from being pummeled into so viciously. Poor innocent Ophelia was aghast, she couldn’t possibly understand why anyone would want to be victimized in such a way. To get pleasure from it. It was…sinful!
Just before she could run off, she suddenly was grasped about the waist–a hand covering her mouth when she shrieked in muffled surprise and terror.
“Mmph!” she struggled against her attacker but it–no–he was far too strong. She looked up, the back of her head hitting the creature’s chest. An orc. A real one. Right in front of her face. Touching her.
It–he, smiled at her. Ophelia mistook it for baring his large sharp teeth at her. She stared at his pointed tusks in horror. She struggled further and he chuckled.
“Easy.” he rumbled, low and dark.
He was huge–bulky and big. Everything about him screamed inhuman. His green skin. Pierced pointed ears and black eyes. Ophelia felt faint.
Betsy let out another groan from behind the two of them and the orc’s ears twitched. He looked over at the sight and a small grunt escaped his lips, he looked back down at Ophelia. “Are you next?” he asks slightly smirking.
Ophelia’s eyes widened even further, practically bulging out of her sockets. She shook her head furiously.
“Hm..” he hummed, removed his hand from her mouth then stroked her bottom lip with his thumb. “Shame.”
She gulps. Shame?
Ophelia looks the orc up and down once again. She really looked at him and…there was a certain attractiveness about this orc. His strong jaw, sharp nose, and strong brow–it was all an approximation of a human man. He was just so…masculine, everything about him screamed male, and that both captivated and repulsed Ophelia.
There was also the fact that he was well-groomed. Which shocked her. She had been told all her life that orcs were dirty senseless animals that only knew violence. But here she was, safe and sound (at least he hadn’t proved to be violent yet) next to an orc that smelled like pine. Her cheeks flushed pink.
The orc seemed to know exactly what Ophelia was thinking because his smile grew wider and he cupped her chin–Ophelia’s lip quivered.
“Are you sure?” he murmurs, “Aren’t you curious, small one?” he baited–knowing full well that of course Ophelia was curious. Not about that–well, okay, not just about that. But it was a little hard not to think of that when she could still hear the dirty sounds echoing through the forest. They were getting louder, she could hear the orc that Betsy was with starting to make his own perverted noises.
“I-I…” she shook her head, “No…I…” her mouth felt like it was full of cotton. She was so overwhelmed with what was going on in front of her and what was going on behind her.
Her lack of answer didn’t seem to deter the orc but fueled him further as he moved closer into her space. Backing her up against a tree. “No?” he mocked gently, “You lie, badly,” he murmured, leaning downwards and Ophelia thought for a moment he was going to kiss her but instead he lowered his head down and traced his nose against her jaw, inhaling deeply then letting out another rumble deep from his chest.
He was smelling her. Not only that but she jumped when she felt the wet warmth of his tongue follow after. Tasting her skin, she shuddered. Was he going to eat her?
The orc began to nibble slightly on her ear lobe and Ophelia squeaked in alarm, “Please don’t eat me!”
He pulled back quickly, looking at her face–seemingly searching her eyes to see if she was being serious. She was. He chuckled heartily, seemingly uncaring about the fact that there was a copulating couple just a few feet away from them.
“Eat you?” he asked, “Why would I do that?” his words seemed genuine but then again there was a certain hunger in his eye that made Ophelia nervous. Then there was the bit about licking her and the sniffing and…it was all making her rather flushed, her thighs rubbed together under her nightdress and she felt a strange wetness.
“Stop it.” she whimpers. “You’re an orc.”
“I am.”
“Orcs eat people.”
He raises a brow, “people?”
“Women. They go missing and then…” She looks at him expectantly, and then Ophelia hears another guttural moan from behind and her nose crinkles. The orc laughs smoothly. “Why are you even here?” she asks accusingly. Was he planning to do that to Betsy too? Were they going to take turns? She shudders at the idea.
He shrugs. “Keeping watch.”
“Keeping watch?” she says in disgust, “You’re voyeurs?” he looks amused but shakes his head.
“Some orcs are, but I’m keeping watch for soldiers.”
“Why would you do that?” What business would a soldier have here? They didn’t seek out orcs, they protected the village.
His face darkens slightly but he shrugs, “It is not safe. There is danger.” Ophelia scoffed. Of course, there was danger. He was the danger. She turns her face away from his but that dark look fades from his face back into an easy smile and he forces her to look at him with a gentle hand. “Why are you out here?” he asks in return. “Are you a voyeur?”
Ophelia’s face heats. “No!” she huffs, “I’m…I just…saw..I was making sure…I..” her words trip up and she looks at him guiltily. “It’s like you said, there’s danger in these woods. I wanted to make sure Betsy–” moans, and Ophelia scowls. “I just wanted to make sure she was alright.” she nudges her chin in Betsy’s direction.
“I’d say she’s more than alright.” the orc smirks.
She gasps, “You’re perverse!”
“Yes.” He smiles, “But you like that,” he rumbles, getting even closer to her space. “You smell delicious,” The orc says and Ophelia shudders. “You smell aroused.”
“W-well I’m not.” she holds her hand out, a gesture for him not to come any closer but he doesn’t listen. She shivers again when he palm touches his muscular chest. He grins down at her. “I’m engaged,” she says, and he gently grasps her wrist which makes her bite her lip at the feeling of his warmth seeping into her skin.
He kisses her fingertips, then, sucks down on one of her fingers. Ophelia watches with a dropped mouth as he removes her engagement ring, swallowing it.
“Not anymore,” he says raspily.
“You can’t just–!” she gapes at the orc. What would she tell Michael? How would she ever explain losing her engagement ring? “Why did you do that!” she asks furiously. Though the orc didn’t seem phased by her anger at all, in fact, he seemed amused by it – if the twitch of the corner of his mouth was anything to go by.
Suddenly, he wrapped an arm around her waist, pulling them chest to chest. Ophelia gasped in outrage but the orc just smiled at her. “I can do whatever I want.” he purrs, “this is my forest, small one.”
Ophelia’s cheeks heat and her heart races as the orc begins to massage her hips.
“S-stop it!” she demands, trying to pull away but stuck within his grasp. “You fiend!” she hisses.
“Come with me…” the orc offers, “and I will show you a pleasure you have never felt before.” he coaxed. The offer disgusted Ophelia. She would never! She was a good girl. A godly woman and soon-to-be wife! The only man she belonged to was Michael and she wouldn’t let an orc spoil her body before her wedding or ever for that matter.
But as he crowded against her and took her chin gently between his fingers… Ophelia felt a heat build in her belly.
“No…” she whispered, “No.”
“Shh…” the orc hushed, murmuring in her ear. “Relax.”
His face came closer and closer to hers–his lips, hovering just over her own.
“Stop,” she begged.
So gently, he grazed his lips over Ophelia’s and she whimpered. Her legs going weak. She stupidly chased after his mouth as he pulled back and that was when the Orc had known he’d won.
“Stupid orc…” she murmurs, “You’re a no good…no good..” The curse came out of her mouth almost inaudibly and the orc only chuckled in response.
“Garrek.”
“What?”
“That’s my name small one, Garrek. Can you repeat it for me.” he coaxed. Her eyes flitted up to his and she repeated his name quietly which made him smile. “Now, tell me your name.”
“Ophelia.”
“A beautiful name for a beautiful woman.”
She scowled, “Do you say that to all the human women you seduce?”
“I don’t know.” he spoke with a smile, “You’re my first human.”
That shouldn’t have meant something to Ophelia but it did. It made her think she was special. Maybe this was something more than cruel seduction on his part.
The orc–Garrek, led Ophelia away from the tree–away from the coupling duo and brought her to an alcove, a small cave that Ophelia wordlessly entered. Garrek’s hand rested on her lower back and he guided her to some furs on the ground.
“Sit,” he murmured, and she did so obediently.
Once they were on the ground, Garrek pulled Ophelia into his lap and he smiled down at her with his sharp menacing teeth.
His large hands cupped her cheeks, thumbs rubbing her blushing flesh. Ophelia squirmed slightly which only seemed to make Garrek’s smile broaden. Sitting like this, with him caressing her, Ophelia was slowly relaxing against her better judgment.
“Why…why me?” she asks quietly, “Am I really the first human woman you’ve ever tried to…seduce?”
“Yes.” he replies, then shrugs, “Why not you? You’re here…and you’re beautiful,” he murmurs, leaning in slightly. She sighs and he leans even closer. “Will you kiss me?”
“I…” she whispers, eyes darting to his lips. They looked…soft. And green. She had to remind herself. She sniffed, looking away.
He took her chin gently and turned her face, Ophelia’s breathing stopped and she was so close to kissing him. If she so much as breathed, their lips would graze against each other. Her traitorous eyes fluttered closed on instinct.
“Just do it…” she whispered. Waiting. Wanting.
Garrek’s lips touched hers with no further warning and she was damned.
He felt warm to the touch, his lips slotting perfectly with hers. At first just a gentle peck and then a longer drawn-out moment. His tongue flicked out against her bottom lip and she gasped. Wrapping her arms around his thick neck, she kissed him back.
His hands trailed down her back to squeeze her hips. Slowly, he laid her down on her back. His lips moved from her mouth to her jaw, sucking gently on the skin.
“Mm..”
Ophelia had never been kissed like this before, not by anyone–certainly not by her fiance. She couldn’t believe she was letting someone who wasn’t Michael kiss her. How would she ever be forgiven for this…not that she planned to tell Michael. Gods no. Never. She would die before actually confessing that she was letting an orc touch her!
Garrek’s lips moved from her jaw to her throat, licking down the column of her neck.
“Don’t eat me,” she warned, breathless and he laughed. “Ah–!” He ripped her shift open by the neckline, revealing her breasts. “What are you doing–?” she gasped once more, feeling his hot mouth on her hardened nipple.
His hand squeezed her other breast, covering the entire thing with his palm. “Don’t worry. I won’t eat you…” he rumbled, lifting his head from her breast, “at least not in the way you’re thinking.”
What?
Before she could think too much about that, the orc ripped the rest of her shift off with one long tear. Ophelia yelped in surprise, clutching at the fabric but her hands were quickly pinned above her head by Garrek. He smiled down at her and she gulped.
“Stay here,” he murmured, then let her hands go to graze the sides of her body which made her shiver. He kissed down her throat, down the valley of her breasts, and down her stomach until he was face to face with the junction of her spread-open thighs. He licked his lips and Ophelia’s stomach dropped.
“Oh no!” Ophelia cried, “Don’t put your mouth there, i-it’s dirty!” the orc didn’t listen, if anything he seemed more enthused by the way he grasped the back of her thighs and held her open, spreading Ophelia wider. Ophelia groaned in embarrassment and closed her eyes as she bit into the palm of her hand.
“You seem well bathed to me.”
“That’s not what I meant,” she whispers.
“Well…” he rumbles, then licks a stripe up her slit–the two of them groan, both in pleasure. Ophelia stares at the orc with her eyes now peeled open, breath coming in pants as he repeats the action. Letting loose another rumble of pleasure, Ophelia whimpers in both confusion and pleasure.
Garrek buries his face between her legs and Ophelia yelps, “Oh! W-wait!” she cries. He doesn’t. Her head falls back against the furs and she moans, her legs stiffening. “Ohhh…” her eyes squeeze back shut and her hips reflexively roll against his mouth.
“Good.” he purrs.
“Garrek!” she squeals when he sucks on a particular spot that has her keening.
Ophelia’s fists clench, and she clutches the furs, ripping at them while she lurches to a sitting position as Garrek continues to use his mouth on her…pussy. Yes, she could recall that word being used by Michael once or twice. When he was trying to seduce Ophelia into pre-marital actions. She had refused then…but now…
Now she was in a cave, naked, splayed out on the ground underneath an orc.
Garrek groaned between Ophelia’s thighs, his wide tongue touching every part of her intimate area. She whimpered and bucked.
Ophelia was no better than Betsy. She was engaged and yet here she was laying on the ground moaning like a wanton whore being spoiled by an orc. But she liked it. She liked the pleasure he was giving her and she wasn’t completely sure it was just the pleasure. This orc–Garrek, had been charming.
The tip of Garrek’s thick finger began to inch its way into Ophelia’s cunt and her eyes went wide.
“Oh!” she whined, her hips shifting.
He growled from between her thighs, “You’re going to be taking a lot more than this later…”
Ophelia’s pussy pulsed around the intruding digit, opening and tolerating more to slide in before clenching around it and moaning.
Everything was becoming too much and she could feel a strange tightness building in her abdomen. Something felt…off–not wrong, no, this was too good to be wrong but something was coming and she felt as if she couldn’t stop it even if she wanted to.
“I feel…” she gasped, Garrek’s finger curled inside her. “I-I feel–!” Before she could finish her sentence, her mouth dropped open as a burst of pleasure shot through her. Intense and all at once, wave after wave of ecstasy as she fluttered around the orc’s thick finger. “Garrek!” she cried once more, humping his face and hand.
Gods.
Eyes squeezed shut and teeth clenching, Ophelia let out a long whine as she sobbed out her orgasm.
She collapsed onto the furs the moment the pleasure dissipated and her eyes went heavy as Garrek lapped at her folds slowly, the occasional lick making her twitch and shiver.
“Mm..” she hummed, her hand pushing at his shoulder to get his mouth away from her sensitive cunt. “Enough.” she rasped.
Garrek chuckled between her legs, eying her, “For now.” he warned. Pulling away, he laid down beside her with a satisfied sigh. Licking his lips he traced his thumb over her cheek. “There’s much more I want to show you,” he says.
She shivered, that familiar warmth pooling once again in her belly.
“You can’t have my virginity,” she said in tired sternness. “That’s…that’s for my husband.”
“Hm.”
“I’m engaged.” she reminded him.
“Not anymore,” he said back. “I swallowed your ring, remember?”
“That doesn’t mean I’m not engaged.”
He cracks a smile, “Do you honestly think I’m going to let you go on back home now that I’ve had a taste of you?”
What? Of course she did!
Garrek wrapped an arm around Ophelia and pulled her close. He laid a possessive hand on her hip and gave it a gentle pat. “I intend to keep you for myself…” he rumbled, “You’re all mine now small one, all mine.”
96 notes
·
View notes
Ok ok ok your "Humans of Transformers franchise are space orcs" rant is out of this world.
I detest with passion when humans are reduced to pets and plot devices when instead the story could be about two alien species finding one another equally amazing/terrifying for their own respective reasons.
Here is my question: do humans and Cybertronians see how eerily similar they are? They have love of music, familial relationships, similar urban infrastructure, societal structure, financial systems, competitive entertainment, organized societies and war, colonialism, recreational intercourse, marriage...
Not to mention, why was it never addressed how similar both species look: bipedal, waists, noses, cheekbones, 5 fingers, chins, facial expressions and sense of aesthetics and beauty? Sure, humans have hair but in rather strategic places.
Veins and wires, blood and energon, metal and flesh, nanobytes and blood cells, Sparks and brain impulses, sexual organs...
Imagine Autobots arrive on Earth for the first time expecting some primitive cave-dwellers, only to encounter a less advanced mini-version of Cybertronian cities (New York, Singapore, London, Rome, Tokyo, Rio, Dubai...) and societies running on scientific, artistic and philosophical development which has no right existing on the ruthless, all-organic planet such as Earth is. Societes run by creatures who 4.000.000 (the duration of their war) years ago were hanging from the trees btw.
Autobots would be terrified.
Lemme make sure this response saves this time, cause it took me a minute to answer cause my first deleted and I had so much written I got unbelievably angry and refused to even look at the tumblr app.
But here we are.
So, this is EXACTLY what I have been thinking about for who k owe how long. It’s also the intro to this wack as fuck universe idea I’ve had in my head a while, and have kinda hinted at in my other works, but I’ve never gone into detail about.
And I still won’t.
Anyways, yes. It’s crazy that we backlit humans so much when any other sentient species is about. Transformers, TMNT, etc (I’m on a one track mind, feel free to jot down any other fandoms I can’t think of). The main theme of these stories? HUMANS SUCK. And that is severely unfair. People want to cry about how much our generation doesn’t give a shit anymore. Have you SEEN the media we feed kids???
That’s why I live Humans are Space Orcs so much. It really puts into perspective how unique and batshit our species is.
So, onto the Transformers vs humans concepts. The ONLY reason (forgoing technoism and general hate towards organics) cybertronians don’t see humanity as an imminent threat, or one in general, is because of size. WE BE SMALL AF. Can’t blame them, I get it. We do the same. Insects? Fuck them mfs.
But have you seen a botfly or tick burrow into your skin? The infection that comes form that? Have you seen ants jump a small animal as a colony and absolutely shred it? Or a spider only biting you, and the horror the venom causes (recluses and huntsman’s specifically). We have a good fucking reason for disliking these mfs.
But transformers? These are organic experiences. Worst they go through are rust infections, spark death, the works. They are not at risk the same way we are. That is why they view organics as small and inconsequential. They have no idea how hard we fight to simply stay alive.
And now the similarities. It’s understandable that they wouldn’t immediately recognize the physical, cultural, and psychological similarities between our species. Transformers are an incredibly diverse race, like any other. But specifically in physical form. Your average cybertronian holds a similar appearance to your average human. We tend to have the same features, just with different names. Eyes, noses, faceplates, ears, two arms, two legs. Sure that’s average for them too. But they are unique because of the fact that they have two forms. Vehicle mode. Their mode decides what they’re second mode looks like, which can create extreme diversity is appearance. Small, large, many limbed or not.
So the immediate similarities probably wouldn’t jump out to them in an odd way. There’s also the idea that because they’re so spread out in the universe, they’ve seen other organic races that are also similar. Pairs of every body part could be the common denominator among species.
That goes culturally too. War, love, music, government, politics, it’s all a natural form of sentient evolution. Another common denominator. It’s how it’s done that makes it unique. And the similarities between human and cybertronian culture is uncomfortably familiar.
I think that’s why cybertronians are seen being closest with humans rather than other species in the shows and comics (obviously because the audience is human and they need relation to characters but shhhh forget that for a sec). This is where the theories start.
Let’s say cybertronians begin to recognize the weird similarities between our species. The really, really weird stuff. The itty bitty details. Like:
- how we also mainstream kissing on the lips as the top tier romantic gesture.
- use verbal tone and cues for our language.
- have intensely complicated interpersonal relationships in the exact same manner.
- suffer from extreme mental health issues like depression, anxiety, PTSD (I totally headcannon that forms of adhd, autism, and ocd exist in cybertronian society, have y’all not seen my boy rodimus prime??)
- will also destroy each other in the name of our gods, until we have a common enemy.
That’s just the basics I could come up with. The only time I actually saw a moment where a transformer genuinely take a moment to realize that humans can be a threat, was in transformers prime. Episode 6 of beast wars (I think, correct me if wrong), where Miko beats the ever loving fuck out of an insecticon (I think) and upon Megatron hearing this, just goes blank Kubrick stare for a hot second. Man had an ugly realization that did not fit in with anything he had experienced his whole life.
AND THEY NEVER FUCKING ADDRESSED IT EVER AGAIN. Sick of this shit. Could’ve had the most badass character development, where the humans actually proved useful and did something (it would have fit Milo’s character so perfectly too) and scared the utter shit out of the transformers. BUT NO. They continue to be annoying as fuck.
One thing I loved about TF Prime was that it canonically turned Unicron into Earth. And humans came from the earth. Which relates humans beings and cybertronians so hard. Cousins Fr. We are the cybertronian equivalent of organics, and transformers the inorganic equivalent of humans. The individuality, the chaos, the culture, it clicks. There is so much material to really go into it.
But they never do. Don’t get me wrong, I love Transformers lord and just discovering more without humans being involved. We’re just annoying af at this point. But there is so much u tapped potential in transformers actually taking the chance to LEARN about us. But we’re just friends (pets) to these mfs.
That’s why I love TF Earthspark so far. Transformers ingrained into human culture because they’re not from Cybertron, and cybertronians having to adapt to human culture because they have no where else to go. Granted, it’s a kids show. There’s only so much they can do. But I’m excited for where it’ll lead. It really shows how much of threat and ally humans are, and how we are just as diverse as cybertronians.
I need to write another fic about cybertronians meeting humans their size from our world tho. Need to continue my old piece. Would give me so much life. Y’all help motivate me, college draining my ass.
260 notes
·
View notes