#or link you to a generic post about the thing you asked them about

[wickjump]

hehe,,,, tell us ur hcs about errors dolls/puppets if u havent yet :3 (if u have please link the post !!)

HAHA SORRY THIS IS SO LATE…..WHOOPS…. anyway!!! i like error i think he’s super fun n silly and i like talking about him,,,

ALRIGHT OKY DOLLS. error has favorite dolls, and he has least favorite dolls. his favorites are aus that don't deviate too much from classic undertale, like basic theme overhauls, while his least favorites include anomalies he deems somehow more pointless or insulting than the rest, such as fresh or any other au unrecognizable as a deviation of undertale.

his favorites get more ‘privileges’, which is to say they get to sit on the bean bag with him when he watches undernovela, while his least favorites are held up somewhere by the neck like a little noose and sometimes made fun of by him. he makes plushies of everyone he meets, regardless of how much he liked them or not. he’s a collector at heart,,!!!! and while most of his plushies are sanses, because he generally interacts with sanses more frequently, he has plushies of charas and frisks and papyri and gasters, and a few others as well.

he has made a plushie of every single cast member of undernovela, and he's protective of them in a 'nonono you cant touch it you might get dirt on it!!!!!!!!!!!!!!!!!!!!!!!!!' way. so they remain carefully suspended in the anti-void, or sometimes uses to re-enact scenes from undernovela using the strings.

error talks to himself a lot with them. like, all the time. very very often. and a lot of the time this takes the form in him making the dolls ‘speak’, kind of like how it’s briefly shown in his ask blog.

this is how he keeps himself busy when in the anti void doing pretty much nothing. he makes up stories and ideas, sometimes even forgetting what was his imagination and what was a re-enactment of previous events, jumbling up his fleeting memories of life before the anti-void even more. obviously this takes place during a more isolated period of his story, and he’s better at remembering when others are around. however when left alone for long enough he’ll revert to using his dolls to mimic conversation.

he’s become somewhat dependent on them to fight his loneliness in a way i think. he’d use the clothes off his back and the strings from his eyes and a snapped off bone as a needle to make one, if he was isolated again with no way to get supplies. the time spent making them gives him something to do as well, it keeps him calm.

i like to think he, over time, has made some of his favorite dolls different outfits and such. i also like to feel his love language would be giving people dolls of him or themselves. very rarely other people they’re close to because he's a little self-centered but we love him anyway...

when someone he likes changes 'design', he makes an entirely new doll rather than updating their old one, such as when ink and dream got new designs. there is also a chance that the clothes on some of his dolls are made using the actual clothes of their dusted counterparts (ie outer, fell, etc).

he's fully self-taught when it comes to making his dolls, and his first attempts are,,, well they were something. probably a good thing they're hidden somewhere (his earliest dolls have a striking resemblance to an aftertale sans and a classic papyrus, but he chooses not to think about that for too long).

i have a not uncommon hc that error can trap souls in the dolls, essentially putting them in a coma-like state, but that’s not really close to canon and not unique or cool in any way so i won’t rlly expand there. i dont even use this hc much i just think its cool n silly.

his favorite dolls are classic, fell, and swap (he technically doesn't like fell, but he and his classic doll are bonded, according to him, so he can't separate the two. note how he's canonically called the classic doll 'sans' before but only referred to his fell/other dolls using numbers, which i feel shows his preference if only a little bit). his classic doll is his all-time favorite, though, it's even weighted. they're all comfort items 2 him....sighs

he's made a plushie of himself before that he has exclusively to act out 'what-if' scenarios, mostly pertaining to undernovela, where he's his own self insert. he'd probably love fanfiction

#SORRY HTIS IS SO LATE... #error sans #utmv #undertale #sans undertale

[sigmxnd]

Palestine info posts (with help links):

https://www.tumblr.com/sulfurcosmos/732456971539775488?source=share

i am constantly reblogging posts with other donation sites, in case any links don't work or you want to give to a targeted fundraiser. ZIONISTS/"NEUTRAL OPINIONS" DNI, YOU AREN'T AND WILL NEVER BE WELCOME HERE. 🇵🇸🇵🇸

~~

INTRO POST‼️ (i'll add stuff if things change/i think of more stuff to put)

hi, i'm sigmund, you can call me sig (or another nickname if i've given you the okay)!! my pronouns are he/angel, i'm biflux, transmasc/demiboy 🏳️‍⚧️, peer-reviewed autistic (not diagnosed unfortunately 😞), and i'm a MINOR🤬🤬🧨💥 (16👴) so DON'T BE A /NEG FREAK OR ELSE

also fair warning, i am not an nsfw account by any means, but i do make immature jokes sometimes/may reblog things that have mild or vague nsfw stuff in them (never heavily though), so if that makes you uncomfortable then just be careful following or go someplace else, i don't blame you :3

my account is multifandom cause i love a lot of things and i can't pick one thing/put a concise list, but the things i post/reblog/like most often depends on what i'm currently into (right now it's total drama), so if you're following me then prepare for a mixed bag that's filled with mostly kitkats (also expect a lot of rarepairs, whether they're joking or not. i loooove rarepairs :3)

don't be scared to send in random asks, especially if we're mutuals!! i forget who i'm mooties with if i don't interact with them a lot, so i'm sorry if i seem like i'm ignoring you or anything 😭😭 i'm also kinda generally nervous to start conversations with people sometimes, but i would love to be friends with all my mutuals :3

i have an ao3 too, also sigmxnd!!!! i haven't posted in a while, but i'm typically always working on stuff, so just always keep an eye out :3

therian/otherkin & agere account (sfw interaction only): @notmeant-tobeseen

main au ask blog: (coming soon :3)

DO NOT INTERACT (will be updated as i think of more): zionists/people with "neutral opinions", vivziepop supporters (i suppose its fine if you don't support her but still like the shows, just please don't talk to me about them, it makes me very uncomfortable), anti-lgbtq+/anti-mogai, radqueer/radinclus/radexclus/etc., terfs/swerfs, ed/thinspo blogs, anti-therian/otherkin/alterhuman, endogenic systems/supporters, dsmp fans/supporters, wilbur soot fans/supporters, if you sexualize underage characters in any media (or real people), forceful conversion religious people, and obviously racists, sexists, and pro-contact harmful paras can fuck off

#intro post #introduction #text #picture #free palestine #palestine #free gaza #art #digital art #doodle

[tls123]

no bond is stronger than that of gifmakers on tumblr dot com

#gosh the gifmaking community has always been a nice enough place #but i do remember how much more likely it was for people to #gatekeep their settings and the like years and years ago #and like i said it wasn't everyone and most people would be willing to share #but it was also just as often that they wouldn't be willing to tell you everything #or link you to a generic post about the thing you asked them about #and now! i can't remember the last time i saw someone say no to #any kind of gifmaking related question #font settings sharpening settings whole ass psds effects tutorials #it's so lovely #like i don't know how to describe how hard i have to rein in the urge to #burst into someone's dms when they tag something of mine as 'how did you color this' #because on god i will give you my psds i will tell you step by step #fra.txt

[mail-me-a-snail]

i think one of the only things vance has actually published is a simple infographic on data port and personal link consent. by publish i mean he wrote it out on a shard in the middle of the night and anonymously sent it careening thru the net

#i mean i do think there is a general understanding and agreement that youre #not supposed to touch those two things on a person without asking #maybe there are even religions or beliefs that touching those things is welcome and can be a gesture of good luck or love #btwn two individuals #but generally: don't touch a persons ports without asking!!! hand them a shard instead of shoving it in there willy nilly!!!! #ask to link up!!! #<- thought about how placide forces you to link to his computer and got really mad about it #and also the fight with the hammer lady after . like no no #dont FREAKING touch me there #my post #vance

[icewindandboringhorror]

I’m always paranoid of my tumblr being deleted or malfunctioning or something like that someday, so here’s other places to find me/follow me, just in case lol

~ instagram - https://www.instagram.com/lucalicatte/

~ main youtube - https://www.youtube.com/c/LucaLiCatte

~ games/sims youtube - https://www.youtube.com/@cloudycatte

~ facebook page (I rarely use this because I hate facebook but.. it at least allows text posts better than instagram does, so idk maybe I’d use it more if tumblr went away? lol) - https://www.facebook.com/cloudycatteart/

~ Other Links (stuff I don’t use often/isn’t Main enough to list here, like twitter, neopets, other tumblr sideblogs, youtube channels, etc.) are here - http://icewindandboringhorror.tumblr.com/otherlinks )

#An updated version of this since some of the links on the old one are no longer the same lol #I might make a website website one day (not with a custom domain since I'm not paying for that/dont have the money lol #but like a 'my name.weebly.com type thing lol) but I haven't had the time recently. If I ever get around to it I'll update the post and #reblog that version. ANYWAY.. I just like to have one of these written out to reblog every once in a while. During the once ever few months #when poeple are like 'tumblr is failing again! it wont survive!' which has happened like 80 times but I'm still always like :0c what if! #also love the ms paint art done with a mouse ghhj #ANYWAY.. also if you want to see the stinky game I made that's not actually related to my own worldbuilding really (why I have never #posted anything about it publilcy because it's like.. how do I talk about it lol) I have my itch.io linked in the 'other links' page #as well as my General Projects blog. which talks about all the ongoing and upcoming projects I want to do that are #actually set in my world and can give you previews of some of the things I'm working on. Currently resuming my Game after abandoning it #basically for the entire pandemic and a little before that - as mentioned before - so that's OUgh.. in terms of A Lot Of Work #Especially since while kind of 'revamping and updating' I want to add a few features which are mostly easy but every once in a while #I don't understand something and it's like....... hGGhh...... Ironically despite Blogging I just hate talking to people in public open foru #.. I love privacy and security lol.. and I always feel that ONE day I am going to have a question that has not already been asked on a foru #somewhere and I am going to have to post myself and.. no.. I shan't even imagine it.. It's not even really social anxiety it's just like.. #efficiency.. instead of wating like days to get an accurate response and resolve the problem with the general public I would rather just ha #e a one time 30min conversation with an expert and resolve it quickly. PLUS then I also only interact with One stranger instead of Many Of #Them lol.. any 6+ yrs of experience Ren'py experts hmu so I can pay you like $50 to have a single 45min conversation #with me over an insanely simple question and then never talk to you again until a year later when I have a second question. hhjb #ANYWAY.. I still really don't like instagram or it's layout and I never understood how it works like.. if I should be tagging photos or wha #or how you really use it and I just... euGH... stimky.. but it is one of the most popular so I feel obligated to link it. I wish facebook w #sn't such a nasty poo poo because I do actually like the variety of posts you can make and how Pages on facebook operate. In the scense of #it being similar to tumblr that you can make a VARIETy of styles of post. not just Only Post Photos or Only Short Text or Only Video which #is still like.. how the funk does sutff like that even get popular lol.. the Limited nature.. hewwo.. but alas.. and NO way I'm touching #fucking Threads please do not make an account on there and don't let your friends do it and don't let that shit catch on lol. #BUT YEahg... links...... just in case.. i hope tumblr stays aroundin it's current format forever though lol.. #I'm pretty sure even facebook doesn't have audio posts. or tags the way this does. or CHRONOLOGICAL FEED. custom html for pages.. aaaaa

[whoatemyshoe]

"just google it" "do your own homework" "google is free" "find it yourself the information is out there"

but they are. they are asking people who have that information, for the information. they are doing their homework by reaching out and asking people questions. just because it's not typed on a search bar, doesn't mean it's any less of putting an effort to finding things out.

like i'm sorry people in the past refused/ridiculed you when you asked them for help. doesn't mean you have to be like them tho. why is learning through human interaction rejected in favour of isolated learning?

#my posts #rants #im part of the organising team for the women's march in my city #and someone interested to join the march was asking public transport directions to the march #the immediately response from the social media team in our group chat was to berate that person for being lazy/not doing their homework #like sure the transit map is available on the website #but anyone who takes public transport in my city KNOWS that the trains and maps are unreliable in so many ways #i was exploring a different line yesterday and got on the wrong train despite being on the correct platform #and i take public transport regularly and have a good sense of direction but the public transport here isnt designed to be user friendly #if they had to ask which line they should interchange at you KNOW they are clueless and probably terrified of the public transportation her #and yet as organisers they refuse to make it easier for people to participate at a march no one owes us to attend #they just gave them a link and asked them to figure it out themselves #i am very familiar with that route and i just KNOW the interchange is confusing and large enough that beginner commuters will get lost #and you know what could happen if someone struggles to navigate public transport? they probably would just go home instead #they blame the education system for producing youngsters who are spoon fed #girl the older generation said the exact same thing about your generation pls #your misdirected anger is being projected at the victim of this system instead of at the actual problem #which is what i've been observing from career activists around me and more #you claim to fight for the people #but the very people you're fighting for are asking you for help #yet you refuse to help them unless it's through significant policies or drastic systemic changes #your fight is conditional and only convenient for you but you refuse to admit it and then pretend the opposite #the moment they decided that they would 'teach them a lesson' indirectly by forcing them to figure out their own routes #they've already fallen into that activist trap of thinking they are above everyone else and that they are here to teach people how to #be a better person according to their standards because they know better by being more involved in activism and are better educated #instead of putting themselves in the girl's shoes and not assuming the worst of people as the default #maybe that girl is new in town and is unfamiliar with public transport here #maybe they had a bad experience getting lost before and wanted someone experienced to share some commuting tips to avoid getting lost #maybe she would rather pull her teeth out than try to figure out the route with unreliable mountains of information online #maybe she has executive dysfunction that makes filtering through tons of information to find that ONE route very daunting

[toytulini]

not to shill for tumblr or be a mobile user on main but i do just wanna point out i think the response to the dashboard clown thing is a little disproportionate, all things considered

like if you just dont like the show thats fine but the way some of these posts are worded very weirdly and acting like its somehow way worse than.....literally any of the other ads? like yea tumblr is a company and not your friend, netflix is unethical and sucks. but like. are we pretending tumblr hasnt had ads for like. horrible fad diets and the fucking trump coin and god knows what else but like this really isnt worse than like. the fact that ppl with strobing triggers are constantly endangered by the ads on this site.

and maybe its super bad on desktop or something but so far this ad campaign has actually been one of the less obtrusive ones vs their other ads, imo. I dont think ive really seen them in between the posts on my dashboard? (hard to tell bc I try to automatically ignore those anyway) but like it feels like most of this ad campaign has been. a little fictional character at the top of the dashboard. and like. a separate dashboard "tab".....that i dont have to look at, and i dont. and its fine. i barely even noticed it. i probably wouldnt have thought twice about it if everyone hadnt started complaining about it. if tumblr wants to do more ads that are just dashboard tabs that I dont actually have to look at and arent interrupting my main dash i think im fine with that actually. like. obviously no advertisements are better than ads but like i dont have a particular problem with the structure or honestly even the content of this ad. its for a show that i might be intrigued to watch honestly. but its also not being targeted to me personally based on data harvesting its just blanket targeting to everyone.

again, id prefer no ads, but if we're going have them: i would actually prefer it be for things i might be interested in, but without the data harvesting to do it. if i HAVE to see ads, this is a way that i dont mind as much.

#toy txt post #sorry if you have a clown phobia ig. i hope one of the many posts with instructions on how to make the clown go away have been helpful for #you. i would like to point out that people can have phobias and triggers of Literally Anything so its not like there is anything that can be #advertised that is Fine For Everyone. i will admit clowns are a fairly common phobia but again i will point out the diet ads #and ask why we arent more incensed generally about the ubiquity of fatphobia in culture. and i will point out the unavoidable flashing ads #that have been a danger to ppl w strobing triggers. be that for migraines or epilepsy etc. both bad. #and i will point out. i dont THINK the clown has been strobing and i dont think the one piece ad campaign on tumblr dot com has been #particularly strobey? and i would just like to also say. its not even a scary clown. its not even like a horror ad. hes literally just like #a clown. its like walking past a spirit halloween. and tbh tis the season. sorry #idk. again. i think its fine to dislike the ads i think its fine to dislike clowns and one piece! but like #do you have to pretend its like The Virtuous Position of Righteous Outrage over an Ethical Transgression??? its literally fine #as far as my Problems With Tumblr Staff Go. Putting A Little Clown On The Dashboard As An Ad for a show is like #i dont. really give a shit. its fine. its cringe ig but what isnt. its fine to be cringe. its actually more cringe imo bc its an ad than the #the content itself being `cringey` bc u can cringe all day long at weeb nerd interests and for what? how dare genuine interest in media #i will say mixed bag of like. using ppls art within the ad campaign. not sure what the right thing to do there is tho #bc i think its honestly kind of a bad combo of tumblr trying to earnestly promote artists on the site #by reblogging and linking their work. but it is also. exploiting their art for advertisements without apparently asking or compensating them #WHICH. is still somehow a step above like hot topic and shit. bc tumblr is. i think? doing the bare minimum of linking to the artist? and #not presenting it as smth they made. perhaps in the future they could maintain the cool thing of trying to earnestly promote the work of #independent artists without it being as exploitative by like. asking permission to the artist to use their art and MAYBE even pay them #altho ig that can be tricky for things like this where its kind of fanart. but i do think they could work it out. like theyre clearly #already talking w netflix and shit so they could work a licensing deal w the artists or smth. but then that is also tricky rn specifically #bc of the strike. tumblr is a company that does not intend to join the unions. and generally i would probably prefer companies commission #independent artists in this way i think that would be cool. but in this situation specifically it would suck for the artist bc if they #approve it and get compensated for it instead of it just being fanart. now theyre Promoting A Struck Company Officially i think? #im not gonna pretend to know the details of what is and isnt allowed for influencers but if someone happens to like. be an artist who wants #to also get into sag aftra that might become a problem. idk! if nothing else. it definitely seems more complicated to navigate than tumblr #itself doing an ad campaign for netflix. which again. netflix sucks shit. but its not like Tumblr Ads(tm) are known for being only ethical #companies. i just saw like 5 ads for audible on my dash. you know. a company that i believe has had some shady shit w how it treats authors #and is owned by amazon.so like. idk. Advertising A Netflix Show is not high on my list of issues i have w staff or how theyre running things

[mostlysignssomeportents]

How I got scammed

If you'd like an essay-formatted version of this post to read or share, here's a link to it on pluralistic.net, my surveillance-free, ad-free, tracker-free blog:

https://pluralistic.net/2024/02/05/cyber-dunning-kruger/#swiss-cheese-security

I wuz robbed.

More specifically, I was tricked by a phone-phisher pretending to be from my bank, and he convinced me to hand over my credit-card number, then did $8,000+ worth of fraud with it before I figured out what happened. And then he tried to do it again, a week later!

Here's what happened. Over the Christmas holiday, I traveled to New Orleans. The day we landed, I hit a Chase ATM in the French Quarter for some cash, but the machine declined the transaction. Later in the day, we passed a little credit-union's ATM and I used that one instead (I bank with a one-branch credit union and generally there's no fee to use another CU's ATM).

A couple days later, I got a call from my credit union. It was a weekend, during the holiday, and the guy who called was obviously working for my little CU's after-hours fraud contractor. I'd dealt with these folks before – they service a ton of little credit unions, and generally the call quality isn't great and the staff will often make mistakes like mispronouncing my credit union's name.

That's what happened here – the guy was on a terrible VOIP line and I had to ask him to readjust his mic before I could even understand him. He mispronounced my bank's name and then asked if I'd attempted to spend $1,000 at an Apple Store in NYC that day. No, I said, and groaned inwardly. What a pain in the ass. Obviously, I'd had my ATM card skimmed – either at the Chase ATM (maybe that was why the transaction failed), or at the other credit union's ATM (it had been a very cheap looking system).

I told the guy to block my card and we started going through the tedious business of running through recent transactions, verifying my identity, and so on. It dragged on and on. These were my last hours in New Orleans, and I'd left my family at home and gone out to see some of the pre-Mardi Gras krewe celebrations and get a muffalata, and I could tell that I was going to run out of time before I finished talking to this guy.

"Look," I said, "you've got all my details, you've frozen the card. I gotta go home and meet my family and head to the airport. I'll call you back on the after-hours number once I'm through security, all right?"

He was frustrated, but that was his problem. I hung up, got my sandwich, went to the airport, and we checked in. It was total chaos: an Alaska Air 737 Max had just lost its door-plug in mid-air and every Max in every airline's fleet had been grounded, so the check in was crammed with people trying to rebook. We got through to the gate and I sat down to call the CU's after-hours line. The person on the other end told me that she could only handle lost and stolen cards, not fraud, and given that I'd already frozen the card, I should just drop by the branch on Monday to get a new card.

We flew home, and later the next day, I logged into my account and made a list of all the fraudulent transactions and printed them out, and on Monday morning, I drove to the bank to deal with all the paperwork. The folks at the CU were even more pissed than I was. The fraud that run up to more than $8,000, and if Visa refused to take it out of the merchants where the card had been used, my little credit union would have to eat the loss.

I agreed and commiserated. I also pointed out that their outsource, after-hours fraud center bore some blame here: I'd canceled the card on Saturday but most of the fraud had taken place on Sunday. Something had gone wrong.

One cool thing about banking at a tiny credit-union is that you end up talking to people who have actual authority, responsibility and agency. It turned out the the woman who was processing my fraud paperwork was a VP, and she decided to look into it. A few minutes later she came back and told me that the fraud center had no record of having called me on Saturday.

"That was the fraudster," she said.

Oh, shit. I frantically rewound my conversation, trying to figure out if this could possibly be true. I hadn't given him anything apart from some very anodyne info, like what city I live in (which is in my Wikipedia entry), my date of birth (ditto), and the last four digits of my card.

Wait a sec.

He hadn't asked for the last four digits. He'd asked for the last seven digits. At the time, I'd found that very frustrating, but now – "The first nine digits are the same for every card you issue, right?" I asked the VP.

I'd given him my entire card number.

Goddammit.

The thing is, I know a lot about fraud. I'm writing an entire series of novels about this kind of scam:

https://us.macmillan.com/books/9781250865878/thebezzle

And most summers, I go to Defcon, and I always go to the "social engineering" competitions where an audience listens as a hacker in a soundproof booth cold-calls merchants (with the owner's permission) and tries to con whoever answers the phone into giving up important information.

But I'd been conned.

Now look, I knew I could be conned. I'd been conned before, 13 years ago, by a Twitter worm that successfully phished out of my password via DM:

https://locusmag.com/2010/05/cory-doctorow-persistence-pays-parasites/

That scam had required a miracle of timing. It started the day before, when I'd reset my phone to factory defaults and reinstalled all my apps. That same day, I'd published two big online features that a lot of people were talking about. The next morning, we were late getting out of the house, so by the time my wife and I dropped the kid at daycare and went to the coffee shop, it had a long line. Rather than wait in line with me, my wife sat down to read a newspaper, and so I pulled out my phone and found a Twitter DM from a friend asking "is this you?" with a URL.

Assuming this was something to do with those articles I'd published the day before, I clicked the link and got prompted for my Twitter login again. This had been happening all day because I'd done that mobile reinstall the day before and all my stored passwords had been wiped. I entered it but the page timed out. By that time, the coffees were ready. We sat and chatted for a bit, then went our own ways.

I was on my way to the office when I checked my phone again. I had a whole string of DMs from other friends. Each one read "is this you?" and had a URL.

Oh, shit, I'd been phished.

If I hadn't reinstalled my mobile OS the day before. If I hadn't published a pair of big articles the day before. If we hadn't been late getting out the door. If we had been a little more late getting out the door (so that I'd have seen the multiple DMs, which would have tipped me off).

There's a name for this in security circles: "Swiss-cheese security." Imagine multiple slices of Swiss cheese all stacked up, the holes in one slice blocked by the slice below it. All the slices move around and every now and again, a hole opens up that goes all the way through the stack. Zap!

The fraudster who tricked me out of my credit card number had Swiss cheese security on his side. Yes, he spoofed my bank's caller ID, but that wouldn't have been enough to fool me if I hadn't been on vacation, having just used a pair of dodgy ATMs, in a hurry and distracted. If the 737 Max disaster hadn't happened that day and I'd had more time at the gate, I'd have called my bank back. If my bank didn't use a slightly crappy outsource/out-of-hours fraud center that I'd already had sub-par experiences with. If, if, if.

The next Friday night, at 5:30PM, the fraudster called me back, pretending to be the bank's after-hours center. He told me my card had been compromised again. But: I hadn't removed my card from my wallet since I'd had it replaced. Also, it was half an hour after the bank closed for the long weekend, a very fraud-friendly time. And when I told him I'd call him back and asked for the after-hours fraud number, he got very threatening and warned me that because I'd now been notified about the fraud that any losses the bank suffered after I hung up the phone without completing the fraud protocol would be billed to me. I hung up on him. He called me back immediately. I hung up on him again and put my phone into do-not-disturb.

The following Tuesday, I called my bank and spoke to their head of risk-management. I went through everything I'd figured out about the fraudsters, and she told me that credit unions across America were being hit by this scam, by fraudsters who somehow knew CU customers' phone numbers and names, and which CU they banked at. This was key: my phone number is a reasonably well-kept secret. You can get it by spending money with Equifax or another nonconsensual doxing giant, but you can't just google it or get it at any of the free services. The fact that the fraudsters knew where I banked, knew my name, and had my phone number had really caused me to let down my guard.

The risk management person and I talked about how the credit union could mitigate this attack: for example, by better-training the after-hours card-loss staff to be on the alert for calls from people who had been contacted about supposed card fraud. We also went through the confusing phone-menu that had funneled me to the wrong department when I called in, and worked through alternate wording for the menu system that would be clearer (this is the best part about banking with a small CU – you can talk directly to the responsible person and have a productive discussion!). I even convinced her to buy a ticket to next summer's Defcon to attend the social engineering competitions.

There's a leak somewhere in the CU systems' supply chain. Maybe it's Zelle, or the small number of corresponding banks that CUs rely on for SWIFT transaction forwarding. Maybe it's even those after-hours fraud/card-loss centers. But all across the USA, CU customers are getting calls with spoofed caller IDs from fraudsters who know their registered phone numbers and where they bank.

I've been mulling this over for most of a month now, and one thing has really been eating at me: the way that AI is going to make this kind of problem much worse.

Not because AI is going to commit fraud, though.

One of the truest things I know about AI is: "we're nowhere near a place where bots can steal your job, we're certainly at the point where your boss can be suckered into firing you and replacing you with a bot that fails at doing your job":

https://pluralistic.net/2024/01/15/passive-income-brainworms/#four-hour-work-week

I trusted this fraudster specifically because I knew that the outsource, out-of-hours contractors my bank uses have crummy headsets, don't know how to pronounce my bank's name, and have long-ass, tedious, and pointless standardized questionnaires they run through when taking fraud reports. All of this created cover for the fraudster, whose plausibility was enhanced by the rough edges in his pitch - they didn't raise red flags.

As this kind of fraud reporting and fraud contacting is increasingly outsourced to AI, bank customers will be conditioned to dealing with semi-automated systems that make stupid mistakes, force you to repeat yourself, ask you questions they should already know the answers to, and so on. In other words, AI will groom bank customers to be phishing victims.

This is a mistake the finance sector keeps making. 15 years ago, Ben Laurie excoriated the UK banks for their "Verified By Visa" system, which validated credit card transactions by taking users to a third party site and requiring them to re-enter parts of their password there:

https://web.archive.org/web/20090331094020/http://www.links.org/?p=591

This is exactly how a phishing attack works. As Laurie pointed out, this was the banks training their customers to be phished.

I came close to getting phished again today, as it happens. I got back from Berlin on Friday and my suitcase was damaged in transit. I've been dealing with the airline, which means I've really been dealing with their third-party, outsource luggage-damage service. They have a terrible website, their emails are incoherent, and they officiously demand the same information over and over again.

This morning, I got a scam email asking me for more information to complete my damaged luggage claim. It was a terrible email, from a noreply@ email address, and it was vague, officious, and dishearteningly bureaucratic. For just a moment, my finger hovered over the phishing link, and then I looked a little closer.

On any other day, it wouldn't have had a chance. Today – right after I had my luggage wrecked, while I'm still jetlagged, and after days of dealing with my airline's terrible outsource partner – it almost worked.

So much fraud is a Swiss-cheese attack, and while companies can't close all the holes, they can stop creating new ones.

Meanwhile, I'll continue to post about it whenever I get scammed. I find the inner workings of scams to be fascinating, and it's also important to remind people that everyone is vulnerable sometimes, and scammers are willing to try endless variations until an attack lands at just the right place, at just the right time, in just the right way. If you think you can't get scammed, that makes you especially vulnerable:

https://pluralistic.net/2023/02/24/passive-income/#swiss-cheese-security

Image: Cryteria (modified) https://commons.wikimedia.org/wiki/File:HAL9000.svg

CC BY 3.0 https://creativecommons.org/licenses/by/3.0/deed.en

#pluralistic #social engineering #phishing #ai #swiss cheese security #infosec #finance #fraud #carding

[shadowfoxsilver]

Some tips and tricks on how to spot scam accounts in general. This isn’t a detailed explanation as I have more info on my other blog but here is some general things to go by and what to look out for overall.

The pinned post is only a few days old or even a few hours old. The text may occasionally be multicolored for the link.

The ask they sent you seems catered to a specific issue or event and looks very odd if you read it throughly. Text might seem out of place or make no sense at all by a health standpoint.

They sent you an ask after following you and have no prior interactions and isn’t someone you’ve met before. This is usually prompted when interacting with a trending post or sharing a post related to certain topics.

The blog doesn’t have very many posts. It’s usually limited to a few posts from a trending tag, a popular topic, or catered to pass at a simple glance if you don’t scroll far enough down. Most posts are made the same time as the pinned and shared seconds apart.

Even if your bio says no aid asks, the account will send you one anyway because they don’t read or don’t care they just want your money and will keep spamming asks until you share the post or block them.

Sometimes the same ask is sent from multiple accounts all using the same story and setting as the account that sent it to you at a different time. Any errors in the text don’t get fixed and it’s usually a quick way it’s a scam.

The accounts usually base their blogs overall theme around whatever is going on at that moment more often then anything else.

Sometimes the ask is about sharing their pet aid post. Any images used may be stolen off somewhere else so it’s advised to ask them questions back and see what they can tell you and if it matches.

On occasion they’ll say to answer privately because they don’t want anyone else to see the ask.

In general, most strangers asking you for money in your inbox found you from searching tags and you need to check and ensure their being honest as scammers unfortunately exist. Not everyone asking for money is a scammer! Just do your research.

#mod talks #scam #how to spot a scam blog #long post is long

[clonehub]

SAG officially considers cosplays of current/past media as crossing the picket line as it can be seen as supporting the studios they're currently striking against.

(link is to a series of tweets, which include the original poster of the screenshot directly asking SAG-AFTRA what the rules are for paid/influencer cosplayers who want to support the strike)

EDIT 2 (first edit in tags): the tweet in the OP has been deleted, so I'll be shutting down reblogs on this post just so people don't take the link as a solid source when it no longer exists. For context, the original link was from a content creator who'd emailed SAG-AFTRA about guidance surrounding promos, contracts, and influencers. The response from SAG-Aftra likely wasn't 100% detailed because things were still being figured out. As for more detailed questions such as what counts as an influencer and other really specific questions I've seen in the tags, that's not something I know. Maybe emailing SAG-AFTRA themselves will help, although I can't be sure.

If the original email or the FAQ were confusing to you, it's likely that it's because both were phrased in a way that would be understandable to people who'd be likely to scab, ie influencers under specific circumstances. It's not really geared toward the lay person (which is what the FAQ will make clear by their frequent use of "influencer").

Again, the notes (and frankly the original link itself) have some that this is about influencers specifically. I missed that keyword in the OP (typo). I need people to stop acting like I'm willfully fearmongering and spreading misinformation. I read the full thread. I read the entire FAQ. It's on you if you do neither. At the time of my reading the thread, the FAQ either hadn't been released yet or had just come out. I also need people to stop bringing up Neil Gaiman's Tumblr post when SAG-AFTRA has their own Official FAQ on their strike site.

For the FAQ, it's here. It's about influencers, both union and non-union. Iirc the non-union FAQ has some ways to help that non-influencers can also engage in, like using a hashtag or generally raising awareness.

If you have any questions, please please please direct them to official members of SAG-AFTRA. Email Fran Drescher herself if you somehow can. Regardless, support the WGA SAG-AFTRA strike.

#ch posts #sag aftra #strike #star wars #hollywood strike #cosplay #edit: pls pls pls go into the notes and find rhe addition/correction #or reblog this version #or idk read through the link #i missed a word here but theres people acting like im fearmongering on purpose because THEY refuse to resd

[am-i-the-asshole-official]

I am not the asshole, and I think this whole thing is stupid, but I was promised that if I sent my side of things to this blog I could pick the hotel for our honeymoon, and I am marrying a man who once tried to take me BACKPACKING of all things, so this ask has become a necessity. In light of that:

AITA (I'm NOT) for planning the seating for our wedding in a logical way?

I got engaged in June, apparently in part because of my partner writing in to this blog (I don't know how to find or link to his posts, but I'm the man who got the cat to bite him, if that rings any bells?). At any rate, for the past ten weeks, I've been in the beginning stages of planning our wedding with my fiance, whom I have been secretly attempting to remove from the planning process as much as possible. I have ALREADY been given a list of his must-haves, and I AM incorporating as many of them as our budget allows. This has NOTHING to do with the emotional side of the event, and EVERYTHING to do with the fact that this is an idiot with no real planning experience or taste who thinks he knows more than me.

For the most part, this has worked very well. I'm the one who's been collating all the contact information for things, so I just replaced all the emails for the tacky companies with false addresses, responded to his inquiries as the companies to say the date was already booked or the price was outside our budget, and let him filter his way to the ones I DO like on his own. I also made a fuss about being "willing to compromise" on the few things he's picked I'm completely fine with in the hopes I can use it to make him compromise later, and have been humming portions of the songs I want on the playlist in the hopes he'll think he came up with the idea to include them himself.

None of this is the real problem. The PROBLEM is that he is deliberately ruining my seating chart, by moving our horrible friend's seat when I'm not looking.

The man in question dated both of us at one point in our VERY early 20s (both ended BADLY), is generally the messiest person we know, and will almost certainly get sloppy drunk and try to make a speech IF he does make an appearance. I'm banking on the fact that he won't, because he's also ridiculously wealthy, and will almost certainly send us some very lavish gift in lieu of coming.

He is SUPPOSED to be sitting beside my fiances aunt, at the same table as his grandmother, his work friend, and her girlfriend, because all four of these women are stone cold terrors who I believe are more than capable of keeping him in line on the slim chance he does come. My fiance INSISTS they won't be able to have any fun if they're running interference all night, and keeps moving him to sit at the head table instead. You know, where WE are. I finally caught him switching the label magnets on my planning board last night, and confronted him.

I tried leveraging how much I've been compromising already, that he's almost certainly going to RSVP no, and that I shouldn't have to deal with him on our big night. My fiance said he knew about all the fake emailing and such, and told me, and I QUOTE: "Look, the mind game shit was hot when it was just about the colour scheme or whatever, but I actually care about this. So you can suffer with everybody else, or you can do the normal thing and not invite a guy you hate to our wedding, you weirdo."

I said that if I did that, it would take out half his groomsmen, he called me an asshole and said I should go explain this to "literally any rational adult" so they could tell me I was in the wrong, and now here we are.

Would you recommend calling my fiance's bluff, since he doesn't want the man sitting near us either? Or should I focus on ensuring he'll turn down the invitation no matter what, so the matter of where he WON'T be sitting can be a moot point?

What are these acronyms?

Original post

The update

#aita #am i the asshole #the saga of proposal anon

[foldingfittedsheets]

This isn’t funny like most of my story posts but enough people have asked some for my opinions about lubricants and general tips that I figured I’d do a little master post about it.

I’m not a doctor! I just worked in a sex shop for several years and picked up a bunch of helpful nuggets, here they are.

All the links will be funny stories though, if you’re looking for a laugh.

Lubricants:

Silicone

Silicone Lube Pros: This stuff is the energizer bunny of lubricant. A very small amount goes a really long way and cannot be absorbed into the body. For anal, those experiencing vaginal dryness, or just really good penetrative sex between partners silicone is wonderful. Silicone is also extremely inert and by itself cannot cause yeast infections or allergic reactions*. Doesn’t taste or smell of anything.

*Some manufactures may add things to silicone to cut costs that could negatively impact genitals, read ingredients.

Silicone Lube Cons: Not safe with toys. Silicone lube can bond to silicone toys, this is basically always terrible. Because of its nature it can be very difficult to clean up, rags might be necessary as water will not help you much. This lubricant can feel very thin to some people who might prefer a more substantial feel. Also it can stain clothes or bedding in large quantities so having a dedicated sex blanket or towel can save sheets.

Favorite Brand: Pjur. Spendier but best overall feeling to me, nice and silky and a single bottle will last ages.

Water Based

Water Based Pros: This lube is the work horse and skeleton key of lube. If you never want to worry about what bottle you reach for, water based always has your back. It’s safe with toys, condoms, you name it. It comes in a variety of thicknesses and viscosity, there’s truly a water based lube for every preference.

Water Based Cons: Tragically, we are made of water. Human bodies love to absorb the water part of this equation, meaning it needs to be reapplied more frequently. For certain activities or bodies it’s nicer to have a lube that doesn’t need quite so much reapplication. Additionally you have to be careful of what ingredients* get added, many cost saving ones are a yeast infection in a bottle.

*Never use Astroglide, KY, or Vaseline, they bank on brand recognition and make the shittiest lube in feel, performance, and body safety. Glycerin or glycol is always a red flag ingredient for vaginal use.

Favorite Brand: Earthly bodies WaterSlide. There are So Many water based options that it’s hard to pick. This was my go to because it has a pretty okay feel but its ingredients list is short and to the point with nothing offensive like glycol to watch out for. It rehydrates very nicely if you lick it, it doesn’t throw off vaginal pH, and it’s inexpensive and easy to get. Even Walmart has it.

Hybrid

Hybrid Lube Pros: As the name suggests this is like silicone and water based had a baby. This lubricant has more body than a traditional silicone while being much more long lasting than a water based on its own. It cleans up easier than silicone and is still a good option for any type of sex except toys.

Hybrid Lube Cons: Still not safe to use with toys. That’s basically it. It’s pretty great.

Favorite Brand: Sliquid. I love their hybrid, it feels very nice with more substance than a silicone on its own and they’re a very nice brand overall in every category.

Oil Based

Oil Based Pros: Oil based is almost always on hand in either olive or coconut oil, it’s second only to silicone in butt stuff territory and some people prefer oil. Like the Roman Empire, which, I can’t blame them. Tastes and smells pretty nice.

Oil based Cons: Cannot be used with condoms. Kind of a big deal! Using condoms with anal is still a good idea but oil based lost favor when it turned out it destroys the most common modern prophylactic. Additionally oil can mess with vaginal pH. Anecdotally I’ve had people tell me it was infection after infection and others who only ever used oil. Similar to silicone, tough to clean up.

Favorite Brand: ¯\_(ツ)_/¯ I’ve never had personal experience with them and I don’t know which way to steer you, sorry. Messing with condoms mean that this lube has struggled commercially.

More Below, just don’t want this getting too long. (Also in case I need to add to this it’ll keep current version circulating if this blows up.)

Notable mentions for lube:

Spermicidal lube: Truly terrible for you. It causes micro tears and irritation which open you up to more disease and infections, besides which it tastes repulsive and is not a very effective preventative. Just don’t.

Flavored lube: I really don’t recommend this? Good lube doesn’t taste like anything, I don’t see that this needs to exist. Vaginas do not like anything sugary in them, which all flavored lubes are by nature. For health reasons it’s extremely Inadvisable to eat out butts without protection. If you must use flavored lube on a vagina haver try to focus it on the clit and not internally.

Condoms:

Condoms come pre-lubricated but did you know: Most condom tearing is the result of insufficient lube inside the condom? For safer sex put a few extra drops of lube inside the condom to increase sensation and decrease risk of tearing

Don’t store them in your wallet. Your body heat will break down the condom much quicker than storing in a drawer. If you’re going to carry one grab it fresh for a date.

Condoms stretch but they need to be tight at the base. Tight however doesn’t meet cutting off circulation. That’s a cock ring. If you need to wear condoms I recommend trying a few singles to see what brand feels the best for your body.

There are lambskin condoms but I don’t recommend them at all. They cannot be tested for tears, they still transmit STIs and they feel like wax paper. Polyisoprene is better in virtually every way for those with allergies.

Most people suffer from low grade latex allergies making a lot of condoms unpleasant. Latex was the first material able to be tested for structural integrity (they run a small electrical charge through it to test for breakages, neat right?). However! A new material hit the market called polyisoprene. It passes all the same safety regulations as latex while being hypoallergenic and contains much lower odor which brings me to…

Favorite Brand: Skyns. These condoms are truly excellent, smell and taste of nothing, and are just as safe as latex! The best. Really.

Anal:

Do not just stick a dick in a butt. Anal is about patience and many people have an awful first time. I cannot count the number of men who came in to ask, “How do I convince my girlfriend to do anal?” No. Start small, little plugs or fingers, and work your way up. Make sure things are relaxed and very very very like so very lubricated.

Do not. Ever. Numb your ass. Many products try to sell you on numbing your butt for anal. This is how emergency room trips happen. You need to listen to your butt, numbing it is how tearing happens.

Don’t rip out anal beads. I feel like it should be clear why ripping anything out of your body like you’re trying to start a chainsaw is a mistake but it bears repeating.

Butts. Will. Consume. Do not ever insert anything into your ass that doesn’t have a flared base. A flared base should have a perpendicular width of two inches to be safe. Don’t end up an ER horror story.

#ramblies #sex education #sex ed

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

#hellsitegenetics #faq #intro post #flowers #plants #requests #birds of paradise #asks #remember to keep checking back!

[nobrashfestivity]

Everyone Hates Poetry 2024

Rules

Write a poem before Feb.5th and submit it to me with the submit feature or in an ask.

Poems should be less than 500 words

You can use your real name or your blog name but they can't be completely anonymous.

Poems will be published at 9pm on Wednesdays and then a link to each poem will be added to the bottom of this pinned post so people can read them all.

I can't stop anyone from reblogging their own poems and generally sharing art is a wonderful thing, but don't turn it into some kind of social media campaign. because people with a small number of followers would be at a disadvantage. This is supposed to be fun. Please do reblog this post and tag people if you think you know someone on tumblr that might be interested. Since the post will contain links to the submissions, your poem will not be lost in the shuffle.

If I receive less than 10 entries I'll cancel the contest and consider it a failed experiment.

Public voting will begin after the 5th.and account for 50% of the vote

A panel of judges will also vote but will not submit poems themselves, and their votes will make up the other 50% of the final tally.

.There will be small prizes for the winner and runner up.

This is my art blog and will remain so, as it always has been. I'm doing this because poets here don't get much chance to get their stuff read and I have a fair number of followers. It's just a little thing to do if you want. I'm not turning this into a poetry blog or a contest blog or anything else.

Poems don't need to be finished. Due to the one month time frame I would suspect these would be first drafts, but please write something new. I want to encourage people to do something now, however imperfect, rather than showing work that's already done.

Updates will follow. Thank you!

Rule clarifications

-Please dont send poems anonymously if at all possible. I am happy to include a name that doesn't identify your blog directly but it's impossible to refer to or contact people who submit poems anonymously. I can't have anonymous poems considered without at least a name for you and if you were to win a prize, you'd need a name and address to claim it. I don't so much care about the latter part, that's for you, this becomes very disorganized and hard to regulate with anonymous messages floating in.

-Please put the title of your poem above it. If it is below it, I have no way of distinguishing with certainty if it's a title or a last line.

One poem per person please.

if you do not wish to see the poetry contest entries just filter the tag "everyone hates poetry 2024"

Due to the very high volume of submissions I am blogging them more gradually as to give more attention to each one. The same tag, "everyone hates poetry 2024", that you can filter if you do not want to see these can be used to find the submissions. If you follow this tag you'll get them all.

Please note that I am now publishing these as asks, previously I had to retype to keep the formatting and there are simply too many entries

Submissions are now closed, I will be publishing submissions all week and then when all have been posted we will start the voting (stay tuned as to how and when)

#nobrashfestivity #everyone hates poetry #poetry #poetry contest #everyone hates poetry 2024

[girasollake]

Hi! Can I request a smut imagine with prompt 48 and trope 8 with Theodore Nott.

She’s a slytherin too and a badass bitch who everybody wants to be or date

Thank youuu!

✧ theodore nott x fem!reader x jealousy x "you. are. mine."✧

(this request is a part of my writing event, here is the link to the masterlist of the fics i'll be publishing from said event:) )

this took longer than i expected, thank you for your request anon! x

told u guys i’d post smth… surprise!!!!

warnings: 18+ MINORS DO NOT INTERACT, p in v sex, some swear words, some slight cedric x reader, theo being bitchy ig, fingering, general sex stuff, orgasm denial, ummmmmm yeah i think that’s it

i’ll reread it later to fix mistakes cuz rn it’s 2 am where i live and i’m going to bed bye

•❅───✧❅✦❅✧───❅•

Your relationship with Theo was complicated. At least in your mind that was the most suitable word for this dynamic, you could never find anything else that would quite describe it. You were friends, that’s for sure, this was the only thing you were certain of. Some days you had found yourself tangled in his bedsheets, his soft fingers caressing your back as you lingered in his scent. But, there were also days when you didn’t speak to him at all, strolling through the halls and seeing him tug a piece of hair behind the ear of some Ravenclaw girl while simultaneously giving her his infamous smile. Even though you also flirted and went on dates with others, something inside your guts sunk down each time you saw him with a girl who was not you. And you could barely handle it. Every time you promised yourself you’ll never sleep with him again or give him your attention, you’d always end up doing the opposite. There was something about him that lured you in, it was toxic, but so divine. So, whenever his lips connected to yours in a hungry kiss, you’d forget about all of the other women he probably does this with. It was just you and him and your only thought during these moments was to stay with him like that forever.

‚-it’s not like it’s that important.’

‚Huh?’ You lifted your head and met Pansy’s annoyed face. ‚Sorry, what were you saying?’

¨What is going on with you lately?´She shook her head and sighed. ´I asked if you have a date for the ball.’ She then added.

‘Oh, well, not really.’ You shrugged.

‘Seriously? Is this about Theo again? I’ve told you multiple times that there is a fucking queue of guys just waiting for you and all you do is always go back to him.’ She huffed. ‘What about Mason? Louise? Henry? They were all head over heels for you, I don’t believe they didn’t ask you at least once.’

‘They did. I just said no.’ You mumbled and avoided her angry gaze.

SShe groaned and took a sip of her butterbeer. ‘I was not going to tell you this, but I see there is no other option.’ Pansy took a deep breath. ‘I heard the boys talking about the ball and Nott wants to take Arisa.’

You swallowed a big gulp in your throat and looked down into your drink. You expected that something like this would happen, you just didn’t think you wouldn’t be prepared to hear it.

‘’M sorry.’ She looked at your numb expression with caring eyes.

‘It’s okay Pans.’ You gave her a soft smile. ‘Maybe you’re right. Maybe it’s time to move on.’

Even though you tried to not think about him for the next few days, it was unusually hard. He was on your mind non stop, like a song playing on repeat. On top of that, everyone was talking about the upcoming event. While walking through the halls you overheard people gossiping about the pairs, discussing what they are gonna wear and you were also a witness to roughly 7 performances of the boys creatively asking their crushes to go with them.

You walked into the courtyard and took a seat on the nearest free bench. You pulled out your sketchbook in hopes to finally draw something. Truth is, you didn’t remember the last time you practiced your beloved activity, not that you didn’t have time, you just didn’t have any ideas. This time wasn’t different, you looked around and then your gaze rested on the empty page before you. You made a soft line with your pencil and stopped, it was like your hand didn’t want to listen to your mind. You groaned and closed the sketchbook to put it in your bag again. While doing this, you felt a presence in front of you. Looking up, you saw Cedric Diggory, a charming smile plastered on his face.

‘Hi, do you have a moment?’ He asked and you stood up to face him.

‘Of course.’ You smiled.

‘I have a question.’

‘If you want my help with something, then no. I can barely finish my own essays and-‘

‘No, that’s..’ He chuckled. ‘I was wondering if you’d want to go to the ball with me?’

‘Oh..’ You bit your lip softly from the inside. ‘I.. I’ll think about it. Is that okay with you?’

‘Surely, just don’t take too long, darling.’ He sent you a wink and walked out of the courtyard.

Later that night you were studying in your dorm, soft music was playing in your headphones as you scribbled some sigils for one of the classes. Your back was turned to the door, so you didn’t hear that someone came in. It was the feeling of being observed that made you move your head to inspect the room and there he was. Theodore Nott stood next to your door, his arms were crossed and you couldn’t quite read his expression. You grabbed your headphones and took them off.

‘Knocking exists.’ You told him.

‘Not for me.’ He replied sternly.

‘What are you doing here, Theodore?’ You fixed your position on the bed so that you were fully facing him. ‘Don’t you have any other hoes to tend to?’

‘Are you going to the ball with Diggory?’ He avoided your question.

‘Why do you care?’ You stood up.

‘Answer me.’ He took a step closer to you.

‘Maybe I am, maybe I’m not.’

‘For fucks sake, stop being a brat and answer the question.’ He said through gritted teeth.

‘It’s none of your business.’ You replied while stepping closer to him and poking your finger into his chest.

His scent filled up your nose and you felt this forbidden feeling again. Your body was lustful, for him, but you couldn’t let him win again.

He chuckled, ‘See, that’s where you’re wrong.’

You scoffed, ‘Fine. Yes.’ You spat at him. ‘I’m going with Cedric. Is that what you wanted to hear?’

His eyes darkened at the confession, which wasn’t even true. You just wanted to get on his nerves and see what he would do. You didn’t even have time to react before he pinned you to the wall and hovered over you. Your breath hitched and you tried your best to avoid his eyes, because if you looked into them, you’d lose.

‘No, you’re not.’ He stated. ‘You are not going with anyone.’

‘Why? Why the fuck do you care so much?!’ Your eyes were glued to the ceiling.

He gripped your face with one of his hands and forced you to look at him. You closed your eyes.

‘You.’ He whispered and brought his lips closer to yours before breathily adding the rest. ‘Are. Mine.’

The sound of his voice was angelic and it sent a certain feeling down to your core. You tried your best to resist but your eyes fluttered open and met his. You lost.

He grabbed your face and connected your lips in a hungry kiss. You whimpered into his mouth and cursed yourself in your mind. Why was he so addictive? Why couldn’t you quit? He just felt too good to be true. Kissing you in all the right places, his fingers touching where you needed him most, every time you felt him inside of you, it felt like heaven.

He took a few steps back and tried to not break the kiss. He pushed you onto the mattress and with one of his hands he pushed all the books off the bed. He left wet kisses along your jawline and you moaned at the feeling. He discarded both of your shirts and attached his lips to your chest, leaving a couple love bites along the way.

‘I want you to say it.’ He mumbled into your ear.

‘Hm?’ You were brought out of your trance.

‘I want you to admit you’re mine.’

‘But am I?’ He stopped kissing your neck and gripped your throat.

‘Are you?’ He raised his brow and smirked challengingly, knowing you’d fold under him.

You stared deep into his eyes and swallowed harshly because of his grip, before replying, ‘I’m yours.’

‘Good girl.’ He let go of your neck and connected your lips once again.

Soon enough both of you were a sweaty mess, clothes laying somewhere on the wooden floor, soft sounds escaping your lips as he pumped his fingers in and out of you. His breath on your neck and occasional kisses made you feel dizzy, his fingers making you squirm from the pleasure, but it wasn’t enough.

‘I need to feel you.’ You breathed out and Theo didn’t waste a second.

He positioned himself on top of you and slowly entered your aching pussy. You threw your head back and he used that to immediately attach his lips to your neck once again.

‘’S okay, darling. You’re doing so good f’me.’ He whispered to help you relax.

His voice made you let go of the tension in your lower body, finally allowing him to move at a pace so perfect for both of you. He lifted you up and spinned both of you, so that you were on top of him. His thrusts became quicker and stronger, one of his hands was caressing your breasts, while the other rubbed your clit so deliciously. You cried out his name a few times when you were close, but he always stopped just then. He just smirked every time and continued his actions, it turned him on, watching you whine on top of him. He felt he was getting closer to his release, so he sped up again, and this time his hand stayed on your sweet spot. You reached your high with a loud moan and threw your head back, your hand grabbing Theo’s arm. He released inside of you with a loud groan and you used that to push away his hand which was still rubbing circles on your bud, too sensitive for more. You collapsed on top of him and gave him a peck on his collarbone. Theo reached for the blanket and covered the two of you.

‘I lied.’ You mumbled.

‘What?’

‘I’m not going with Cedric.’ You replied softly. ‘I told him I’d think about it and..’

‘Good.’ He interrupted. ‘You’re going with me then.’

‘Am I?’ You looked up at him playfully. ‘I thought you were taking Arisa.’

‘Who?’ He replied and you giggled. ‘She asked me to go. But I refused.’

‘Why? She’s a nice girl.’

‘Maybe. But she isn’t you.’ He tucked a strand of hair behind your ear. ‘And I belong solely to you.’

•❅───✧❅✦❅✧───❅•

@ girasollake 2024

#imagine #x reader #🤍 - girasollake writing event ☾ ⋆* #theo nott x you #theo nott x reader #theodore nott x reader #theodore nott #theo nott #theo nott x y/n #theo nott x fem!reader #theo nott smut #theo nott imagine #theodore nott x you #theodore nott x fem!reader

[ryo-maybe]

can u explain why AI art is bad without fearmongering, moralizing or bootlicking lol

I'm going to answer in good faith, even though the tone you're using sounds like you're harboring anything but. The issue with AI art isn't specifically inherent to the tools used to produce it, because, ultimately, a tool is merely that: something devoid of will which, in the hands of a human, can produce a specific outcome. It's the human element that taints what we could otherwise enjoy for the unquestioningly fascinating topic that is AI art and, by extension, AI software as a whole.

Now, the problem isn't people, period, but the kind of people that are responsible for giving AI the bad rep it's been getting, along with the intent that goes into both the development of AI tools and the things produced by dint of said tools. I'm talking about the tech bros happily rubbing their hands, waiting to provide business moguls with a brand new means to commodify and mass-produce what artists stake their entire livelihoods upon, because when you have enough zeroes lined up in your bank account, your eyes are utterly blinded to the soul and personality that human beings put into their handiwork, and which a machine won't ever be able to reproduce no matter how much stolen art you feed it. Oh yeah, by the way, that's how AI art tools have been making the rounds: by chewing on thousands upon thousands of stolen pictures made by actual people so that they may learn how to ape someone's style and spit out absolutely soulless derivatives, while the original authors don't see a lick of recognition or monetary retribution for any of it. Do I need to tell you why stealing and parading someone else's art as your own is a terrible, vile thing to do?

But sure, you did ask me to refrain from "fearmongering, moralizing or bootlicking", which I guess I've already done. So since you'd rather I skipped straight to the point in a concise manner, lemme offer some quick examples of why the culture surrounding AI art has already developed into one of the most abysmally disappointing displays of how greed and an utter lack of human decency can ruin something objectively brimming with possibilities:

Less than a week after the sudden death of Korean artist Kim Jung-gi, someone trained an AI model to mimic his artstyle, having the audacity of asking for credits if anyone wished to use it. I sincerely hope I don't have to explain to you why this is a ghoulish example of the kind of tone-deafness sported by tech bros who buy wholesale into the AI art craze.

A piece of AI art was submitted to an art contest and won. The "artist"'s work amounted to little more than picking a series of prompts and letting the machine do the work. It's as much art as googling a smattering of terms and making a collage of pictures taken from Pinterest (and even then, you would have put more work into it than this person did). That they won at all says a whole damn lot about how abysmal the respect given to artists - real artists - nowadays is.

There are a multitude of people out there already selling prints of AI-generated art. I could link some of them here, but honestly, type "ai art prints" on a search engine and you'll get inundated by them. I've seen and personally know artists who have had to undersell their works because commissions were the only thin, frayed string they could hang on in hopes of making it through the week without fucking starving themselves, but here we are: any random asshole can now yell "MASSIVE BREASTS, THIN WAIST, COCKTAIL DRESS, HUGE BADONGAS" at a computer, let it mash together a trillion of other people's hard work, and print it for easy bucks that the actual authors of the basic ingredients of their insipid soup will never, ever see a dime of.

It really bothers me that you mentioned "no bootlicking". Whose fucking boots is this side of the debate supposedly tasting? That of the artists who post every day about how angry, sad and terrified they are by the prospects of what the development of AI art will entail for their livelihood and passion? What kind of gall did your mother birth you with that you have the spiteful spunk to type that word, when you've got shit like an artist who had their sketch stolen while they were drawing it on stream, then fed to an AI and posted by someone passing it off as their own art? How does that not ignite your indignation? "Bootlicking". Like anyone's tongues have been tasting leather but those of the same tech bro chodes who kept trying oh so hard to convince us NFTs were the future while ruining the environment to make the absolute stupidest point ever made in the history of humanity.