Tumgik
#no punctuation I'm not okay
destinyandcoins · 6 months
Text
if you're ever worried about whether or not you're making a difference in the world with your work, remember that somewhere out there someone is rewriting the mla style guide for like the 10th time
5 notes · View notes
morganaspendragonss · 6 months
Text
looking at everyone who writes reyes's
6 notes · View notes
graciousdragon · 7 months
Text
Can people stop fucking bullying CG5 please this is genuinely pissing me off. I don't give a shit if someone likes his music or not (personally, I do really like his music) but if you don't like his music you can literally just. Shut up and not engage. I and anyone with common sense isn't going to be mad over a difference in music taste. But how much longer are we going to have to deal with people on the internet who think its okay to literally tell people to kill themselves for no reason? It's not okay to say that to anyone regardless of reason, but the only thing he's done is make songs about memes that some people find cringe. Can we just fucking grow up and be mature about shit please?
3 notes · View notes
woulddieforloki · 2 years
Text
I can already tell I'm gonna be super salty about Love and Thunder Taika if you diss Jane one more time I'll strangle you so heads up that I tag all my salty posts as "negativity" and I'll be adding specific tags like "anti Love and Thunder" and "Love and Thunder negativity" so you can filter them out
8 notes · View notes
pa-pa-plasma · 2 years
Text
I just really want to say, the reason good & accurate grammar is important in writing isn’t because it makes you look smart, it’s to make your writing as easy to read as possible. I (& many other people with certain disabilities) can’t read your writing when the paragraphs are longer than my phone screen & several people are talking at once with no commas or apostrophes.
#i'm not saying this to put people off writing i'm saying this because i'd like to read some people's thing but physically cannot#because of the above example#i've seen people complain about how ''good'' grammar doesn't exist & whatnot & like. true ya#but also no. 100% completely false#grammar is made up but that doesn't mean it isn't important#like. the point of good grammar is to get your idea across to the reader. it is to help them understand what's going on#they can't be expected to understand what's going on if you never use apostrophes to indicate possession or whatever#plus not using commas & apostrophes can lead to. interesting results.#best example would be that ''lets eat grandma'' one. you're either a cannibal or you're inviting your grandma to eat#& yes the reader can figure out which one you mean regardless of whether you use the proper grammar but like.#you don't put all that onto the reader. it pulls them out of things & now they're thinking ''wow okay we're eating grandma lol''#they're no longer in universe. they're now just reading words. you pulled them out with that#i'm begging for people to read books. any books. don't just write & read fanfiction please just go to the book store & pick a book#that looks good & bring it home & read it. analyze the writing style. incorporate the parts you like. repeat#please im begging you people to get past a 1st grade level English class. you're a 20yo native speaker#you've gotta know how to use punctuation at this point. or you gotta know you need to learn at least#okay sorry the more the think about it the more frustrated i get. writing is a hyperfixation
4 notes · View notes
keeps-ache · 2 years
Text
i have done that waking-up thing, i hear it's aaaall the rage!
i'm also still tired, so sleeping means nothing! :)
4 notes · View notes
spiritofjustice · 1 month
Text
every time i see John Garrideb i feel so bad for the fella. they rly portray his wife physically abusing him as funny and lighthearted. frankly i don't think a woman hitting, throwing things (including a KNIFE), and pouring scalding tea on her husband who has done nothing wrong is very funny personally!
1 note · View note
gender-euphowrya · 11 months
Text
i'm fucking proud of how far i've come like i used to feel like there was no hope for me to get my shit together but guess what. i just sent an email and didn't panic for 15 minutes over how to phrase it
0 notes
capslocked · 2 months
Text
PASCAL
male reader x karina & irene
part 1 of two roses, by every other name
28k words
Tumblr media
It goes without saying that Karina’s reputation is flawless. 
Irene’s is remarkably not.
You're not even staunchly a romantic or anything. You just can’t be assed to manage the distinction between desire and distance. So when the dust settles, the best case scenario is the three of you going around telling people, "all of this is actually a true story by the way."
-
You don't need the extra helping of moody and foreboding, but the wind picks up enough to chill you to the spot.
It blows some of the longer, darker strands of Irene's hair into her eyes and she shivers, too, against the cold as she tucks it behind her ears. You’ve got both hands balled into your coat pockets, watching her pretend like she isn't about to say something you absolutely do not want to hear. Then, a sigh - the length of which is probably unwarranted. You can feel the frost on the air burning through your teeth as you face back out toward the taxi stand. 
It’s gotten late and you're still waiting on an empty cab - you’re realizing there was never a conversation to be had in the first place.
“For what it’s worth,” Irene says, and there’s an indecent proposal just in the way she glances at you. “I had my eyes on her first.”
It’s all on account of some sort of moral quandary, or whatever nonsense Irene pretends to believe every time it comes up. A gross power imbalance; an issue of innocence and entitlement; a threat of abuse. Something, another thing, patriarchal expectations, blah, blah - she fudges around the details, but never ever cares who gets hurt. Not really.
And it’s doubtful Irene believes what she says, not to mention she’s skeptical anyone is even capable of zipping their way down Karina’s denim, working a pair of hands up the contour of her long legs, and making her pant and gasp hard enough that she forgets to breathe.
Well, supposedly - that is anyone, save the two of you. Nevermind the fact she’s always, always been off-limits.
The bottom line is she's a whole decade younger than either of you. This just for starters - only legal for alcohol by some narrow margin. Because between you and your fiancée there are all these rules: no coworkers, no labelmates, no close mutual friends, no personal assistants, no jealous ex-lovers, and absolutely none of her juniors. It’s in poor taste, among other things.
Also, just as straightforward: crossing any number of those lines has its own kind of appeal.
"Okay,” you say, “then maybe you should be the one to tell her we’re taking her home."
Irene's arching her eyebrows at you like a silent rebuttal. She smiles after a laugh, quick and easy, because it's what she's good at. It's what she knows. “Like you weren’t hoping she’d be here, too."
The ash Irene taps off the end of her cigarette falls to the ground like snow. Hitting the pavement as if it might punctuate the thought. That's a rare first mistake from someone like you, and then a second one from her: she thinks she’ll need to defend herself with an explanation, like she’d ever need to justify anything to you.
“Besides, she’s not waiting for me to ask.” There’s a curl to her mouth - and then, she adds, for your benefit, "she'd follow you anywhere."
The twisted irony is that the two of you could pick up any woman, anyone at all.
"I think it’s a discussion for another day," you tell her, serious. She laughs out loud.
"Which one? Who Karina wants, or that you're aching every bit as much as I am to spread her out on our bed and fuck her? Because I'm pretty sure we can both agree that at this point-"
Your palm curls around the nape of her neck with a touch of on-your-feet-thinking: one of these moments that lets Irene sit with the knowledge of how small she really is against you, her head against the collar of your coat, chin angled just so to look up at your face. And there's only a beat that passes between your fingers in her hair, tugging gently as her hand releases to your waist, her teeth clipping against the press of your lips, before a cab pulls up right next to you. You kiss her hard. It probably looks cinematic.
If for nothing other than to give Karina one less thing to overhear when she comes back outside to join you.
"Really not the time," you whisper right into the subtle twist of her grin. Her cigarette's gone out in the snowy mess, but Irene smirks deeper in response before throwing it onto the wet concrete. She grinds it beneath her boot like a reminder, her hand still firm on your hip.
"What, you don't think it’d make her day? Don’t think she'd want to hear all those kinds of thoughts running together through our heads?"
You pull Irene in closer. “She’s not you.”
-
For context - only so you’re aware how it all starts - it wasn’t actually New Year’s Eve, even though everyone had been drinking like it were.
Also for context, it’s not something you were strictly invited to either. Irene’s company holds this holiday party at the end of every year where all of their employees show up (read: idols; Irene likes to argue about work sometimes - to which you have never contested the value of her labor - but your brain tends to fuzz out in the middle, and instead you mostly just watch her pretty mouth in motion). All of the high-up executives and department heads bring their uptight wives and girlfriends to some restaurant ballroom for a cocktail reception that only really functions for name dropping, or influencing the media, or placing side bets on who is sleeping with the CFO - or whose mistress might show up unexpectedly and meet someone's wife face-to-face for the very first time.
It happens to someone Irene knows, once. You pray every year it will happen again.
Be that as it may, there are a plethora of other terrible ways to spend an evening and a half, but it’s all laid bare in Irene's contract - attendance being mandatory; enjoyment excessively optional.
And sure, it’s taken time, but you have gotten used to it: the industry, all of its excess, the inevitable display, the million and one things required of Irene that you, on the other hand, will simply never be able to relate to.
The machine’s so fine-tuned and tightly wound, like clockwork.
"Yeah, whatever," she had said, leaning her hip against your bathroom sink earlier in the day. Her dress laid out neatly across your bed, already pressed, set with her heels and jewelry, everything set on schedule to the point of absurdity.
And so it goes.
You can hear her brushing her teeth through the open door - and see her profile through the hand-swiped-fog on the mirror. She drags the toothbrush to the corner of her mouth: "And before you even ask, yes, you have to come. That's the deal. That's always been the deal - bored, or busy, or trapped talking to some social climbing board member who’s realized the liquor flows fast and free - I don’t wanna hear about it. You’ll be there."
"Uh-huh," you say, eyes fixed on her reflection in the mirror.
"Look, I hate to be the bearer of bad news,” she adds, spits, and lets the faucet run, “but this one’s shaping up to be a really long night.” 
You watch the meticulous effort to pull her dark hair back into a low, neat bun as she turns and comes back into the bedroom, tossing her hair clip onto the bed to reclaim later. 
“So I guess, pace yourself or something.”
"Ever the salesman, Irene," you say, facetious.
"Um, saleswoman, thank you." Her words are slightly muffled by a silk tank top pulled on over her head, then down the flat length of her body until it hits the tops of her thighs. 
It’s not a matter of opinion that she'll look gorgeous in the stilettos, the dress - those earrings that catch light wherever it dares touch her. She'll smile her practiced grin. It'll probably taste sour after the hundredth person asks how long it's been and she tells them she can't remember. But then look - Irene here, still perfectly disheveled: her damp-darkened hair sticking to the porcelain skin of her neck, skin washed free of makeup. She’s beautiful. In a plain and simple way, simple-but-good. Even with the tight little scowl she shoots your direction. It’s a look she has to know could launch a thousand ships; could start a real, actual war; though you're far too charming to know how to fight - you’ve never seen the appeal.
Irene's teeth tug at the corner of her lip like she knows you'd probably end up dying in it. She puts forward this unassuming, nonchalant, “hey.”
She muses it right into a laugh. Covers her genuine smile with her fingers.
"Hey," is how you answer, always.
You’re noticing, now, the strap of her top has fallen just down the petite slope of her shoulder. You want to get your fingers beneath it. Maybe get her back in the shower. You’re never too picky.
And here: an unspoken demand, the thing that always gets you about her - while Irene stands in front of you, her finger looped between the top buttons of your shirt to draw you close. The bow of her lip perked ever-so-slightly, this soft pucker - all pretty in pink. "Before I slip into this dress, you’re going to push me against something sturdy and kiss me until I'm dizzy," she instructs, calm and methodical.
"A lot," you continue for her. You nod seriously, for a moment. "Dizzying."
She closes her eyes and leans in, and you lean into her, too. "Yeah, exactly," she ends up murmuring under a hot breath. "So, get to it.”
And so it goes, and so it goes.
-
"Have a drink," someone keeps saying.
As a matter of fact, they all do: four shots together - or one old-fashioned, or two vodka seltzers, or three of these mystery concoctions that come in a tall-stemmed glass you didn’t actually catch the name of, and jesus, it fucking reeks of prosecco. You pace yourself, within reason. You really do.
Irene gets elusive under the surface, which is to say, she doesn't change at all - not even at the edges.
And though everyone is here to be seen, only a few actually do any of the talking. Irene has it covered - you do your time.
Happy New Year, sorta. You wait it out.
-
She tastes like everything sweet, strong on her heels and sharper on her tongue - and sometimes, it’s not the best mix, given all you can manage is the touch and scent of Irene without actually getting at the insides of her thighs or that tempting stretch of skin under her ear, her neck, down to her chest.
This much, and she has no complaint - hardly seems surprised or inconvenienced - to you stepping her into the wall like it's a matter of instinct.
She just sighs, a short huff. "Don't miss these kinds of parties," she then confesses, right into your mouth, her warm exhale filling you whole. The sounds of people laughing and champagne glasses clicking nearby, a new song starting up, it's all an unnecessary backdrop, and Irene isn't distracted by a single bit of it.
Character, setting, scene; it’s all rather textbook, no? 
You know what the sounds mean, the soft hums, the lingering touches, the firm press of your palm into the dip of her waist or the slender line of her back. She knows where all the cameras are because she knows everything that anyone could possibly ever want to know, such as the fact that this empty stairwell is a perfect place to start, that there isn't a real plan as to where this might go - or when it should end.
And you should know where not to press - or bite or grab or leave a mark - not in some liminal space, nor some vacant practice-room, not beneath a desk, not behind a curtain. No, not here, cloaked in shadow and secrecy, another scandal in the making. Not that the knowledge stops you from testing out the lines, from drawing little patterns up Irene's waist, slipping one hand along the barest skin where her dress has hitched up along her thigh. To a boundary, the low pitch of her voice, some suggestion like, "not here, are you serious?" mumbled across your lips like it really doesn't matter what gets said or does not.
She’s pinned so properly, so precisely, that the discord between her gentle coaxing, and your hard, bruising edge - that sheer incongruity between what you should do and what you should not - can make the adrenaline spike.
She kisses you harder - and harder, and harder. She catches the small sigh you let out. She kisses you breathless.
You can’t shake the feeling that you’re wasting an opportunity, given that you’re both dressed to the nines and are usually more homebody than anything else. Isn’t that the irony of fame? You sign up for an escape, and spend your life running away.
Irene eventually sinks back into the soles of her heels, wiping her mouth with the back of her wrist, and she smiles so easy. She tugs at the cuffs of your jacket, sets your collar flat and proper.
"I'm thinking," you hear her say, taking stock for herself, the flush high in her cheeks, the tousled sort-of-curls now bared, "in half an hour, if you feel like leaving early, we could, oh, I don't know - escape?"
Escape to a bed with a door that locks, you assume she means. Irene wants; you deliver - however she'd like.
“Sounds tempting,” you tell her. She laughs against your shoulder. "Are you waiting on someone else to sweep you off your feet, maybe? Another offer?"
"Uh, always," she scoffs. It's the little things, confidence, and certainty, the honest-in-practice; how her palms sit soft and secure, cupping the angle of your jaw, one hand, now, toying with the knot of your tie like she's contemplating just how it might fall off of you later. Irene shrugs, leaning her weight back against the wall.
She taps a finger to her lips. Ends up saying, very solemn: "Thirty minutes."
As if you had any intention of absconding without her.
-
Irene holds true to her word - she catches you on the second to last pass around the banquet room. Some executive with a slack mouth is just launching into what sounds to be a spiel about a merger - it's unimportant, not well-versed, so Irene sidles up to you, and immediately steals your attention. It doesn't bother you in the least. She curls her finger into the cuff of your jacket sleeve, and without really being prompted or asked - and only, probably, due to the clear discomfort she has being there with anyone else - she begins dragging you out of the room; you, her ticket out of hell.
"I'm so sorry," Irene dons the industry smile and is probably charming. It's difficult for you to tell. You follow her blindly. "So sorry," she tells someone else as you exit, just before you both disappear entirely, "We're leaving. But, we'll see you next year, promise!"
A real celebrity.
The two of you suddenly a duo - and for everyone’s safety, the way it should probably always ought to be - here’s how it’s all supposed to go:
You, standing almost amidst a bank of snow gathered at the curb, your coat fanned out around Irene, shivers racking up her slight frame. All hidden just enough that if anyone were to notice where your hand ends up arriving at the narrow of her waist, they might think: 'it's not really any of my business,' and look away.
Her, curled beneath your touch - even the single press of your fingers over the small of her back as a stranger pulls a car up to the curb; or, the pull of you that ensures the driver can't actually see what you're both up to, what you're hiding; the little reach she makes into your pocket for a lighter, smiling appreciatively as she presses her cold face to the crook of your arm, your jaw, the juncture of your neck; a safe space.
“So.” Irene will look up at you, pale moonlight gathered in her lashes. She’ll make another face: this thousand kilowatt grin or her brow raising - sharp, quick, there-then-gone. She'll turn the lighter over in her hand once, twice, and say, “how long has it been since we’ve done anything social?”
You’ll know it’s not what she means, but you’ll offer her the out anyway: "could go downtown - there's a place you've probably never been to. Might even play your style of music, if you're really lucky."
Irene will arch her eyebrow as she raises the cigarette to her mouth, lit up before you know it.
"Is that right?" she'll say, dismissive, a smoky tendril curling up over city neon and catching starlight.
You're no stranger to what’s actually being suggested - an unspoken sort of arrangement. All because Irene sees herself as being above, hiding her intentions in euphemism, tact; in long, slow drags; in lilting lashes - while she's fully and shamelessly aware there's nothing virtuous about it.
Who the hell else could make it sound dignified, pretty even: ménage à trois.
Then, you’ll do your part. You’ll help interpret: another girl, gorgeous and probably unclothed, another bad decision, or two, the three of you finding yourselves back in your apartment where Irene will not hesitate to run her tongue up the side of a sweat-glistened neck, to tilt her head and whisper out a mantra of, honey, sweetie, anybody ever tell you how good you look between a woman’s legs? Or, fuck, let’s get you out of those jeans, let me take you all in, how the fuck have we not gotten our hands on you before?
Which means the question you really ought to be asking sounds more like, “maybe we can invite someone over?”
You’ll meet her eyes as they flick up - a lazy expression, easy to read. "Bingo," she’ll say, blowing smoke and even more caution to the wind.
Almost to a fault, everything she does draws attention. Every fool with a blog and a camera posted outside of an event will have her labeled on-sight. You can already see the headline - because the only thing worse than everyone thinking you're the antagonist is looking the part. The imagery, red carpet, sexy evening dress, sultry, regal. The caption, Bae Joohyun - they use her government name like they really know her - sulking in smoke, or thirty flirty and thriving? below a thumbnail of her holding the cigarette, with your suit jacket draped over her shoulders. She's a total tabloid darling. Irene the temptress, or Irene, ice in her veins, or Irene - "How does she look so fucking gorgeous without makeup?!" or "Do I wanna hate her, or wanna be her? @RedFlavor_ROYAL," or "In every shot I feel like Irene has me staring into her soul."
Add that to the fact the girl’s utterly shrouded in myth.
Everyone running amuck with speculation; she's the girl-next-door, she’s the fantasy-in-real-life, she's someone everyone could see themselves fucking - she’s the heroine they say, the villain, the perfect wife, the one-that-got-away. They never do decide.
Though there’s only one opinion she’ll concern herself with, and only on occasion: yours.
Her fingers will come in the dark to trail feather-light from your collarbone, between the rise and fall of your shirt buttons, before pressing open palmed to your chest to still right there, and she's such a pretty thing in the plain black dress, all yours and very much in the mood - which you'll already have reason to know, in part from having felt your way around her no more than a hour prior, but also just the way Irene's been looking at you from beneath her dark lashes all evening, that subtle predatory gleam in her eyes.
You’ll hold her close. Irene will have the audacity to comment, “love you,” in this delicate little whisper, quiet like it could go either way - affection or gratitude. Maybe a touch of both.
A car will shortly arrive, pulling up to the curb with snow melting under its tires, headlights in your eyes, and then finally, in no particular order, your heart hammering: the click of the lighter, the falling ash, the sweet easy laugh, the crunch of ice under foot as she steps down beside you, the soft sweep of your arm.
You have no complaints about the proposal. A lack of argument or dispute is basically the same thing as consent, isn't it? For all intents and purposes, as a whole, it's really kind of a win-win:
Irene needs variety, which you're well aware of. It's only natural for someone who can have anything they want. And, sure, you happen to be a willing participant when it comes to satisfying the occasional whim.
So - the conversation will follow you right into the backseat of the cab, simply to iron out the details. 
“Tall. Beautiful. Soft, soft, soft - like cashmere, a luxury brand," Irene will have one heel off and her knee braced up into the back seat while the other leg extends across your thighs, fingers running along your coat collar to make idle circles against the exposed skin there. "Or, at the very least, someone with a little more bend to their character - you know how those prim and proper types always get a bit lost in you.”
"And wouldn’t you know."
It’ll sound smooth, probably. Irene will roll her eyes.
“So, okay,” you'll return to her, right after instructing the cabbie how to get to Irene's place. None of the implications here are lost on you. “You have anyone particular in mind?”
"Hm, I’m thinking."
You can picture it, roughly: Irene's whole body sunk into the dark corner of the seat - one leg idling over the other. Her foot bouncing at your thigh. She has her heels in one hand, earrings in the other.
She’ll look wistfully out the window; the intermittent flashes of city lights casting her face in different hues. The curve of her jaw; the stately line of her nose; her thick black lashes - composition and subject. It's this kind of attention to detail that the cameras scramble to pick up. It’d be better if they got it for the right reasons.
You’ll pull out your phone. Start the usual scroll from the top of your contacts. The girls you know, the girls you don't, the ones who might be awake or who definitely are, regardless of time of day or night.
Irene will finally perk up, gleaming.
Someone cute, she might say, only because she'd rather not admit, someone like me. There's limits to her vanity insofar as her taste - in all sorts of things.
But she does like the idea of it. Someone young and pretty and impressionable; someone naive, or tiny and helpless; it's never difficult to find the girl who will fawn over her - all wide-eyed and doe-faced the instant Irene floats her fingers across her collarbone, smirking - when she starts at the zipper at the back of her neckline and says, "we’re going to see how wet I can get you," without missing a beat. Someone who will eventually say please when Irene gets a little stern and tells her, "ask me what I'm gonna do to you," in a rasp so smoky that it would make the cigarette seem blasé.
But that, you suppose, is the nature of Irene. A touch domineering. A little more than just a pretty face.
She always takes, but she takes gently - a push here, a pull there, she knows people will give her anything.
It will be more obvious when there's a small voice trembling between the two of you, twisted up in your sheets and simpering with the gentle sort of affection that Irene deals so expertly: two fingers sliding up, pressing down. Curling, beckoning. Slow and tender, without giving up that she's looking for any soft spot; a weak point. Some vulnerability to exploit.
It'll be right after whichever plaything of the hour pulls her lips off yours, off the length of your fingers - or when she unfastens her mouth from the hard shape of your cock with an obnoxiously loud pop: "do you guys do this kind of thing often?"
And Irene, without even an ounce of hesitation, will rip right into the sheer of her stockings, letting out an aggressively casual laugh. She’ll plant a kiss somewhere deep. Say, "oh, honey," as she nuzzles into the crease of her thigh. "We're pretty new to this too."
Everyone, just - believes her. For the same reason you suppose they believe she's perfect. She’s good, really good at all this.
In the taxi, Irene's foot will continue to tap against your leg, until you're stopping her by covering her knee with your hand. As for now, the evening will remain all but written in stone. You'll run a hand through your hair, you’ll lean an elbow against the window - the whole while, ignoring the sudden itch between your shoulder blades at the thought of something else. At the thought of all the other girls who'll take an instant liking to her. Who wouldn't. 
The light will change. The intersection will empty. The radio will turn to static.
You'll eventually offer up a name like, "Jennie Kim," among others. Moving alphabetically down your contacts list. Taking you a long while to make it through the 'K's.
"Hm." Irene's soft hum of disapproval, non-committal. "Are you asking, or telling?"
The difference won't matter. "I'm suggesting," you'll say.
You’ll watch how Irene turns the name over in her mouth a few times before smiling - how she knows, there's the smallest part of you that has her held in a certain light. "Maybe," she'll say, tapping her phone against her cheek in the contemplation of whether or not this is a tentative no or a provisional yes - when really what she'll avoid an answer with is, "aren’t we a little tired of Jen?"
Tough to say.
Good, sweet, and just naive enough to get twisted up between you, in her case. Oh, Jennie’s the type of girl - you'll stuff your cock in her pretty little cunt while leaning into her, taking her arms and pinning them to the base of her spine, so she can't reach and can't claw and can't make an utter fucking wreck of herself. The two of you have known Jennie for too long, is what will strike you then. And a moment later, the idea of sinking into her ass from behind with your palm flat and warm against her hip and your voice husky and deep in the way she likes, and saying, god, fuck, Jen, you’d let me do anything wouldn’t you, you’d let me cum in here too.
And - she would, really.
She wouldn't even complain. Her face would be pressed so firmly against Irene's thighs, and she would whimper, not beg. Even though you know it’s what Irene might prefer; how it makes her look real cute - cheeks stained crimson as the syllables roll around her tongue before being forced out into the open.
"I think she's great," you might say out loud, lowkey.
And in a voice that is louder than strictly necessary, Irene will cut in: "she lets you finish in her ass, and then not even three minutes later she'll say it was the best lay of her life, of course you do."
It’ll make the cab driver clear his throat.
"What you’re saying is ‘no.’"
Irene will frown, thoughtful, but not conceding anything - perhaps she means hold onto that thought for now. If nothing else sounds particularly enticing, we'll call it a maybe. "I’m saying: Jennie is. I don't know."
You can hear the end of her sentence: not quite good enough. Not this time around, but someday, sure, someday soon.
"And for the record," Irene will follow, casual, with a dismissive hand wave. "Just because you got to her first doesn't mean she's ever liked you more."
The few that fall afterwards will never make the cut. Irene will turn them all down. Jisoo - no, sorry, look, she's so, so pretty, Irene will be trying to explain, gesturing in a way that's hard to interpret. "But a little too stuck up for my tastes."
You've been speaking in code for years. She means: way, way, way too straight.
"The blonde though," Irene will try right after that. “Daisy, or Lily, oh god something or another, what was her name-”
"Um, do you mean Rosé?”
“Yeah.” Irene will sink back into the leather, sipping down a memory or two and shifting her skirt up the top of her thighs.
You'll consider the angle. Your options: Rosé on her knees right inside the foyer of your apartment, Irene's hands wrapped tightly in her hair, controlling the rhythm. The way she gets her fingers spread under Irene's knees and draws her forward, pushing up with her eager, prying mouth - licks and licks, nosing against the heat of Irene's pussy until she’s gasping and locking her hands around the younger girl's head to steady the jerk of her hips.
Then, you'll laugh out loud. Because you know, Rosie isn’t anywhere close to straight enough. 
And the back-and-forth of what-ifs and could-bes will follow. An endless string, a laundry list. Where Irene makes a face for every name, every suggestion: too messy, or too innocent, or too sweet, or too boring, or not nearly shy or gullible enough, or whatever other bizarre caveat she finds to slot between all of her impassioned criticisms. The cabbie will be shaking his head at some point too, because the question hangs over the taxi at large: 
What exact criteria could possibly be good enough for the distinguished tastes and sensibilities of Bae Irene?
-
(The truth is: it doesn’t go like that at all.)
-
Enter then, Yu Jimin.
The run-in starts there, downstairs, out standing in a pool of warm, yellow light. The snow flurrying about in the glow of a street lamp - melting into where her smoothed curtain of jet-black hair spills over her shoulder and trickles down her sleeve. She looks a little cold, but not noticeably shivering. There's a red flush to the exposed length of her legs, between a pair of knee-high boots and the short hem of the coat itself. The stockings underneath offer little in the way of wintery protection - nor do the little bows that rest at the the bands of elastic around her soft, pale thighs - though it's obvious to anyone who's looking why she'd choose to wear them.
An assay into form over function. She's never cared for pragmatism.
But the lines around her are pristine, a clean-cut of shadow and substance; you take a step onto the curb, feeling yourself fall right into the foreground.
Look: you know Karina. You both do. Enough to recognize where it’s calmest before a storm.
Irene eventually calls out her name into the silence, and there is a split-second where her fingers reflexively wrap around the crook of your elbow. Almost possessive.
A car rushes by. Karina turns with her ungloved hand holding her cellphone to her ear and she's fucking gorgeous as can be, always pinning you with these big, unapologetic eyes - strikingly and somewhat deceptively innocent beneath her sharp brows. A breathy huff in response; she's otherwise unaffected.
Her shoulders shrug in easy dismissal; a quirk of the corners of her mouth. She slips her phone back in the pocket of her pea-coat. "Oh, how we all doing?"
Not for long, the question lingers.
"Fine," Irene finally replies, though her voice doesn't rise above a disinterested murmur.
"Easier, right? To fight for breath down here than it is up there," she says, pointing her gaze up high into the rafters of the building, and in a lot of ways, you realize, she's just like Irene - sweet, charming, this uncanny ability to make you think she's close, when she isn't actually looking to share anything. When she hasn't exactly decided that she likes you or anything at all.
You squint slightly. Take in where her silhouette appears darker against the backdrop of city lights, blending with the velvety black, bleeding into the ink-smudged night sky.
"There's certainly something to be said for flying under the radar at these things," she continues, taking one step closer towards you as if for comfort. Or privacy - to guard against anyone who might walk by.
"You've still got it easy," Irene says, "that, and everyone thinks you're too pretty to go after. No one even seems to consider the idea, it’s insufferable."
"Jealous?" Her tone is playful. There’s a smirk she’s suppressing - until she can’t hold it in: an unexpected, stunning smile, dimple and all. This incongruously kind face.
Oh, and listen, no one gets it better than Irene.
"No," Irene exhales, hot. “Not at all.” You can see where the thin plume of her breath hangs over her like a cloud for a moment, thinking, before dissipating against the harshness of a frigid December breeze.
"Really." She smiles at you again. Makes a sound that could be a laugh, you don’t know, the wind takes it, far away.
"Are you out here waiting for someone?" you have to ask. 
"Loaded question." Karina purses her lips for a moment. Her long eyelashes blink once, twice. "Because, I dunno, aren't we all?"
"Some of us more than others." Irene speaks quietly, moreso to herself than anyone else - but somehow her voice carries.
"Cheeky," Karina says, and this time she does laugh. "No. I'm waiting for a cab. I've had one hell of a night, and no interest in spending the rest of it in some rising socialite's bed, doubters excluded, because - look, I'm happy for you guys, I guess? You're gonna get married," she claps slowly, slow and mocking, slow enough that Irene rolls her eyes, "-or, the two of you will make a statement saying that you are - either way it sounds fucking exhausting - congratulations to you both. But seriously, congrats."
This is sorta how you've always known her. 
Faintly-hinted secrets, flirty half-truths. Her love life is an utter wreck, but that’s not something you’re supposed to know. So that's all she gives, which is more or less how everyone knows her. It's the only way to survive, probably, in a world of glitter and glamour, when everyone's vying to look, to feel, to take, and take, and take. Irene knows how suffocating it can be - she doesn’t lie about it, not to you, which is the only reason you're so well-versed.
Point being, no one wants to admit to any cracks in the fantasy; the gold too shiny, the surface too slick, the mirror too smooth for that illusion to slip.
"So go grab a guy with a half-decent smile and get him to buy you a drink about it," Irene suggests, derisive, "arch your back, push your tits out, get creative. I doubt it'll be much trouble at all."
Karina looks down, back up - with a slight chew of her lip, saying, "you just have me beat in all the important ways, I suppose. You got it in the bag, no real competition."
Irene is smiling, but her expression is unimpressed; it doesn’t mean much, really, to be her friend, her colleague, or worse, her opponent. Irene is calm like an evening in July, a low, cool, languid feeling. "I don't mean to be a prick, but, aren't you a little young to be so jaded?"
"Gosh," Karina’s grin doesn’t change, but does turn a touch wicked, like she's biting back. "I'd hate to be around when you do mean to be a prick, but maybe we'll find out - you know, down the line, someday.”
Irene tuts softly. It sounds patronizing. "Please, you'll have to forgive me - for mistaking you for someone more aware of how the rest of us work."
“You're one to talk, Irene."
“Careful,” Irene warns.
"What, you gonna set me straight?"
"Right." The way the word rolls off Irene's tongue, slow, thick, bitter, like molasses; like the coffee she has when she's tired, like the cigarette she swears left and right she’s cutting out and the vodka she needs you to reach for in the upper cabinets, like the person she is after midnight when you've let her keep drinking to find the limits to her inhibition. You understand Irene too well. And no matter what anyone says, you will not have the facts wrong.
There's no kindness to the way she laughs. None.
She tilts her head to you, grinning: an honest grin, her favorite thing - inimitable, unique, and hers alone; her version of cruelty is what will always have them doubting. You hold her gaze as she adds, "of all things, right now - wouldn’t you just love to set her straight?"
-
Depending on who you ask, you’ll get different results.
Irene insists you kissed Karina first, probably out there in the snow - god knows how cliche would that be.
She also insists that it was you who suggested that “there’s a lot more sense in splitting a cab,” and then minutes later, “please, it'd be no trouble, just let us pay. Our place is five blocks that way," and Irene - being Irene - mentioning it's actually quite a bit further, but hey, it isn’t worth splitting hairs over. And it's not worth explaining - she shuts you up with another kiss, pressing her weight hard up against you, the arm she slings around your neck.
Then in a sort of mythologized version of the timeline, it's you who makes the proposition - invites Karina upstairs, with the charm that Irene knows is usually reserved for her benefit alone: that slight tick of the brow, the delicate slant of your mouth, the confidence you seem to have in thinking no one will ever say no, no matter how brusque the invitation-
"You two are unbelievable. Is this really your standard procedure?" Karina asks, once you're through the door, or maybe during a bout of smalltalk in the kitchen. Something flirtatious; and suggestive, and maybe a little offhand. A pointed glance downwards, back up. All it really will take. "You get some girl into your home and they're just so overwhelmed and dazzled and in love, they can't even make eye contact for longer than a second? Because that's quite a line," a soft huff, the exhale that seems to carry the faintest note of a sigh. You could call it wistful. Just this side of romantic; very attractive.
“That’s more or less the gist of it,” you offer.
“You’d be surprised.” Irene is lingering on it, back against the counter beside you, laughing. "Some people are more than happy to be swept off their feet."
"Imagine that. If that's how this is meant to go, then tell me," and Karina lifts her chin, a breath drawn slow and deliberate, "what exactly do prince and princess charming do next?"
Consider that Karina’s interpretation of events is closer to reality: no pretense. She is not drunk, and in this story, she never will be.
But it's the slow-burn thing, the rivals-to-lovers thing, the sexual-tension-through-conflict thing, the white-hot-blistering-rage matter gone awry. Not a series of happy accidents, but a result of intentional circumstance - this slow arc of descent. She knows exactly how Irene is tightly wound, and which thread to pull to make everything start to unravel. She'd flirt with you right under her nose - say things in this obnoxiously girlish tone, pout a lot, lean into so much innuendo it becomes impossible to miss the meaning, or the sincerity behind it.
If you had to guess - Karina’s been pining since forever, since Irene accidentally etched her DNA into the girl upon saying, carelessly, that she’d always seen some part of herself in Karina. Probably around the time Irene wrapped a palm over an expanse of bare thigh, just beneath the hem of her skirt, telling her, you're getting way too pretty for your own good.
Doesn’t matter who you are, that’ll fuck you up for real.
And it's not just how she looks at Irene when she thinks no one is watching either; swings and roundabouts, Karina probably can’t keep the thought of you sprawled out over Irene’s petite little frame, or Irene kissing you hard while wrapped around you tight. Your hand, her hand, intertwined and picturesque, sliding down Irene's stomach. Together - and so very without her - fingertips stroking lightly over Irene’s clit, gently dipping inside her.
Irene is not stupid. She picks up on everything, and there's a lot to unpack:
"Can you believe it? Minjeong just asked me if I've ever kissed a girl before," Karina had said to you once, ages ago, between a workout or dance practice, something or another - she was wearing a loose-fit tank top and very intent on showing off. She seemed then to be taking mental note of the face Irene put on, the look of someone trying to hold in an aneurysm.
“Well,” you played along, because you’re not really without blame here either. "Have you?"
"Oh my god." Karina knew what she awas doing, the playful slap to the chest, the lingering touches she’d have on you every chance she could get - total fucking coquette - anything to get a rise out of you, your fiancée. She hushed her voice down to this strategic whisper that Irene could just overhear: "of course not."
You better believe Irene broke her composure not soon afterwards, after Karina made her exit. 
"Do not fuck her," she demanded, firm, "I don't care how good you think she might be in bed, or what she would probably let you get away with."
You remember the knit of her brow.
“Do not.”
You’re sighing, profoundly. The memory - not to mention its shocking clarity - has put a smug sort of satisfaction into your bones, indulging. The nip to Karina's jaw, a hot, open-mouthed kiss to her shoulder. A hand tracing down the curve of her hips, under the guise of helping her settle between the cushions of the couch. You feel like you catch the color flooding her cheeks. Then, Irene, her pretty little shadow: the steady presence over her other shoulder.
"What." Karina sounds defensive when Irene pulls her lips away, but the hand she has buried in Irene's hair doesn’t appear to be going anywhere. "Are we going to pretend for a minute I don't see the way you're both looking at me right now?"
"Don't be stupid, darling, of course not." Irene leans up close again. Kisses up her neck, behind her ear, and coos, "the two of us, you just seemed like you were needing someone, that's all," and then whispers the words, barely audible: "I mean look, who wouldn't want the three of us right now?"
Karina hums. "Ah, so - you think I deserve to have a little fun."
"Maybe," she draws it out a little longer.
Your hands dip below her knees, running over the silk-slick surface, tugging at the frills lining her thighs - feeling up over the outline of where her body curves under her dress. Over the dark pattern printed across the front.
Karina swallows visibly, her head dropping back against the armrest, the couch cushion; by the way she shudders slightly and starts breathing, you realize that it's probably been a while since she's had much experience being in a position this helpless. You draw your fingers lightly across the bareness of her skin, right as Irene finds that sensitive spot just where her neck slopes to her collarbone. You trace along the fabric until you have her squirming beneath you both.
She sucks in a breath as Irene drags a touch right over the obvious seam, across the expanse of her hip, and despite your fiancée being a tad forward -
"Both of you should know I'm not that type of girl. Who puts out so easily-"
"Likewise," Irene practically sneers, not missing a beat and threading her fingers beneath her jaw, feeling her pulse against the pad of her thumb.
"Yeah, well. If this isn't a setup, then, what-"
“A setup.” Irene breathes the word out, contemptuous, which is almost as if she says yes, you figured it out, and she starts to lean in closer - the distance between the two of them now negligible as her mouth tightens with her derision. "That is awfully conceited of you."
"Ha."
You choose right there to run your palm between her thighs and cup at the front of her pussy through the skirt of her dress, squeezing tightly. There has to be an element of good cop, bad cop to this whole routine, and you'd be remiss not to participate in the former. Irene's glare is starting to become pretty intimidating.
"The way I see it," you begin, and it's so gentle. Easy to slip through, but easy enough to grip - no threat, or indication that she should stop rocking forward to the motion of your fingers, toying idly. "There's no catch. Only: Irene calls the shots. If you end up with a crush, or worse, think you're in love," a light squeeze to illustrate the point, the dig of nails, not too rough, but definitely drawing attention. "You've gotta walk it off.”
Karina just runs her tongue across her lips, sighing.
“No strings attached, no special treatment. Or anything."
"Oh." Karina is looking straight at you, dazed - as your fingers work harder, picking up where her hips started rolling a second before. She licks her lips. "You're telling me that I'm going to get fucked so thoroughly here, that it's gonna be a problem."
"Actually," you pull away, pushing her dress up so you can touch up ever higher this time. Rooting between her soft thighs. "I can't make any guarantees. You'll need to convince us first."
There's a laugh, from a spot inside her diaphragm - and yeah, there's no denying the reality here. She's nervous; or excited; or nervous-excited. Karina just lets it pass, an exaggerated sound in her throat, before gasping on an exhale of breath: "convince you to fuck me?"
"Between us, we've kissed our fair share of pretty girls in the heat of the moment," Irene supplies.
Karina laughs. Starts saying, "in that case, can I start by confessing that this whole exchange has left me pretty fucking wet-" 
You slip one finger down the rise of her panties, this lacy little number she probably picked out with sordid fantasy in mind. 
"Oh god," she says, voice drowned in her throat, husky, and sultry - it’s really hard not to appreciate the girl, like this - and then she closes her eyes, saying it again, "oh, yeah, like - like that. Okay, thank you."
Irene puts a hot kiss into her lips, and a subjugating silence stills over the living room, softening around her small voice, her breathing. Everything comes together so seamlessly, so effortlessly: 
The click of Irene’s heels against hardwood, these soft sounds of wet tongues twisting and bodies grinding, Karina's face, buried somewhere under Irene's chin, letting out the cutest moan. Irene's helping the rest of the dress up over Karina's ass, then up past her waist, pulling down the scalloped elastic of her stockings. She grabs hold of her hips, feeling the draw of her curves there - you watch how your other half does the thing she does best, the thing where she strips a girl down to nothing like she's doing them a favor.
"Pretty," Irene appraises her naked body - not her face, not her mind, not her ambition or the strength of her determination, or god forbid, something banal like her personality, but, "fuck, look at you, look at this figure," her palm skates along the plane of her stomach, "so pretty."
It could be the insinuation: Irene is ready to reduce the girl down to a heap of jumbled nerves; to tears, probably - given half the chance. Like she's telling her a body as flawless and well-manicured and sweetly receptive to being toyed with as hers needs to get absolutely wrecked, among other things.
(Fucked so deeply, and to the point of utter exhaustion - the point is that she forgets her own name.) 
Irene knows just by looking, her eyes tracing down each and every one of Karina’s curves like they’re taking inventory. It could be as simple as a handprint seared into her ass, a stinging red stain etched into her soft, creamy white skin, marking the insides of her thighs, her beautiful fucking tits - oh, the things the two of you could do.
"How do you want it, exactly?" Irene's eyes are dancing around her face, in her stare, darting down, then back up. "How, baby."
Karina smiles against Irene’s lips like she knows the answer, the perfect one. She must already have the script prepared. It's no stretch of the imagination: "anything, as long as it means you both keep looking at me."
Because maybe it's down to the pure physicality of it all. Something Karina's been waiting to feel, desperate to have, for some time - as you set into action, dismantling any pretense that you weren’t about to devour the heat of her aching cunt, from running touches all over her slick pussy. It’s a strong theory, you figure, from the visceral response you get when you get start to fuck her, when you slide a finger inside: tight and snug, and so unbelievably wet. 
“Oh,” she breathes out, and it sounds sated and needy all at once.
You make sure to glance at her face before pressing another into her. All the way past the knuckles. She looks lost to the feeling, the pleasure; her expression gone hazy-eyed as you start fucking into her with a few steady pumps of your wrist - slow and then faster, then faster again - fucking into her with increasing urgency.
Just to keep her gasping, panting.
Like a woman starved for it.
"God," Irene kisses softly into her mouth. Her hand tangled in Karina's hair, twisting strands between her fingers and tugging just shy of something painful, "you're really sensitive, aren't you?"
Karina nods, slightly. It’s all she can manage.
You have a soft spot for girls who will spread themselves open like they can't wait, but still end up flustered over how your lips ghost across aching flesh. Who can't even form the words - asking for this, and that, and a million little things; and look at Karina - blushing, her eyes fluttering closed, and digging her nails into the couch the moment you finally put your hot mouth on her. Her entire body is drawn taut like a live wire.
"Relax," you coax, speaking more to the muscle - her legs tensed, and knees pulled tightly together. You know just where to place your lips to make her go to pieces, but it's worth suspending pleasure - your own, and Irene's, who won't admit that this sorta turns her on too - so Karina's face might open up, so the tilt of her brow can slack, and the twist of her expression can soften. Like it's the only chance she'll ever get.
When you place your palm across Karina's stomach to steady her and look up, Irene has started peeling off her own clothes, down to nothing but the little panties underneath. That garter-belt thing that makes her ass look like she was sculpted straight out of clay - a reminder she's always worth your time, no matter what mood she's in, or whether or not she'll eventually let you take the lead. She's lifting herself on the couch to throw off the little slip of a dress, the high heels. “Baby," she purrs, teasing, maybe to distract from how she’s gone from dragging circles with her fingernails across Karina’s collarbones to kneading roughly at her tits. And she might even insert something she's never actually had a chance to confess out loud, or even consider much, like: she's been dying to know what Karina's face will scrunch up into, or what her eyes will look like, tears stained across her lashes while you fuck her within an inch of her life. The image you’ll find when you find all those spots that drive a girl wild.
Your mouth drags over the slick, her lips, her clit, and down again - as if to illustrate the point.
"That feels - so," she starts, and bites off the rest of the words.
Irene grabs hold of Karina's hands. Presses their mouths back together, and bites Karina's bottom lip. Kissing the words out of her, the sentences that start in half measures and stifled gasps:
"- so, good, oh. Do - ah, fuck. Oh, god-"
-and vanish somewhere in Irene's mouth.
"-oh, do that again. Oh my god. There. Just - lick- please, keep fucking, exactly that-"
And pay close attention, because here now is how she slips: from the image she maintains for the cameras, the audiences, her admirers, her competition, her detractors, the ones who mean it, the ones who don't mean a damn thing; the girl who shies away from anything overtly sexual, or sensual, or remotely hedonistic; and doesn't act as though she too, just as much as anyone else, needs someone to fuck her stupid - as if it's an eventuality of her own humanity, instead of a concept she's learned to scorn.
Irene picks up on the distinction, all too familiar with the look filling out across Karina’s angelic features.
She ghosts her thumbnail across Karina’s nipple. Tries out: "why don't you make her cum, baby, right here, on the couch.” A look at you, a quick tilt of the chin. Then, her tongue peeking from behind her teeth, and her voice dropping, "just so you can tell Minjeong, or whoever ends up asking - 'you have no idea how good they fuck.'"
And just like that - with Karina’s body laid out beneath Irene’s hands, your mouth - you simply fucking ruin her. 
You both do. 
Until it's only a mess of whines and shuddering limbs and that lovely look: pure agony. So helpless. So utterly exposed.
Karina hiccups something incoherent - you’re doubling down. You’re working your touches through the torrid mess between her legs. Her pussy is shimmering wet and hot and every bit as pretty as she is. Then, the motion of your tongue, the slow, heavy flick back and forth, relentless and constant - dragging back and forth, keeping her right up, riding the wave. Back and forth, back and forth. 
"Oh my fucking god." Karina can only gasp, jaw-slacked open. 
Overwhelmed and blissed-out and suddenly awash in this searing and wondrous sensation that the only real way she's able to make sense of is by twisting her hands in your hair and pulling you flush against her cunt while she cums on your lips.
"Ah - you're fucking kidding me. Please, don't stop, please don't-" Karina has her head turned. Voice pitched right into Irene's shoulder. You fuck her on two fingers until she’s got the heel of her palm pressed firm into her forehead, and she’s starting to jerk her hips into your face. Stutter her breathing, her words: “I, I, I- fucking - what the fuck, you’re making me - jesus fucking christ."
Like some delicate and intricate piece of her had just been irreparably snapped. Broken. You hear her expletive-laden screams - and think, better her, than either of you.
And all the way through every last part of it, cresting, waning, quivering, the tremble of her thighs snapped shut against your ears, the grind of her teeth, and each little choked out gasp-
“I'm… fucking cumming.”
Karina spends the entirety of her first orgasm between the two of you, heaving.
The look on her face alone, just from what parts you can see, has your lower gut clenched - it goes from anguished pleasure, mouth pulled wide and brows wound high and tight, all the way to calm and cathartic, the pretty bow of her lips settling into something manic. Eyes softening with a luster, half-closed. A mask, the afterglow: blissed-out and smiling dreamily.
How anyone could say no to a picture like this, you're unsure. Though not particularly willing to test the theory, naturally.
"That was mean," Karina finally huffs, letting a moment pass to even out her breaths. "Both of you, so mean."
"You said to," is all Irene says, amused. 
Karina looks down; lifts her head just slightly - as you bring your own mouth off her, catching her glance. Not even your palm and your fingers covered with the evidence - it's her lips that give her away, the swollen, pouting, bright pink lips of her pussy, still radiant with her climax.
She breathes, "god. Irene."
It sounds an awful lot like she's begging for mercy.
Irene hums softly. Leans in for a kiss, with her slender hands cupping Karina's face. Manages to say: "you just look so fucking hot when you're struggling. Can’t fault us for that." She reaches down, and digs her fingernail into the line of Karina's cheek - near the center, just short of the outer curve where her dimple naturally settles. She works her lips to a very soft, "ow."
"Listen," Irene says, "is there anywhere else you've been considering going? Because in the event you're looking to stay for the night-"
Karina replies, "only everywhere I still haven't gone."
Her smile looks honest. Her cunt seeping and slick - there's abundant honesty there, too. And you manage to catch the wicked glint in Irene's eye, like she's a bit obsessed with all that glisten, and what it means - that Karina hasn't felt a real, good dicking in ages. Maybe, probably, never. That she's slept with everyone and filled her quota of playing pretend: of someone just going through the motions, dragging their mouth or tongue or cunt along the most obvious, conventional routes.
It’s written all over her face: the girl between you needs to be touched everywhere, and by someone who knows how. Needs it deeper, more. Has to feel the pressure everywhere all over.
Irene asks her, plainly, “how might we get you moaning like that again, hm? We're both dying to know."
She puts her hand under Karina’s chin, tilts her face towards hers, and kisses her long and deep. Until the both of them are having trouble catching any breath. Until they have to break, only so one can take another in: inhale, exhale, and back in her mouth.
"Maybe." Karina lets go of Irene's lower lip. She sounds almost bashful, "you'll need to let me get my hands on that cock of his. Let me get it inside, want it real fucking deep inside. Tell you if I'm just, you know. Really fucking horny. Or maybe I have some hangups about sex I've never told anyone - and we have to work past that," she takes Irene's mouth into her own again.
It's the short consideration of sure, mm, why not? until the next suggestion is: "he should be on his knees, in bed, those hands around my waist, behind the small of my back and pulling me into every stroke."
“Oh,” Irene agrees, “I love that. Should I play with myself while I watch him fuck you senseless? So hard and rough - you'll start seeing stars. I wanna see him completely railing into your dripping pussy from behind, fucking you so goddamn well until you're screaming so loud it’ll wake the neighbors."
Karina sighs. “Well I’d hate to get all the way here and half-ass it.”
You barely catch it, but there's a lovely note in Karina's voice. It’s saying, and don't you dare treat me like glass, like I’m fragile.
All in all, a filthy, filthy way for a girl with virtually no ill-reputation or ill-gotten gains - no record whatsoever - to describe how she wants you to fuck her, until she’s biting down on the consonants in your name, moaning loud and unmistakably clear, and-
“-sorry, whose cock?” Irene has no intention of letting her off easy.
You draw away from the meat of her thigh, licking your lips clean, and insert mid-conversation with a husky-voiced, "hmm?"
Karina just shoots you a sharp-eyed look. "You heard."
"Only," you play dumb. You run a hand between her legs, using your palm as you go, so you can pull more sound out of her throat; the pleased sighs, a hum. Another. "The part where you want it 'real fucking deep inside,' I think I heard."
"I mean, wouldn't you?" Karina looks satisfied with that. Lets out an easy laugh and turns to Irene. "Besides, I need to know if it’s more than just pretty eyes and a handsome smile that you’ve gotten yourself so hung up on."
The tilt of your fiancée’s brow above her is noticeable and apparent. Not a twinge of surprise; more like recognition. It's Irene looking haughty - beyond the usual - wrapped up in the afterglow. It's the confidence, and not at all humbled by the reality that she is no stranger to fucking a girl this downright gorgeous, knowing the danger inherent in allowing that kind of damage, but if Irene has you figured - she's figured Karina even better: someone willing to push through the burn. Someone, she’s betting, with the capacity to handle pain like it's an artform.
“Karina,” Irene says, and she's really leaning into it, "you really ought to be more careful with that smart-mouth of yours.”
It's the absolute worst way to proposition someone; maybe second only to what Irene whispers straight into her ear:
"If I had to guess, it’s your sweet, pretty face that has everyone bending over backward just to let you fuck them, hmm?” 
You’d anticipated this much. You watch how your beautiful wife-to-be eases forward and leaves a slow kiss into Karina's throat, before adding the worst, most awful thing she can manage, “they're eating up this adorable, innocent facade of yours just as soon as you let it slip - letting you straddle their waist, and slide right on, and chase some clout out of oh, she must have this tight little cunt, or how good it would fucking feel to ruin a load just slamming these perfect tits, or. The best of the best, when it comes to pretty things with brains and mouths on 'em: 'fuck, I bet Karina has a face like an angel, she's the kind of girl who probably really, really loves taking it raw - filled and fucked as deep as she can manage'."
“She’s insinuating you’re a slut,” you offer on the next beat, down from between Karina’s knees. “Or something.”
"I put that much together." Karina has that teasingly pragmatic tone in her voice, matching Irene's level. "Your point?"
The joke is that even Irene - after she has the chance to drag her thumb across Karina's lips - looks mildly impressed.
"Sweetheart," the corner of Irene's mouth quips, as if the reason is so, so very obvious, "let’s say you’re just like me, total hypothetical. You're going to have to let us know which part feels better: the praise, or the degradation. I know it’s what makes you tick: all the attention. I know you need it. The same way I know that I could eat this perfect pussy out for hours just to get it slick, and wet, and wanting, and the thing I’m still not sure you’d be ready to learn," she tells her, a light in her stare that flicks upwards, eyes going from Karina's cunt and back to her eyes, her own mouth, and then hers, "the really good sex? Isn’t always pretty."
There isn't room for misunderstanding, let alone any mercy in it. Irene's face is dark; dangerous. Like, seriously. Karina knows better. Everyone does. You know exactly what she's doing. You know what comes next, but this time, you can't shake the feeling like-
Like Karina wants you to look.
She has her fingers on her cunt, spread, presenting - and a small shrug; her response is so fucking coy: "I guess I can't really help it. Besides, it’s common knowledge, isn’t it? The brattiest girls always turn out to be the best fucks. Honest, I get so wet sometimes, you know and then god, I can't think straight.” 
She laughs at the premise. 
“I dunno, what's a girl to do?"
You can feel the room starting to tighten up, just barely: Karina’s breath still heavy, her chest heaving, the way Irene holds her still, how her arm curls across her stomach, palm flat under her tits; that pose in particular, the power to entice.
And maybe it's the fact Irene is still making eyes at you from Karina's shoulder, the cruel bite to her upper-lip, showing how she's working at the soft skin of her neck - a smirk, before pressing into another kiss there. Your insides are running hot, a shudder racing up your spine. There’s no mistaking what she's getting off on, not just some pretty-as-paint newcomer. There’s your Irene, your fiancée - and her beautiful, adorable, awful little shadow.
-
So what if, by some pure hypothetical, this all spirals out of control?
You don't know the consequences of taking home what amounts to a coworker and screwing her with a certain reckless abandon. There’s power harassment, a toxic workplace environment, boundary issues, sexual-fraternization. So on, so forth. It's all relative, but watching Irene and Karina make their way up the stairs and admiring the things that only a woman's hips can do, swaying this way, and that - and, following the path from one tight little ass, the other, all the way up their spines - there are no such qualms to contend with, because there's absolutely zero chance that’s the thing that’ll be keeping you up all night.
Irene laments and hopes in the same breath. 
She has two pairs of panties in one hand, Karina’s fingers laced into the other, explaining with a quick squeeze, "don't tell me, baby, I already know," a wink, a laugh. She’s such a sweetheart when she means to be; charming, wooing, the coy girl Karina seems to have gotten so drunk off the idea of getting mixed up with. And yeah, when she drops them on the floor, and pushes Karina gently against the wall. Traces her finger up her jaw, then her cheek, and leans into the crook of her neck, into that same spot from earlier; yes, Karina can count herself lucky, or whatever.
"So, don't stop now, baby-" Karina's huffing - the line of her throat so taut and exposed. "You should really fucking try harder if you want me to beg."
"Honey," is how Irene responds, leisurely.
There will come a point in their intimacy, in all things considered, where this act no longer plays itself: Irene, the seductress, and Karina, a deft and innocent prey; of course you, the hammer to a nail, pushed and pulled in one direction, the next. The moments in which her lips leave the crescent of Karina's mouth - hot, hazy, and half-wet with their own spit, their tongues twisting, the muted click, and the telltale wet drag of a body pushing and straining up against her own-
Maybe in her bones, she is begging for it. Maybe, Irene hopes, she'll have to: eyes turned up, watering, tears coming hot, streaming down her flushed cheeks as she cries it from her lungs.
"I wouldn't have you beg for anything."
It's true that Irene is ninety-nine percent grace, one percent child-like wonder; she's easy to read when the mood hits her. The lines of their bodies tousling, twisting and tangling in moon-lit-darkness. There's some irony to it, only a few steps away from the bedroom. At the base of the staircase. In front of the tall windows covered with frost that serve, now, primarily to remind Karina that she's in a part of town she could never afford, in an ostentatious apartment she could only dream of; but most importantly, that the woman in front of her - with her fingers dipping down between her thighs and up again, tracing over her navel and the rise of her hip and her cleavage - can have anyone she likes, without limitation.
Karina can't deny it's everything she wants.
"Karina, I'm curious." You're easing into that spot, where the two of them have coiled themselves up - you’ve got your cock in your hand and you’re stepping out of your pants - in the hallway, the frame of the door, a heavy, long shadow cast: Karina has Irene pinned now, a wrist over her head, against the other side of the wall where the white paintwork is starting to run thin. "Didn't you say something before about how hard you wanted it? Raw, deep, I believe was how you put it."
Irene smirks. It's just the slightest sneer, until she has her hands reaching over the curves of Karina's hips and pulling her fingers into her soft ass. Spreading her cheeks. Touching up, then down, back in the same groove, this slow rhythm that builds - like they were both expecting this exact sequence of events.
You watch Irene whisper something into the girl's ear, and - fuck - the light catches her expression at just the right moment, head lolled to the side.
"Hey," Karina drawls. She lets it come out breathy - on the note, the middle and upper registers of her voice, hitting something near a perfect alto. "How about instead of having some heart-to-heart, and making me out to be some naive-ass kid, you stop asking questions and get to fucking the life out of my little pussy."
She ends it so charming.
“Oh,” you tell her, feeling how fucking drenched she is right at the end of your cock - sliding her slick up and down the length of her cunt, and knowing the feeling will likely stick to your skin and drip to the floor, all of it - "well. If that's all."
Your hand arrives on the lithe stretch of muscle between her waist, right along the ridge of her hip bone, your cock pressing onto the heat of her cunt. Karina turns her head over her shoulder so you can see it all in profile: that pout. That look. That everything.
"There you have it." Irene squeezes the flesh she's got cupped in her palms, drawing circles. "If only everyone else got to hear that sweet, sharp edge you've got underneath, hm?"
Karina opens her mouth with some clear quip to needle, but stops herself, a catch in the center of her throat, her brows shooting up. The pull of her voice is somewhere out and over.
“God, fuck-” she can just manage to sputter. “You’re- ah, ah - your fucking cock-”
Oh, it has you cursing too. You're pushing so far into her tight little cunt - the soft airy moan, that pretty sound, riding back on every last stroke until you've filled her right to the hilt.
“I know, I know - that feels so good, right?” Irene coos.
You just pull her all the way back onto your cock, thrusting deep. Base to tip. So goddamn fucking deep.
Karina probably doesn’t even mean to whimper, but the press of your hips, slowly snapping in and in, has her lungs constricted, as the pressure slides through every hot, slippery inch inside of her - this glide of agonizing intensity.
“I bet you want to just cream all over that cock,” Irene says, fine eyebrows knitting into something like contentment. “All filled up and feeling full, and just fucking letting it go - he’ll take such good care of you. He’ll fuck you so good you won’t ever get that warm, hazy, blissed-out feeling out of your veins ever, ever again, if he has his way-”
All while the head of your cock works over every fucking sensitive part of her, dragging out to thrust all the way into her soft cunt, the round of her ass bouncing back to meet each stroke. Again, and again, until you've worked through that wet stretch of muscle. And the motion isn't exactly elegant. Karina's mouth hangs wide open, catching short breaths that curl inwards when you reach the line of her waist.
“It’s so fucking good,” Karina’s sighing out. She’s all fluster, no bite.
There’s no lack for juxtaposition in the way Irene dotes on her either - these small beguiling bits of praise like, baby, you’re doing so good, these tits of yours are just, you are - just gorgeous. Mouth quirked into a tight grin as her fingers pull and twist around her nipple. The sharp yelp that comes after. The fact that she's kissing the words into her mouth on the very next whimper: “a girl like you needs the time, and patience, and opportunity to have her insides completely, totally, catastrophically ruined.”
Irene had it exactly right on the first read. She’ll say, “I told you so,” when Karina’s washing the cum off her chest or out of her eyelashes in the shower. It’s the praise; it’s the degradation; it’s you leaning down, your hands finding her hair, curling in, and getting her right up against your lips to say it quiet, low, intimate - like a lover, like she hasn't already heard it before, “such a good little slut for me.”
And the girl absolutely fucking keens.
You grip onto her hips. You pull her hair tight. Her throat bobs under your thumb and you can feel the anxiety start to throb, her pulse hot and heavy in her cunt. How it soaks the base of your cock. Jesus, you’ll fuck a load right into her. So easily. Her pussy is so snug, so unbelievably wet. Perfect enough to know if you fuck into her any faster, any harder - it’ll be just that: you'll paint right up to her cervix; you'll fill her to the fucking brim.
"Fuck, Karina, this pussy is such a fucking dream," is what you're making sure she knows, and at that, Karina just finds that bend. Arches more of herself to you, until her ass is slotted into the plane of your stomach, the head of your cock prodding, testing the limit where her cunt is hottest and wettest. "God, this has to feel incredible. Your ass bouncing on my cock" - Karina goes slack on the force, leaning forward - "as I rail your tight little cunt."
If anything, Irene is there to catch Karina's tearful, thankful gaze when she finally starts fucking crying, a litany of yes, fuck yes, yes-yes-right-there, please fuck, and a wet, dazed little "you're goddamn - you're ruining, fucking - fucking, ruining me," every other syllable broken by her shuddering breaths.
"Aw, you're going to cum again, huh? Baby-" Irene's got her head at an angle - their gazes locked, watching - and maybe Irene really gets it: how much of a big, bad crush this gorgeous fucking woman's had on the pair of you all this whole time, with all that faux-romance, and lust, and envy wrapped up inside her - but if she wasn't so obsessed with the shape of Irene's mouth, the contour of her jaw, the lean and sleek lines of her frame and the soft, round swell of her ass - she’d still be left with the shape of your cock, where it’s pounding her apart. Fucking her and fucking her up.
It's more than worth the breath to remind Karina what she came here for. Irene's fingertips brush the line of her lips, part them just so. 
“All over him, baby, let him make a mess of you. Just a total fucking mess. We'll fill you up, and fill you up, until your poor, aching pussy is full of cum," and it's probably as well: Karina does what comes most natural to her - with you three, the whole number. Her eyes flutter and go dreamy. There's not even a moment of hesitation:
"-until it's leaking down these fucking thighs-"
"You're doing so good, babe," is your supporting role in all this, murmuring encouragement straight into her ear as you fuck her to pieces. Your breath fans out against her cheek. And then, your hands make a grip under her thighs, holding her steady, making her mouth fall open - this keen, wobbly, vulnerable thing that exposes the naked girl she is, behind all the makeup, and the heels, and her seductive and all-consuming appeal, everything.
“Just so you know: it’s the best fucking part, Karina. I mean, the look on his face.” Irene laughs with her whole body, until the rich, raspy sound of it fills the hall. “The way he bites his lip when he's close, his eyes clenched - and god, I fucking love when he finally cums. It's so good, watching him. Letting him have his way. Feeling his cock throb and spill into you - hot, and still, and just pumping inside you - just so, so good.”
"Fuck, ah-" the little gasp is like she's starting to hyperventilate. 
"Because baby,” is the final nail in the coffin, hammering home, “he’s fucking you just like he’d fuck me.”
"Fucking, please, god-."
Irene's hands have her breasts in their grasp and are playing at where she’s sensitive, then pushing into the soft, delicate space beneath, thumbing the indents. "He's so fucking good, isn't he? Are you going to cream and cream all over his hard fucking cock?"
Then - and because it comes so instinctually to her. Because, actually, your Irene has a slight propensity for evil:
She slaps Karina, right across her tits. "Fucking cum on it."
One.
Tugs hard on a nipple. "I swear, every single bit of you is so goddamn beautiful-"
Two.
"That body is built, perfect. So easy to ruin. And god - what a perfect little pussy you've got-"
Three.
Karina struggles to breathe. Her voice is torn, frayed. She barely manages to utter out a very shaky, very desperate, "harder, fuck- you’re fucking making me so- you can, harder-"
Four.
The cruel contact of Irene’s palm pulls this deliciously hedonistic sound in Karina's throat, a loud moan; like she just hit the sweet spot inside that's all her nerves coming alight. Irene plants a quick peck in Karina's hair. Her temples, the ridge of her brows. Slides her thumb across her eyelashes, brushing them clean from whatever tears had sprung free. You don't even want to try, not at that moment, to try and endure the quiver of slippery muscle all over your cock as she shudders into her orgasm. It's simply too fucking much. She's too fucking tight.
"Aw, shh shh, shh," and then Irene's soft hushes are coming down from the other side of her head. Irene kisses her full, straight on her mouth. Karina is shaking, convulsing and caught and fucked from head to toe - and what she needed was someone like the two of you - to watch her cunt swallow your cock like some magnificent and unbelievable sight, taking the whole damn thing. Irene is telling her, "it's okay. You can let it go."
The silhouettes alone. From the end of the hall, and where the afterimage lingers: the smoke-frosted windows, the dim lights, their bare, beautiful forms - this picture that will stick in the center of your head, will probably haunt you-
"God, I can’t, just- ah.”
“Breathe,” Irene says.
"I'll cum again, it's too- I'm so-" Karina can only plead and sigh.
Irene shushes her one more time. "It's a lot. It's alright, baby. He's going to keep fucking you until he's ready to pull out, until he has a whole mess just painted onto your ass, and thighs, and I'm going to make sure that little pussy gets so wrecked, fucked, stretched on every last inch- until the thought of sex hurts, and then we're going to make you cum again, and again- over, and over-"
You're leaning over her, nose buried into the waves of Irene's hair, the curve of Karina's back, and the flush of skin in contrast. That's when you feel the coil in your chest come loose - unspooling, and bursting - when Karina's lids roll into the back of her head and her lips fall open with a pleasured gasp and a stammer, "y-you're, ah, both, you're so, both- oh god."
You're about to just pull her down and absolutely cream her, stuff her full - a mess.
And she wants you to-
"That feels so fucking good," she lets slip out on the cusp of a shiver, just as her inner muscles are spasming, milking your cock with the pressure from one pulse through the next, squeezing.
She’s right. It does. Her, coming undone. You, at wit’s end. 
Another breath, and Karina is managing out between these small hiccups - not as much out of breath, just dumbstruck - simply muttering, "I’m cumming, I- oh my god." 
You barely manage it; you unbury your cock from her cunt; you’re cumming all over her ass. 
A shot of white that streaks right down to her bare-slicked skin, before it gets painted down into the crease of her pussy, all swollen - wrecked and raw.
Just the way it feels on her skin is enough to earn another hushed moan from her, this sweet little whimper as she can hardly stand up straight. She lets her knees buckle, but Irene is right there, to catch. Her eyes are closed, eyelids clenching, as Irene tilts Karina's face her way, to lay one, two, three soft, adoring kisses on her mouth, the angle all wrong. 
“Mmm.” The smack of her lips. The pull of whatever breath she still has to give - right out of her heaving chest. "Sore, that, ahhh- um, thank you."
You fiancée wraps a slender hand right around Karina's wrist, and starts whispering to her, unbridled, "just had to. Had to see how you look-"
It’s wicked, for one thing. More than that, it's seamless:
While Irene still has the girl's voice caught in her throat, she reaches around the curve of Karina's hips and drags two fingertips through the puddle of warm cum that sits right at the base of her spine, glistening all over her ass cheeks and inner thighs, slipping and rolling off her cunt, down the center, running in rivulets. Your cum between her fingers is so filthy, so obscene - dripping hot - right off her reddened skin, and Irene can't possibly help it; not after a display as indulgent as that. The trembling that remains in Karina’s thighs does nothing to hide how her legs now jitter and shake under Irene's touch.
“That’s my good girl,” she whispers as her fingertips hover across the apex of her puffy lips. Over and over again, with more force, and more, until you're almost positive it's Karina that leans in a moment later, kissing the rest of her soft assurances right off her tongue.
Listen to her: this incoherent string of words pouring from her mouth, like they can't move fast enough, tripping over each consonant, "are you, oh, oh - oh, fuck."
No one else could make that kind of overstimulation feel so heavenly, you figure, the way she just properly melts. You take a step back, just to let Irene work. Just to watch. To appreciate the craft.
You absolutely get it. 
How to touch, how to tease. Firsthand experience has you know she'll ride your cock until you're throbbing and spilling cum and she'll just shh-shh, let you have it - it's okay, sweetie, just let go - until she's rolling her hips just right, or reaching a hand back to massage your balls, or stroking your inner thigh in that exact kind of spot; some method that keeps her all the way on the end of your cock, but not quite off the edge, and your cum leaking down your shaft, spent.
She’ll bite into her smirk. She’ll tie up her hair. She’ll get that serious look on her face because she knows: you’re all hers for the taking.
So she'll sink onto it, again and again, until she's fucking you with the slippery friction only your own spill might provide. "Just a little more," she'll tell you, which is absolutely a lie, "come on, just a bit harder, I'm so close." Irene does this thing - she's had years to refine and perfect - and her voice gets a husky edge to it as her teeth graze the shell of your ear; she makes a small, pained groan into the curl of your hair and breathily hums it: 'I'm almost there.'
Who stands any chance to resist?
And she's always asking you - the same way she's coaxing and promising Karina the world with just the movement of her fingers, this delectable in and out, in and out, pushing that filth up into the red-soaked lips of her pussy - "now, what did I ever do to deserve someone like you?"
Karina blinks, once - a sleepy-lidded draw that leaves her lashes, lush and long, and fanning her flushed cheeks. 
The sound between her legs is wet, squelching with your cum, with hers, the barest hint of slapping her tender skin. The beat of Irene's wrist against her thighs - like that's where she needs it most - a deep, primal rhythm, like the last thing she wants is to take a breath. It's fucking hot; her head is tilted, her jaw clenched, and Irene has the tips of her fingers twisted between Karina's legs, swirling your cum right back around in her slick cunt - those plump pussy lips that you've watched stretch out on the first press, the first and the second and the third, as Karina finds what gets her there fast, fast-fast-fastest-
"You can cum for me too, baby."
It’s not a suggestion. There’s nothing but expectation in Irene’s voice. 
“Just cum.”
You watch it knock the architecture right out of Karina's legs.
-
Indulgent, just isn’t quite the right word for it. Careless, reckless, clumsy even-
Look - the tumultuous tangle you three make is all over the fucking place.
One moment, you're at an angle, moreover twisted-limbed with Irene bent over her dresser, then propped up on top of yours the next, your forehead landing against hers, feeling the soft cradle of her shoulders, her legs around you. She has her hands wrapped in Karina's, in that muddled in between: it's a collision of sorts.
There's the chair in the corner of your bedroom that really has only ever known one purpose, a plush rug, all these surfaces, horizontal and vertical for you to take the two most breathtakingly beautiful people in the world on and let your bodies settle into the shape they've needed to ever since your fingertips met Irene's in the cab, ever since she blinked her heavy lashes at you with Karina in-tow, just shy of smiling.
And boy, do you learn that Karina likes to watch herself get fucked in front a mirror. Specifically, the tall one beside Irene’s closet. It's hard to blame her. When you hold her hips tight, and really, truly fuck her, you can’t keep your eyes off how her face twists with the pleasure; or, when you drill the length of your cock into her sopping wet cunt: the wide, glossy rim of her pretty lips pulling back into a wince - and your eyes dropping past the reflection of her shoulders, her collarbones, down to her perfect tits.
The back and forth, the up and down, the way they fucking wobble in their beautifully buxom blur.
Though the eventuality remains unchanged, spread out across your bed. Karina takes a moment, hand pressed to the mattress experimentally like it's all running through her head - this is where Irene gets all that fairy-tale-inspired romance from, really - a quick pause where your future-bride is up on her elbows and staring, watching - your finger sinks in slowly, between where she's soft and warm and wet. She's thinking, you can just read it off her face, 'oh. So that's what you'd do, huh?'
Just for demonstration’s sake, you fingerfuck her in all kinds of ways - show-off and performance and dirty and mind-blowing. Because even better than the whiny, gut-wrenching moan it gets out of Irene, Karina can't get enough of how it’s all presented.
"Ugh," she slides up next to you at the foot of the bed, helping you turn Irene on her side, "why does she have to be so pretty, it's annoying, she's- she's like, made it so fucking far by playing the girl everyone wants to wife, huh?" She's talking directly to you, even while Irene rolls her neck to press her head against the pillow. "Inspirational."
You're drawing circles into her clit. Thumbing the dip, circling in the opposite direction. Karina has her nails biting right into the crease where your knees touch. In tandem, you’ll help your fiancée reach the top of that first wave. 
Karina presses, all cheek - a very dry, "cute."
It’s so simple: you eat Irene’s cunt. You hold her down. And Karina slides her tongue lazily against the tight pucker of her ass.
The three of you know she deserves nothing less.
“Oh, christ, you have no idea,” Irene is murmuring into the pillowcase, head tilted at an awkward angle, looking at the wall, almost distant; but her legs are split wide and her hands are reaching forward to rub a circle into your cheek, "you know how sensitive-? Yeah. Like, really, super. Super, super fucking sensitive, okay? So - if you'd keep doing, uh, oh- oh…”
Simultaneous, then slow, and easy - kisses landing right onto Irene's clit. So much so, you can't help but turn a little, smiling right up at your girl as she digs her toes into the duvet and threads a hand into Karina's hair.
The thing is, with Irene: facades fade fast.
Karina gets to measure that fact up close - where the details of Irene's composure are not only sharp, but also readily and openly and emphatically pound to dust by the time the last loose curl of Irene’s hair falls over her collarbone; she ends up on all fours, spread out over Karina - pressed along the length of her stomach, spread over your duvet and fitted sheets, your hand at the base of Irene's waist and tightening into the divots. She’s so small beneath you that when you bury your dick inside her- 
“Fuck.” Her cunt is so wet. Her breath uneven - and her words are starting to slur. There’s the gooseflesh on her back that lets you know it’s all already over for her. “Okay,” she tries to steady the ache in her stomach, “okay, okay, just- right there.” 
The drag through her pussy is fucking extraordinary. It knocks the wind out of both of you; so soft to the touch, like velvet - she’s unbelievably tight. You pull her hips into you and it opens her right up. Then when you end up balls deep inside your girl a second, third, fourth time:
She simply shudders apart.
Even though you fuck her so slow, so easy - her cunt clenches and squeezes on you like Irene detests the very idea of letting you go. You don’t even need to rail her lithe body to complete and utter ruin just to feel the familiar pent-up tremor starting to build in her muscles, how she rolls her hips back just so-so. How your hands fit that round and pert little ass of hers so well, and when your fingers finally sink in, you’re pulling it all apart to get a good look where your cock shimmers with her slick before disappearing right into her tiny cunt.
Karina mutters something in her ear. It pulls on some thread, somewhere - you feel her wind like a spring, further, and further; your cock edging her so close. The smirk Karina saves for you over your fiancée’s shoulder makes you think she’s figured her out- 
“Irene, look-” 
Well, at least she’s tuning in on all the right frequencies.
"Aren’t we all about being thorough?" Karina raises a perfectly trimmed brow. She drapes her arm across Irene's neck, their lips sliding together again, and that kiss is drawn-out and languid, albeit needy. "So, say," it gets muffled against the seam of their lips, and comes up, and comes out like a slurry, "are we gonna use everything else too? Your mouth, your perfectly tight ass?"
Irene can hardly muster out, "fuck- fuck- yes, fucking, god," as she takes it, so deep. There’s enough there to make both of you cum, you’re sure.
“Who could’ve guessed - like there’s ever been a more perfect cocktease than bae-fucking-Irene," Karina coos, all lips. She plants a row of kisses along Irene's exposed throat. The tilt of her hips, as she pushes closer - as you press the head of your cock as deep as it can go. "Go on. Cum, baby. Be a good girl, a good hole to fuck, just do it. All over his big fucking cock. Let him fucking have you."
Which is probably about the same time you realize that you, Irene and Karina are all well enroute - becoming this one mind, a single unit. This plurality you know there’s no coming back from.
You look down, with a little more focus, and Irene is being pulled apart in every which way - your cock stretching her out, over and over - Karina’s fingers right under her clit, every circle making her whimper. She’s all sharp edges and delicate angles, but manages to be soft for you in just the right places.
“God, you’re so fucking tight,” you tell her, shifting your hips; pulling her ass flush and filling her completely. Your grip tightens on her waist and she doesn’t flinch a bit. "It's so goddamn easy to cum in this needy little pussy of yours. All wet and slick, and, hah- just pulsing-"
Irene lets out this wanton sound, desperate.
“Oh, right there, huh?” Karina asks. It’s not quite mean, but it’s getting there, fast. “Is that how he’s going to make you cum?”
You thrust on the same angle again, the same depth - you’re hitting all her nerve endings, all her sensitive spots. There isn't even room, now, for some imaginary head-to-head, some verbal volley, the banter; what comes forward is her tiny, broken moan.
How many times had Irene done the exact same, after all. Fucked you without holding back? Fucked you over? The flood of sweet-nothings as you started to approach: honey, you're so perfect, we can go slow, you just have to ask, and if you feel uncomfortable at any point, if you want me to stop-
“Just say please, doll,” Karina tells her.
If Irene told you a quarter of what made it out of the side of Karina’s mouth, you’d have never believed it. "I can't wait to feel what that arrogant mouth of yours will do when he cums inside this cute ass-"
You watch Karina spank her. Hard. There’s a red stain in the round of Irene’s cheek, and her skin is so pale that the imprint of all five fingertips looks stark, glaring.
"Just," Karina presses the rest of herself against Irene's skin and steals a quick glance at you - this half-coy smile pulling on one corner of her lips, "thought I'd do that in the name of-"
"Mmph," Irene’s groan is long, loud, "yes. Fuck, yes- please-"
Karina immediately looks away. An effort to hide the smug satisfaction. She fiddles with the auburn locks behind Irene's shoulder.
You’ll finish the sentiment: "-being thorough," and drive your cock to the hilt. Irene collapses forward onto Karina’s lap.
The sound she makes you swear is a sob. See - for Irene, it’s only about getting control in so far as it is about getting off; she’ll take whatever comes her way so long as it’s directly to her benefit - the theatrics of being pinned, the willingness for surrender, for subjugation, for the sake of telling you, yes, push my knees, spread me apart, hold me there; look at the things you do to me - it's the Irene everyone imagines, when they see the dresses, the gltiz, the glamour, just the brief flash of her grin, or the way she holds her fingernail between her teeth. Everyone wants to put her on her heel and feel a bit powerful. To have you watch the supple arc of her neckline bend, to hear the humility slip off her lips: the notion goes beyond simple kink-
It steps out into pure necessity.
She really, really needs it, and it's written into every muscle and tendon - it's on her breath as it shudders through her whole body. The beautiful, harrowing sound. "I love the way you two fuck me," she murmurs, head buried into the crook of Karina's neck. It's the sort of line, coming from someone like her, you know could raise a few blushes - if either of you was still in the business of such things.
"Honey," her voice wavers. Then, it falters: "please."
The desperation is thick, husky, almost. Karina seems like she's breathing her in, nose tucked against Irene's forehead.
You watch how she runs her nails up Irene's sides, a hot whisper sliding over her skin. You feel it, and so does Irene, this white hot pleasure singing up from the tip of her clit and spreading throughout the soft curves, the sensual lines of her body, this tangible current, a hum, a whine. You see her strain the lean stretch of muscle connecting her neck to her shoulder.
Until her face is tucked under Karina’s jaw, with a hand reaching back and hooked around your wrist and keeping you fucking, filling her, your hips drawn tight against hers, like a second home.
In and in and in.
Fucked-out and outright to the extent she goes completely silent. Almost completely still. The moment she cums all over your waist. Mouth hung open, like she’s in pure disbelief.
It doesn’t really matter, how often or how precisely Karina has imagined the whole thing. It's still a fucking revelation the first time she gets to watch Irene cum.
“No way,” she’s almost laughing, holding Irene’s jaw with both hands. “No fucking way. All the times you- what? No. Nuh-uh. You better fucking explain why this face, you- it’s not fair, the perfect face- I swear, even mid-fucking-orgasm, you are such a fucking doll-"
There's the sheer intimacy - Karina holding Irene's lips open, dragging her thumb down along the center. Quiet and sordid curses slipping from her mouth. And the obvious, her free hand already running down the curve of Irene's spine, her ass: all this sensitive-touching, admiring, appreciating-
"Hey," Karina says, voice raspy and drunk on the sex, the premise, "do me a favor, and tell me this feels as amazing as it looks. Or maybe, for once - just for the sake of fucking argument, is it actually better for the both of us, hm?
Her eyes are half-lidded, heavy, sultry. She's arching up into Irene's warmth - until her palms are spread out against her chest, thumb sliding right over everything sensitive, and she leans right to pull the other breast to her lips, and start all over again. It's clear what she means, spreading her legs as far as she can, pinned beneath the orgasm you're still fucking into Irene. As much as her petite frame will allow.
And in case you missed the point:
"So. What are we waiting for," is what she says a breath later, matter-of-fact, not at all expecting denial. “Or am I not as fuckable as our princess here?"
There's so much wet spill around the base of your cock, and the sound Irene's pussy makes when you finally draw free - all her creamy slick mixed into your mess just fucking leaking around your shaft. Karina holds herself open for you like that, spread wide. All your attention to her pink, raw cunt; you slip right inside. 
Karina lets her arms go slack on the mattress, her chest shivering, lips locked around Irene’s panting breath.
And so it goes, and so it goes, and so it goes.
-
(To anyone taking notes - chemistry, by definition, is the sum total of a certain process; where and when energy becomes matter becomes another.
More relevantly perhaps, it is that race and rise you feel inside your chest. 
Nothing about the sensation, it seems, is too exclusive either - Irene, and now Karina, the pair of them equally devastating, all over and again. It has you in communication with a different kind of contentment: to fall apart inside their embrace in particular, and kiss them with enough breath and time to waste until the morning.)
-
“Jesus,” Karina laughs out loud, “you really believe that? You corrupting me?" she makes another scoff, both hands buried somewhere in the pockets of the sweatshirt you've lent her. "At least do me a favor and cut it out with the solemn tone."
You're leaning over your apartment’s balcony, watching an emergency plow make the slowest grind of progress up the road. It's late. And cold. Or actually - it’s early. The sky is the kind of dark midnight navy you see after all the snow and stars have run through the horizon. Time ticks on, and Irene’s inside sound asleep. A woman that small has no right to snore like heavy machinery.
So,
You and Karina happen to be two things at once: very tired, and very awake.
"What I mean is: I'm sure your manager, or your parents - fuck, someone - would fly off the handle," you say, pulling a cigarette from the pack and offer it begrudgingly. She takes the end and slips it between her lips, a little unsure. You then draw a lighter and offer it, too, and Karina puffs with all her strength. She's no expert, but it looks like the end catches and turns bright. 
A bit of color.
"My parents?" Karina flouts, sucking at it, pulling deeply from her chest - smoke pours from her nose.
She finishes with a cough. And says again:
"Um. Your girlfriend had her fingers in my ass - your cock down my throat - and we're worrying what my parents might think?"
Well. She's got you on that count.
"Not to mention: who the fuck thinks they're so virtuous-" a small chuckle as she passes it back. The cigarette is lit, bright. You take a drag. Watch her tap her feet on the snow. "That they need to do that to begin with. It's more trouble, telling me what to think and feel, as if that hasn't just the opposite effect."
“Irene’s protective, albeit in her own sorta peculiar way. So, you know, by extension, she worries-" you pull, and exhale, the smoke blowing past Karina. It gets caught in her fringe, in the wisps. You offer it back when you see her shiver. "That some shit happens, after."
"Your concern is heartwarming, truly - if you want to let me think on it, I might go and write a nice little diary entry tonight. It'll have sparkles and glitter - if you're that worried." 
Karina reaches in. Lets her fingers graze yours. Her skin is cool. 
“Besides, I don’t need a lesson in image from Irene of all people. She’s her; I’m me.”
She holds onto the cigarette between two long acrylic fingernails, tapping the end so the ash flits out onto the ice. You're caught staring, probably - the dark hair framing her face, all messy and soft, falling about her cheekbones. How that pretty pink blush in her skin seems to never go away.
Your eyes drop to where her mouth is red, a bit swollen - well-kissed; it is snowing again, after all. And it’s easy to be kind of transfixed.
"You're not, I dunno, say embarrassed?" you ask, after a beat.
"Nope." Karina swallows. Brings the cigarette to the pucker of her lips again. You watch how she holds the inhale, holds her wrist up and slacked, head tilted back a little. This exaggerated fashion-model exhale follows, all smooth.
“Because I'm not the type.”
The heavy stream of smoke then blown right into your face.
"Really, I think - sorry, I have always wanted to do that. It felt like a movie. Look," she coughs on the next breath. "I get your dilemma. But also, um-"
There are some quiet moments too, here and there: the heat between your thighs, her pressed up close. She smells like Irene's shampoo and bodywash and that just confuses your head some.
"Who’s to say I’m not just looking out for you," you offer. Every good lie is rooted somewhere in the truth.
"Don't bother," her words hit you square on. "It's about getting off right? You invite me to your bed; I’m so starstruck and enchanted by the very concept of it - Irene and her charming, intoxicating husband. Fuck, I dunno - the way the two of you kiss, look, feel: the experience that you will let me be a part of," she stops and makes another face of amusement, so fucking confident, "you let me play, too, just once, and we're all just a little happier. My version."
“We’re not married,” you correct.
“That’s the part you’re hung up on?” Karina leans over, her upper half across the balcony, staring right up at the sky. “Same difference.”
The moon finds her smile bright like nothing else. It's something infectious. Immediately, it reminds you: of Irene.
"Trust me," she goes on to say. The cigarette slips back into the space where you are connected - the lines of her fingers, her knuckles. "I had a wonderful time, but the sun will rise here, and I'm not gonna stick around to blow you while Irene burns three omelets and finds a spot for me in her fucked up game of house or whatever."
She makes you laugh, free and easy, like a gust of cold air. Something genuine and natural. And as the laugh shakes, Karina makes it impossible not to crumble farther. Not to fucking simper there like an idiot.
“I really thought she was going to make me call her mommy or something, I swear-”
"Hey, I'm sure if you had asked." A spark catches you. The flash of her canine, and those eyelashes. “She’d have done you the favor.”
"Oh, shush." The touch of Karina's fingertip against your hand is delicate, careful - unassuming. But, god, everything with her is just the right amount of heat - it melts you; and when it stops, her touch: that feeling is so cold that you just chase her out of impulse.
"What about New Year's?" you ask. There are still boundaries you really shouldn't be crossing, but here you are, straddling yet one more.
Karina's grin cracks like an old fault line. "You're not allowed to ask me out like that," she insists, batting you away - trying her hardest not to lead with the obvious. You look out on the view, watching a guy in a parka trudge over to a garbage can, a handful of newspaper bundles, then a glance back-
The slightest flush has bloomed up Karina’s face, right underneath where the makeup's been rubbed bare. It's utterly irresistible. "Go wake up your fiancée and ask what her New Year's Eve looks like. Doubt it involves me and my dumb friends."
She’s probably right.
"Karina," you start, watching her push open the balcony door with her foot and walk slowly, lazily, back into the apartment. The window rattles, and she looks back over her shoulder. The bob of her ponytail, the sweeping lashes, that perfect slow-burn smile. That’s how you end up with a title as ridiculous and reductive as ‘original visual’ or ‘the human cg’.
"You’re really going to let them in on what we all got up to?"
"Oh," she makes this low, delighted hum - it sounds so dreamy, how her voice gets the richest sort of rasp, "every last detail."
-
On Monday: the holidays are officially over.
There's a bunch of stuff on the to-do pile. A lot of loose ends you have to clean up, a ton to catch up on. Irene is judiciously ignoring all of it. She's wearing her glasses - the ones with the big round frames that should look entirely obnoxious - which means she's already decided she's not leaving the apartment; Karina's still wrapping the world at large around her finger and has everyone convinced that she's all femme, no fatale; and you - well, you're back to thinking about how to climb the ladder and maybe how to stay there.
You head downtown with a cup of coffee in one hand and a musing mood in the other.
On your phone, some more choice text messages arrive in the late AM: had a great time by the way, stay out of trouble, this sweatshirt is actually just mine now, duh. 
The selfie alongside it is pretty suggestive, but just vague enough to flirt with indecency.
She sends one more at lunch where she's gotten out of the shower, or a hot pool, or maybe a long workout - her breasts squeezed between a towel and an arm - she has the camera all zoomed in and framed tight, almost full body. If her intention is to mess with you, that's what she gets. The texts: ah, fuck off and did you have a nice date with your left hand then, thanks for reminding me, the hotel wifi is shit lmao.
The messages just keep on coming and there's really no better descriptor.
And Irene, later, in a way that's neither diplomatic nor nuanced: jesus, don't let her catch you by yourself. For simplicity’s sake. She interprets being alone with a handsome boy as carte blanche to do absolutely whatever she wants and she's vapid that way.
There’s a chance it fizzles out into nothing. An even greater chance it all goes sideways. You'll have to see what becomes of you three.
-
Okay, right - new year, new you. The resolution for the past couple remains unchanged, and unfulfilled - less takeaways and eating out; more meal prep, less calories, healthier decisions.
Irene has this cute little apron over her sweater that is fixed extra tight, the belt trailing down the tops of her jeans to accentuate her nice round hips and slim waist. She knows the nature of her charm, her sex appeal. How it occurs, almost, as if by accident.
You say something that will get right under her skin like, “looking real domestic, Joohyun,” as she slides a chopped onion from a cutting board to a bowl.
She presses her hips out just a smidge, just enough. Turns a bit as she opens up the fridge, and the smirk she has for you, that sidelong glance-
“Don’t you Joohyun me,” is her lightest rebuke. 
She twists her way onto her tiptoes to fetch at the highest shelf. The crochet corner of her sweater rides up a couple of inches, flashing a hint of the fair, bare curve of her lower back. "You can help me by grating the parmesan, hm? Into that," she gestures back at the table, pointing with the bottle of olive oil.
And so you're ten, fifteen minutes into helping with dishes, with the grunt work - with the realization that Irene is going to chop her fucking fingers off if you leave her to it unchecked.
"Actually, here," you say, "can I?"
She tilts her head, skeptical - still, a quick nod of permission - and her slender fingers surrender the knife and wooden chopping board to you. She's tapping away at her phone, finding the playlist you're both always secretly listening to.
"Wow," Irene says, low, as you start dicing mushrooms, a stalk of celery. "So brave. There’s no way I could do that. Is it safe? Are we, like, in nuptial bliss now, do you think? I fancy you, I fancy you-"
It's always this sorta-delicate dance with her: how much should you step up; how much should you put out of hand; how much she accepts versus how she pushes you aside and gets through you all the same. You're too proud, really - both of you - but fuck. She's adorable; the apron adds insult to injury; and it makes the switch in your head simple.
“I always forget how much I love this song,” she’s saying; the rolling pin she’s grabbed is a reasonable surrogate for a mic. When she’s through singing a verse, she shoves it in your face. You don’t know any of the lyrics. 
She doesn’t really care.
You have to laugh at everyone who's ever wasted the effort to theorycraft who she is behind the smoky lashes, the lowered chin, the downturned glance. All the characters and archetypes she'll wear and cast off as she needs.
"Here." She sidles up and tucks her hair behind her ear, the side of her hip grinding into your thigh until she’s pressed firm into the line of your leg. Because she needs to tell you that's way too much garlic, and she's not going to kiss you if your breath is trying to kill her first. She uses the word "pungent" a number of times, just for good measure. Go on - she’s murmuring - taste; right off her finger. If anyone caught this you’d be embarrassed for weeks
“I think, definitely, should open a bottle of wine-”
That’s how you earn all the responsibility for getting the both of you fed; she gets distracted looking through the recipe book.
But there's the way she looks up at you from the opposite of the kitchen island, face held up between her hands, fingers folded underneath her chin. "What?" she asks. 
She’s totally caught you staring.
The truth is: Irene only looks this gorgeous when it's just her. When she forgets that she's supposed to stick to a script.
You tell her as much when you end up fucking her right there on the counter.
It's so slow, atleast at the onset. Her panties pushed aside, jeans spilling off an ankle - the fucking apron managed to make it to the floor but her sweater got kinda stuck on the way up. So you're reaching through some overpriced fabric blend to pull down the wire of her bra and get your palm where she most prefers it.
"Say it again," Irene sighs into your neck, clutching to the back of your shirt - white-knuckled at the seam. "Come on, you can be so charming when you want something."
"I wouldn’t push your luck," is all you choose to tell her. 
You're hitting all the spots she wants you to hit anyway: her pretty pink cunt, slick, all wet for you already. Everything clenching as she arches her back, until she's hanging off the edge of the marble. You find it’s just enough leverage to fill her completely with your cock - stretching her out and open until her thighs bracket around your waist at the perfect angle.
"Or what?" Irene is out of breath, but hardly at a loss for words. "I know. You'll have to remind me how much smaller I am than you, right? So easy to keep pinned."
Well, if you really wanted: "Hah, ah - right." You get right next to her ear, muttering the words as deep as your chest can go - then take hold of her waist to put her in a spot she can't escape. And, by Irene's usual logic, once that happens, that's as much a victory for her as it is for you. You're being compliant, aren't you? The in and out: fucking her, filling her up, pulling your messy cock out of her pussy and slapping her clit just so she can hear how fucking soaked you make her, merely as a reminder-
"I wonder if she was even half as desperate," she moans against your jaw. "Her heart probably stopped the second you, ah - told her, what? About all of this?"
You stop fucking her, halfway.
"I’m sure you wouldn't be referring to Karina, right?" is where you glance at her. “I remember us both agreeing to chalk that up as a total absolute mistake. That was that.”
Irene just swallows, looks off somewhere over your shoulder. No one wears a blush better than her.
But she won't say it. Her honesty is such a privilege. The prodigy-type. Or at least, that's the word Irene chose. Then again, there’s you and your uncanny ability to turn a blind eye. 
To the vice, the virtue, and everything in-between.
"So, can I ask," you press your lips together, finding the point of her chin with a gentle tap - you have her looking you straight back at you. The moment could let you drive back inside and fuck her brains right out, right there, like that - right through, instead: you watch her try not to squirm. 
The tension in her upper chest, the rising heat that settles between her thighs, her weight struggling where you spread her knees, as far open as her body can allow. “How long exactly," you choose your words, careful and pointed, "are we going to pretend that she isn't texting both of us?"
You bury the question deep where she’s practically molten - hot and wet and so incredibly needy.
You do, again, and again. You pull her against you, watching that pretty brow scrunch and un-scrunch as your cock bathes in that soak. And hell, Karina had sent her a selfie today, is what she's explaining when you slow down enough - a bit of red, on her cheeks and her lips, and a lot of black, all the rest - the part about a midnight flight that's on hold until tomorrow morning. And then another, an hour later. To you both: her tits, the lace lingerie - so heavy, and soft, and easy to see yourself getting lost in-
Irene gasps at how fast you find all her favorite spots, then repeats - twice and again - hey, Karina said you're "such a cutie," and she sees her as the perfect mistress-material, don't you think? Wouldn’t it be ideal? The perfect fantasy? The perfect toy-
Obviously, that is morally bankrupt, even for the two of you. And you’re making sure she hears about it.
You ask her, point-blank: "are you really so selfish? So callous." It's ground out, slowly, against her hip, into her cunt. You've got Irene dripping wet, she's running everywhere, and you're telling her, "and this is your roundabout way of asking me to validate your twisted little ego?"
Don’t get it too confused: Irene lives for this shit; that sharp, hard-hitting tone - it drives her up the fucking wall. 
"Duh. Tell me - just a guess," she presses her hands further back, arching into each push. The slim curves of her chest are bouncing, just under her sweater. "You like to feel so guilty and morose but I bet-" she chokes off mid-sentence, you know exactly how, the exact motion that has her wanting. She gets a leg over your shoulder with no effort at all, and your fingers find their place, digging into her hips as she locks into your thrusts. 
Like fucking her is the only thing the two of you ever do.
Your whole body buzzes, it hums in resonance with where her gasps conflagrate to moans - you're pulling her slender frame down into every sloppy thrust and she takes you so fucking well.
"I bet it all sounds like, ah, the prettiest fucking music - in your head-"
“Fucking god, Irene-”
“Mhmm?” she fucking coos.
Because the things she wants to hear never actually leave your lips - your girl, fucking relentless.
Because the line between you fucking her and her fucking you becomes less distinct every time she rocks back and takes you deeper. Or when her mouth catches your next kiss a bit lazily. She takes over to swivel and slide her cunt up and around your length. So good that you have to keep her there. Hand locked onto her throat, digging a bruise or two in her collarbones, fucking her senseless against the countertop-
"Irene, fuck.” Your voice comes out thick, like gravel, and practically as an aside, “you’re going to make me-.”
Irene cuts you off, nodding, shh-shh’ing you into silence. “I know, baby. I know.” This total sigh of agreement - a hushed yes, or maybe uttering something she knows will sink right into your core, two words that sound a lot like “good boy.”
What, is that tacit approval? Probably. It’s hard to think straight.
So you bury yourself inside her, instinctually. Irene tips her chin up when she feels you paint her fucking womb. Every throb - with a fistful of her ass and your face pressed against her chest, sucking and biting and marking her anywhere, everywhere - right through her sweater. Fucking her so full that your mess is dribbling out all over the fucking floor, drip, drip, drip, and-
"Hey, I want you to know that I" - she sounds so amused as she cards through your hair, pressing a kiss to your forehead - "really couldn’t ever ask anyone except you."
(All is fair in love and war, is an adage Irene takes to its logical extreme, tangled in your sheets or with a dress puddled at her ankles. A silk stocking rolling down her leg, the crochet thrown into some dark corner.
You never say yes. You never really have to.)
This all before setting her down, off the edge, back onto her feet and taking another half-step forward and having the awareness not to completely flatten her under the full weight of your body, so she can run a hand down between the two of you and her fingertips can start gathering up all the cum you've pumped inside her. Irene tells you in her sweetest lilt to pay attention as she leans back up against the counter and gathers as much into her mouth as it will allow-
The sight alone.
When her head tips back, tongue passing over her knuckles, and she swallows-
"You are so," you sigh into her temple. Her cheek. You've settled the rest to the space in between. “Absolutely unbelievable."
She reaches out and trails the tips of her fingers lightly along the rise of your cock - her softness up against your hard lines. Her eyes flash when you twitch on the fucking spot. It's so tender all coming from her.
And there, a moment or two more. You can see it in the way she has her lips tilting, dreamy. You've always known what you were signing up for - how she's thumbing the nape of your neck - what her ideal outcome was, is. There's nothing and no one in front of either of you to bar the way.
You’ll make your vows like any other.
"Well, hey," she finally says, slow and husky and curling toward you with a smug self-satisfaction.
You push her hair behind her ears, the dark brown locks. Some part of you understands, unequivocally, that she is the absolute limit of how far you would go for any other person on the planet. No questions. In a heartbeat, without hesitation.
The kiss to the corner of your jaw is unironically chaste - before she’s telling you, "shouldn’t we get a move on it, chef? There’s food to eat, recipes to ignore; aren’t you fucking famished?"
-
The bolognese reduces down to a scorch in the cast iron. Too much heat, or too long, you got too preoccupied, who knows - there's a moral lesson to ignore here if you're so inclined. So it ends up being over a tray of sushi delivery that Irene explains to you her working theory like it's high-stakes political intrigue.
"Listen," she's got her chopsticks pointed at you, "for one, Karina, to her core, is a total seductress; and she's told me already, more or less to my face - she gets off on the chase, and hates the other shit. To be involved, or invested."
“Okay then why all the go-around; the wait-and-see; what’s her endgame?”
“What’s anyone’s endgame?” Irene shrugs. “Validation." She slips a tuna roll into her mouth.
"I think you might be projecting."
"Or, I'm simply an extremely empathetic person," her sarcasm hits harder through chewing - she almost gets you, and finishes swallowing to say, "look, she's like us if we were pretending to care, okay? Just more, like - explicit about her lack of intention. So. Doesn’t matter if it's to piss her manager off. Or it's like a revenge-slash-extortion-thing against someone she either had or is having an affair with."
"An affair," you repeat, skeptical.
"It's not like it’s an unheard-of workplace hazard, come on," and then the final confirmation: "she’s just into it because it sounds dirty and sexy, okay, like everything else-"
"And you figure we should be the ones to dole it out."
"What I figure," Irene says, doing that same mental calculus she did the first time: how, where, why - it's clear. A dozen different kinds of naked are an old, tired song by now. "I want us to fuck her. However she likes, whenever she likes, for however long she likes. Let her think she’s won something, or think she has you totally fucking hooked - I don't really care. Because it would be so much more satisfying to hear you tell me about it - because the idea of you two being like that for me. It's," her words pitch up a touch. 
"That's the fantasy."
And Irene dives into the details. She explains what it could look like, all the more raunchy and ridiculous. This very specific arrangement. It makes no real sense, the conversation alone, and that, you decide - what can't be rationalized - is how she'll take it: by fucking both of you. That's the objective fact. That's the demand.
You listen until it feels less and less like the decisions have already been made.
“Okay, babe,” she’s presenting her case. “Hear me out.”
And she keeps going until you both can see it materialize: "if Karina thinks she can handle both of us, then both of us it'll be." It’s how her fingers end up buried in your boxers and around the throb of your cock. You hear the gentlest laugh Irene has as you start fucking softly into her grip, and she runs her thumb over your weeping slit until she finds you that much more malleable to the suggestion. Effortless almost, she lures the primal part of you from its confines and teases and prods at its wants and desires. Which is also how some charged vocabulary gets thrown in for good measure. Because no, no, no - she's murmuring into your mouth, tipped back, plush lips right above yours - it's not a cuckquean situation, or an open relationship, or anything like freeuse or whatever else might justify the concern. It's not even cheating, Irene��s explaining, strictly speaking, because who said you and I wouldn’t be doing it together?
(Lying by omission is the story you both live - and the difference: she's pathological. You’re just now getting the hang of it.)
"Fuck," is what you exhale out as she opens her fingers, offering. Her thumb glides across the expanse of your head, a trail of pre-cum drawn underneath a nail. And you know all the things her nails can do - can rip your heartstrings. "I mean. God damn. There has to be, like, terms."
There's still sushi sitting on the coffee table, and Irene is placing these kisses into the slope of your shoulder, your sternum, making a show of the movement, how she's traveling down, downward - to her knees. Where she finds the seat between your thighs and tugs your shorts, the fabric gathered down your leg-
"Let me handle it," she tells you, and there goes the cut of your t-shirt, shoved up to your chest. Her grip runs flat, down from the rise of your hip, fingers wrapping around, touching - the flat of her tongue laving across the tip of your cock until she decides to lower her jaw.
"Just think right now. How I want to fuck her and how I'd want you to fuck her, too-" 
Right in her warm, wet little mouth.
Jesus, her tongue too-
She has it gliding up, around and against the swell of the underside. Rolling to where you need it, the places she knows you’ve died before. Lapping up the mess she's already gotten out of you-
Like this, Irene's looking at the way that the idea strikes: you and you and you; the only person in the whole goddamn world that can handle her; you fucking know it too - it's the most perfect, hopeless kind of thing. Like the feeling that catches at the apex of your lungs. It burns in your stomach and grips in your gut. She's gone and cut out the nerves - there's the crown of your cock caught in a velvet grip between those pretty pink lips and her fingers twisting at the bottom. 
She breathes deep. Sinks her lips so slowly to the base. Anything, everything you want: to put your hands to the side of her head, to weave your fingers through her hair, and coax her, fuck her mouth like it belongs to you, all slow and hard and measured.
To hear all those wet sounds she makes as she chokes on the end of it. The gags as you force your cock into the back of her throat, holding her head tight, her hair pulled up into a fist, to have that mouth hanging around the length of you, tongue stuck to the bottom of her chin as you move her, your fiancée, your toy. To be looking her in the eye and watching her look the fuck back while she revels in every filthy second of it, not a single damn drop of hesitation or doubt.
"Really think," Irene urges, and she's all innocent when she tips her head to kiss her way up your cock.
She’s trying for some grace or finesse, or both - trying, you think, to make a point; instead, you end up watching her gulp and spit into her palm, just to obscure the sensual curl of her tongue with the sloppy-hard rhythmic stroke of her fist. "How hot it would be if you watched us both choke on your cum. Her face fucked stupid - the perfect little fuckdoll, is that not an image for the ages-"
You get a glimmer of that catlike grin - the one you would kill for a picture of. Something for the wallpaper, or the wallet; you've never met a boundary she hasn't challenged. The most depraved ideas in her head are just, as she is, a masterpiece. And so the answer has never changed - there has never been anything she's not been allowed-
"Trust me baby," she presses her cheek against your shaft. You feel her turn and run that mouth all over. The tip of her nose. Her eyelashes. The wet heat of her breath as she nuzzles the length. "Karina's all ours to share."
Her pout, right there, waiting.
You can't stop yourself from grabbing her face, the crook of her jaw, her neck and the tips of her shoulders. Until it all comes with a good, hard pull. The sound of her mouth on your cock, the blowjob she's been perfecting for years. It's starting to fill up the room, her lips wrapping your shaft - the sound of her being so obedient, the most receptive, sweet, pretty thing: letting you guide her pace until she has a steady motion going. Taking the thick base in her hands and working it over between her fingers. There's only enough room for that before you’re all the way inside her, in and out, again: the tip of your cock brushing over the softest curve of her throat.
When you take her at face value, it's fucking wild: your fiancée kneeling before you. Her chin and neck wet with her effort, lips wrapped so pretty, stuffed, used-
There are no questions. This is simply Irene, doing what she loves.
She pushes a hand between her legs and holds herself together as your hips tilt forward, meeting her halfway-
Just letting you get yourself off in her mouth like it's no big deal. It's her throat - it's her goddamn cunt and ass, and whatever else - because you fucking asked, right? Because you gave her the permission, the choice, the agency.
"Hey, where should I?" you’re muttering as you push the hair out of her face, already half-drunk on her slick lips and realistically only a few seconds away from doing some real damage.
There isn't a need; but you want her to tell you, to use her words. In her mouth, on her face, in her palm, you’ll go without thinking. You’ll cum straight onto your own stomach if it’s what Irene says. Even if she’s acting like you already have.
"Make sure you give her,” is what she garbles out around the hard line of your cock, and it’d be impossible to understand if you didn’t know every nuance to her, if you didn’t - you know - fucking love her. To have and to hold - to hold on tight and for better or worse, and this is pretty much as bad as it gets. 
The syllables come in-between hollow breaths, all wet and sticky. When Irene wrenches the fuck out of it, the base of your cock- “hm, that same sort of courtesy when, agh, I'm not around-"
Because the image alone is what matters. There, getting your cock sucked like you've earned the privilege - it doesn't have to be real, it just has to look like it's a new truth to believe in. The little motions in her wrist are just - hah, fucking unreal - and the way she sinks down lower on her knees for each stroke, from base to tip - lips pressing over the knuckles she has wet, and squelching, and twisting up and down and up-
She places a hand under your balls, the gentlest cradle, and something of your restraint finally breaks - it snaps - her insistence is ruthless.
"Yeah, god, okay- I’m just gonna go ahead-" 
There are these images in your head, of Irene: the upturned brows, the hollowed cheeks, and that slutty-as-shit smirk - and then of Karina: doing the exact same thing. Fuck, your cock is heavy, absolutely leaking cum: you can feel yourself leaking into the press of her mouth. It fills up her cheeks as she blushes into the fuck. Her lips become flush and go soft against the ridge of your shaft - her jaw slack in anticipation. 
"Your fucking mouth, Irene" you breathe out, “I'm going to cum-” 
Just at half the sentence, you're there, sunk into your fiancée's throat. Fingers across her ears and into her hair and watching her own hands pulling you, guiding you-
It’s all flexed in your back. Every muscle. Every fiber.
Irene hums onto a simple, satiated note. She always does, when she tastes it. When you dump a hot load of cum all over her tongue and straight into her throat.
(And yes, some might claim this is the death knell for all kinds of reasoning, but you’ll go ahead and admit it’s so, so worth it.)
"How thoughtful," she says, low and slow, once she's through swallowing the entire fucking thing.
The corner of her mouth tilts up. Because you're finished: two steps left in the brain from falling out of consciousness, a mess on the couch. You get to watch as she pulls you into sorts and slots each piece back to where it's meant to sit. The underwear, your pants. It's with such careful attention. Your soft cock gets cleaned with a tissue and wiped dry. A tiny parting kiss for the tip, her mouth full-on puckered, like she's kissing out anything you have left.
Though it's a pleasant daze. She prefers you soft like this, really.
All you have left to say is: "fuck me, baby." It sounds sloppy and open-ended as hell. "I guess I'll leave everything to you."
If that's a cue or sign for the evening, the only right thing: it isn't exactly misinterpreted.
-
The actual logistics don’t arrive for a handful more weeks. You find it surprising they ever happen at all.
// Karina 10:41 pm > i'm bored.
// Karina 10:42 pm > suggestions?
// 10:49 pm > have you tried looking into an incognito tab?
// Karina 10:58 pm > lol, and what is it i'm supposed to be finding?
// Karina 10:58 pm > help a girl out here.
"Send her a picture of your cock," Irene says, like it isn’t a joke. She looks up from the smutty-dash-of-romance-porn novel she's got herself wrapped in, with her best faux-serious expression. The pair of readers that usually are in her top desk drawer have made a new home perched low on her nose. "God knows she hasn't stopped leering since she found out what I'm marrying into."
"Please," you tell her, because she's full of shit. "I'm not sending her a dick pic."
Your laptop is warm on your thighs as you huddle on your side of the bed. That's the point of balance where it feels like Irene isn't trying to look. Though she clearly is. You flick up through a couple tabs just to drive the point home.
// 11:01 pm > sorry. i'm not in the business of just handing out freebies
// Karina 11:07 pm > really
// Karina 11:07 pm > thought we were making progress here
// 11:11 pm > you're funny
"Ask her if anyone's home with her." Irene dogears the page she’s reading and sets her book down. "Or ask if she's, like, tied up or something. Something edgy."
"Something edgy," you deadpan.
"Do you want me to put the readers away," Irene offers. She's wearing the sort-of smirk you always need to be wary of.
"No," you say. “God, no.”
"Ask her where she keeps her lingerie. Tell her she should be thinking about what it'd look like: all naked except a thong. With the straps digging into her. Tied up all nice and pretty-like."
// 11:13 pm > u alone right now?
"What the fuck?" Irene slugs a pillow at you. "That is the creepiest way you could've sent-"
// Karina 11:13 pm > yeah. i am :/
You and Irene are both struck a little dumb by that. 
“Sheesh, she must have had her finger hovering over the reply button.”
"Yeah," you say, eloquent. “Who could blame her, though.”
"Uh-huh." Irene exhales, staring a bit pointedly.
// 11:16 pm > cool if I come over?
// Karina 11:17 pm > and… do what?
Irene nudges you with her heel, a questioning glance: the window has just been left there wide open and hanging. She whispers like Karina can somehow hear her through the phone, "you are terrible at sexting."
“Can you fucking leave it-”
Irene rolls her eyes.
// 11:18 pm > do you need ideas
// Karina 11:19 pm > got a couple. i wouldn't be against hearing something that lets my imagination fill in the gaps though
"Text her that you're into her throat and want her to show you her tits," and Irene actually cracks a laugh as she has the audacity to make the request. She's in good form this evening; in nothing but her favorite silk camisole - the navy blue one, which pairs great with all 5’2” of the rest of her. Like the soft curves she wears and everything else isn't bad for your heart. "Seriously, I want you to-"
"How am I supposed to end it?" You ask. The tone is purely sardonic. "Babe. Baby. My future wife. Tell me. You do realize you're basically asking me to bait her, right?"
Someone will eventually put their cards on the table, and Karina, Irene, and ostensibly you will realize you’re all currently having a mental break from reality. Or something along those lines. "I mean. Could that really be a negative," she wonders with an eyebrow quirked and another gesture of her arm like she wants to showcase the night sky beyond the bedroom windows.
"How, what - babe."
"You could promise to let her sit on it."
"Is the cockslut routine an act? Like," you lower your volume, "do you really have a playbook, here?"
"So mean." Irene reaches a hand over. She has her head propped on an elbow, the rest of her sprawled and comfortably positioned on the bed. And you wonder why the fuck you feel compelled to argue a point that so obviously has already been lost. "Just go fuck her already, god damn, I dunno."
Right. So. This was the part that was kind of inevitable - and Irene's impatience aside, you probably were about to win a lottery when you showed up at her door - that golden little interaction: "hey it's me, your rival at work's future ex-husband, I guess - I'm so horny and I think you're so beautiful and wouldn't it be so crazy if we, like, boned, haha, what?"
"Just- have sex. Tell me about it after."
The novel beckons Irene back toward it. She makes herself the picture of someone perfectly comfortable with you walking right into the next most uncomfortable predicament.
The sigh. That long, heavy thing. A leadup you do so often.
The simple idea of sending Karina that sort of message sends heat, low - just under the band of your sweatpants, and right where you've got yourself in the palm of your hand and you're already wondering how this is the result, why your cock is coming to a rise already - god damn - why every thought of Karina's face, and Karina's ass, and Karina's everything, every moment her lip is caught in between those teeth is becoming impossible not to touch. "Okay," you huff, "fine. I'm getting up, I'm going now- I mean it, right now, just give me a minute, I am putting my clothes on."
"Wait," and she's saying, "wait. Wait."
And when you turn around, Irene has this cat-that-ate-the-canary grin all stretched on the canvas of her face. She takes off her readers - her elbows thrown into her lap as she goes to the very edge of the mattress, pulling your shoulders for balance. "Babe-"
"Mm."
Irene likes to get you at a low simmer. The way she runs her thumb pad along your bottom lip. And all those questions - a look into her eyes - it's hard not to fold or break - when she's holding onto that sort of expression, unwavering; no matter how her mouth seems to get soft and curious.
Her lips move onto yours, asking - a push. And your eyes - a brush against a shoulder and you've already gone a whole mile from anywhere decent. There's the touch of her tongue between your parted mouths.
"You'll be good right?"
"I mean, sure," is what you manage, watching her lips close.
"You'll fucking wreck her, and do it exactly how she needs it done." And her brow, knit. She can tell your brain is busy jumping ahead to a hundred different scenarios. "Stop worrying."
There's a brief nod of reassurance. Her fingertips dust down your chest and the rest of the way. You hear Irene tell you to-
"And give her an extra hello from me."
"Okay, I love you, but also you're insane, like certifiable."
"Shush, I know you," and Irene gives your hair a little tousle before pushing you out the door.
-
You're standing there at the front door of Karina's apartment a little after midnight, bathed in dim, orange wicked fluorescence. Like it knows your sins - past, present and future. There's no obvious answer when you go knocking, and for a half-moment, you're thinking, okay, it's alright, this is how I let someone down easy-
Until she answers and leans out, pulling open the door. It takes you by surprise-
"Well, I'd normally let you in," you hear Karina say, and a smug smile starts to cross her face, "but..."
It's about the degree to which she looks hot and a little off kilter in this tight t-shirt - a snug pair of panties around the sway of her hips - that almost sends you spinning. There's not an ounce of self-consciousness; it's like a punch to the gut.
"Aeri's date went south and she's drunk. She's passed out on her bed, like, right now, I don't think-"
There's no bra. It's hard not to get fixated on every detail. Like her nipples, practically standing out. You have an irrational desire for her to take a step back, further into the room, further out of your vision's reach-
"Uhh," you croak. And you do have the mental faculties for, uh. For telling her. "Maybe, you know, later, could be better, yeah, maybe call me."
Though, unfortunately, the suggestion falls short on delivery.
"No, no." Karina has her hands searching up and underneath your sweater. Her fingers dance flat up, right over your stomach - teasing as she hikes you back inside. Right past the threshold. Your mouth is half-caught and stupid under her, the gentle hum and pressure on her lips. "It means we need to be quiet."
She drags you another step forward, with just the hot flash of her gaze. 
"Shut the door behind you?"
"Locking it too," you tell her.
The laugh she makes into it, this one little scoff - it's an acknowledgment: an agreement. It's one of the worst fucking sounds, and the whole damn thing gets to you. Like her ass wasn't the perfect fit for the palm of your hands- like you don't want to trace your fingers under the elastic of her panties.
As if it wasn't fucking clear enough. It's the tongue in your mouth and the hands in her hair. She's kissing you soft, she's kissing you deep; her weight rests and pulls back with each swell of your ribs, pushing her fingertips down until they're skating, slow, low into the grooves of your spine. Like she's getting familiar with you again.
"Okay," you breathe. She laughs on your lips and presses forward - pulls you back, farther- "uhh. Okay."
She must see the confliction you're in-
"Hey." Karina keeps going until you've got her backed against a wall, until your thigh has pressed into the crux of hers and your hand is in her shirt. You don't miss how she lets her head tilt back when her eyes shut. It's her. There's no disputing the reality. "Whatever you want to do to me. That is all I've been thinking about. Do it."
"I- don't really-"
She makes a decent show of crossing her wrists and tugging her shirt right over her head. Tosses it someplace safe enough. "So are you just gonna leave me in suspense, or do you need my explicit, enthusiastic permission?"
Your lips draw themselves a blank on anything useful, while your heart rate accelerates.
"Here try this: you’re going to fuck me until I beg you to stop. Then you’re going to fuck me some more. Or whatever- then we can go somewhere, I don't care," she offers with a half-whisper. In all her goddamned glory - barefoot, almost bare chested - it's not like it could be any other thing.
-
You’re not exactly supposed to end up on your knees for this.
This isn't quite how you pictured-
Okay, fuck, Karina's making the prettiest noises where her spine is curling up against the wall; those sounds you couldn't even make up. How it feels like the easiest damn thing, because there isn't a question to why. Every inch of you is pressed to every inch of her. You know what you'll taste on your tongue, which of these breasts belongs in your palm and the fingerprints in the dips of her waist - her lips on the curve of your jaw - every mark and bruise on her skin, every hint of it is real; it's fucking you up because you're kissing the woman that Irene picked, the woman you met - it's how you pull yourself away-
Karina, for the longest few seconds, is shocked into stillness.
Because you could, of course, decide to give this one last shot, your head between her thighs and eat her out until she was so fucking wet your cock wouldn’t even enter the equation. This is not actually a new idea; the possibility has run through her mind enough times already.
"Yeah. That would work."
Like it's no big deal-
"Do you need instructions? I can get a bit graphic."
"Actually, you know what?" you choke a little, and - "trust me."
You stand straight up for a moment, a second, an extra fraction. You slip your cock inside her hot cunt, and, yeah. She collapses right into you. You’re holding up her just enough to fuck into - she's starting to breathe deeper, harder; you've got her pinned like that - a hand on her neck, fingers sinking into everywhere she's softest: her tits, her ass, her waist, her throat, and there is nothing that isn't some version of fucking glorious about Karina's weight grinding, heavy onto the tip and onto the ridge and down the thickest length of you-
And her face, jesus christ, her fine brows upturned, the tears heavy in her dark lashes, the little gasping-sobbing sounds that spill across her wobbling lips - this is the both the easiest and the hardest part: seeing her get absolutely fucking ruined-
(You know, god help you.)
-
Irene doesn't even have to ask. There are hickies and bruises shadowing in on your neck, your chest - these marks you never remember Karina giving you, and a ton of scratches all up your back.
"You know I was going to offer to make you breakfast," Irene says, smug, "but I'm wondering if Karina got to you first."
"What the hell do you think?" you say, dumb.
There are eggs burning on a skillet that are never going to be salvageable, no matter what Irene says. She has no respect for the process. And her voice is full of that infuriating smile: "was it everything you hoped?"
"God," you mutter, trying to mask the embarrassed laughter in your words. You can hardly move an inch on her behalf.
"At least tell me something fun, you insufferable tease," she presses her nose into your hair and tickles the spot on your side, just to be a pest.
You lay it all out for her. Everything she wants to hear.
-
Surprisingly, there’s still plenty to learn about each other; days to weeks to months. The first real thaw of the year comes, and you’re quick to fall into this odd rhythm.
Karina won't actually join Irene on set or production very often - too much heat. It shouldn’t have taken so long to figure out the two don’t belong in the same room together, and if they’d asked you, they’d know - but no one ever really does ask you. However she does spend more and more time around the apartment. In and out of your personal spaces. And maybe a bit in between, or a little underneath too: how she seems to slot herself right into every possible fold whenever Irene’s away.
Always traveling for this reason or that.
And god, the perfect powder keg Karina is - ticking, short-fused, all ready to explode. It’s ironic, you think, she’s drawn to scandal the way Irene will do anything to avoid it, and here, she's found her ultimate indulgence.
The quick lay, the time and place you know you can be patient in pulling her apart, the everything in between. 
In fact, you’ve taken to calling her "babe" just so she doesn’t think twice when she gets your cum pooling deep in her cunt, all hot and sopping. Looking like the picture-perfect centerfold. The fucked-dumb face - all twisted in your grip, flushed-red; and the musky scent of sex; the noises and her presence alone. You fuck her, and fuck her, and fuck her, rubbing a thumb across where the mascara runs thick.
To be the gorgeous girl, cock-drunk and fucked-out in your lap - so simple - so natural: Karina finds her way over more often than not.
After your shower, after your nap; your work, the bar - Karina’s never more than a text away. And you'll keep a hand around her waist as she stands around in the kitchen, stealing Irene’s leftovers out of the fridge. Karina ends up straddling your thigh right there at the breakfast table, holding onto the wood for support as she cums all over you.
The long and short of it is: 
She's fucking you. She's fucking your fiancée. She sees no problem in having her cake and eating it too. The only caveat is: Karina thinks neither of you know what's actually going on.
“You gonna say hi to Irene for me?" she's teasing one day, snapping her bra back into place. The t-shirt pulled over all that glossy-dark hair, the shimmy of her hips just to get back into the world's tightest jeans. She presses a fleeting kiss to the corner of your mouth. It's such a stark, clinical goodbye - ending with a flick of a thumb across a screen. "And oh, let her know if she ever wants me to teach her a trick or two. Anytime."
“Yeah, I’m sure she’d love that.”
Karina does the most insipid thing. She fucking winks. “I’m sure she would.”
-
"Uh, are you kidding me?" you ask Irene. 
It's late one night, and Irene is standing in the kitchen in her pajamas with a welt the shape of Karina’s lips kissed right into her jaw. A couple drinks in your system have given you both a false sense of clarity, and also an ill-timed desire to solve all your goddamn problems. You lower your voice. "In her ass?"
Irene has that all-triumphant and dopey grin that makes your heart ache for her. There's a soft curl of her hair loose, thrown across a shoulder. "I’m serious, pull her hair right, hold her wrists until her back has to be arched. Pin her to the bed," she continues to illustrate, "it's all in the finer points of how much. Tell her to count, even. I'm not joking-"
She takes another spoonful of yogurt between her lips.
"-she'll let you do anything, promise."
“That’s fucked up.”
“I know.” Irene wags the spoon at you. “It’s great.”
-
It's not only the hypothetical-homewrecking that gets Karina so torridly wet for the whole affair; when she's pinned beneath you with her legs spread and her toes pointed skyward, or perhaps later - the same day even - riding Irene's face in a locked dressing room and crying out - "ah, hah, jesus, please-"
In her head, she has you both at her beck and call. Forget semantics - Karina is a fool to her own illusion. Because in her head, not only has she managed to go toe to toe with the industry's reigning monarch, she’s managed to win.
-
You don’t exactly know how Karina ever intends to keep it casual. Because things are damn near constant:
It’s a weeknight, and the moon is high above the windows, casting a crisp rectangle onto the hardwood; it doesn’t actually matter, as far as Karina is concerned.
Irene’s on television again, the sequin in her dress clinging tight, and she’s found the gaze that never breaks for the cameras. Found the flash of her most practiced smile - that little chime of laughter she has that sounds like striking pure gold.
Then Karina: sitting cross-legged at the very end of the sofa. One leg thrown over your thigh, she’s got these nylons on her feet and she’s poking a toe into your ribs. "Isn't she stunning," you hear her muttering, "honestly. Doesn't it, like, turn you the fuck on?"
Her foot grazes your lap, all casual at first; the impossibly soft-curved heel of her sole. There are so many ways she'd prefer to pass the time and they almost all involve getting under your skin, if not just outright getting into your pants.
“Elaborate.”
"I mean listen, in your case, just knowing your fiancée is up there looking like a total angel and at the same time, thinking about you; how she’s got to be considering every which way she’ll unwind just after the showcase - at least, that’s what I’d be doing." She licks her lips, teeth. "Hell, I’m only imagining how pretty her eyes are when she can barely keep them open, and that’s enough to ruin my panties."
"Are you really."
She shifts her weight. Puts that ankle to good use. Rubbing it into the crease between your legs. "Tell me," her lips curl. She’s looking at you dead-on. "How does she usually prefer it, hm?”
Like a wildcat, you suppose, your Irene - a pretty, little predator. You could tell Karina everything, but you don’t. Instead you let her wander into the lair of her own making. Her eyes: light and curious; it’s written in the lines of her face how she's picturing it all so plainly.
“I’d guess she lets you go slow. Or hard. Or maybe a little rough and then you make her cum, and then maybe, just maybe, after the teasing; after the edging, I guess, that's when she comes in hot. I would hope."
Karina twists her foot around, swings her weight onto your lap, and sucks in a sharp breath when you reach out and grip the lean lines of her hips. It’s as easy to hold her still as it'd be to drag her across the couch and under the rest of your body, fuck the goddamn tension until there was no longer any room left for the pretty smirk in her lips. And her gasp would probably sound a hell of a lot better - than all the needling quips - a much louder and much less-pretend whine when you could throw those thighs open and really pound her wet, aching little cunt-
“Easy,” she chides when you end up taking two handfuls of her chest. "Shouldn’t you be more supportive? For god’s sake, it’s your fiancée’s moment in the spotlight, you know-"
There’s nothing stopping you from popping off the buttons of her dress, one by one by one - and kiss right there, into the swell. Your voice feels all the rougher when you respond, "and what a moment."
Her fingertips skim over the places she's been kissing you, where she's been marking and claiming and trying to, at least, to stamp you like her personal property - when the look is that serious. All cold-burn. Right through to the bone.
“So.”
You can feel her touching into your pants. The heat in her soft, silky thighs; she sits above you, keeping a leg on each side. A part of you feels trapped; another is confused why you aren't turning the tables right now - flip her and ride out her cunt on the couch. Some passing thought, or just a fraction, the only one that matters in that particular instant, wonders what Irene would do, will do - has done - in your situation. How her hips would roll. How Karina’s moan might sound when she dug a nail right into a sweet spot.
You push Karina's skirt a little farther up her body and try to gauge the moment she's finally decided she doesn't mind.
“How about you keep your eyes on her, and I'll suck your cock while you do," ends up being the short and not-so-sweet of it all. “-or maybe you can get off between my tits.”
She wraps those fingers around your base and pulls gently. It's not a decision, but merely a continuation, a culmination: a gesture made entirely to pull the response: the hitch to the throat. Her nails skim that ridgeline as her eyes track across the cut of your features. It makes you groan into her next kiss, to say, "if you wanted it so bad, babe, you could’ve just said. Would save us a lot time-"
"Are you complaining?" she husks, pulling your pants down your thighs. Your cock is in her hands and she smiles like a cat - licks her teeth when it twitches at just the slightest touch. "Yeah, I didn't think so," is how the breathless laugh leaves her lips.
You catch the quirk of her brows, her tone: straight-up, like nothing. You’re almost buying into that until she's got your shirt on the floor, those lips of hers in the divot of your collarbone, and her tits wrapped around the base of your cock, and, well, fuck-
She actually wastes no time - none at all. A couple feet away, Irene covers her laugh with one hand. There's a brass award in her other. And the television casts this soft, pale glow.
Karina tips her head, and a curtain of her dark, silken hair spills across the ridge of her breast. She runs those big eyes over you, all wide and round and vaguely-deviant. There's the perfect amount of motion, of squeeze, just a light-bit of pressure, and she's got a face smug-arrogant in an instant, knowing. Fuck, her hands on either side start pushing into the line of her cleavage as she bounces and rocks and draws every inch of your cock up through her soft tits and back down again.
"Fuck," is the harshest exhale she's ever dragged out from you.
She hums a low sound, all self-satisfied when it's her own namesake: your body wants her, like you know the full weight of her needs, your touch, how badly she's fucking craving to get off and still not admitting to anyone it might be more than sex. Like it's really as easy as her next breath, the flutter of her lashes: Karina wants your eyes, the weight of your attention and she's not going to beg for a fucking thing. The feeling, you think, is mutual.
"Irene," she says, her smile as open as it could ever get. "She's just so gorgeous, right?"
On one hand, she’s speaking between the lines. A perfect tincture of deceit - the bawdiness-by-nature: watch me, look at me - is what she might as well say - look what I can fucking do, the whole lewd display. And, god, how she knows every way to make a guy want it, like she wants you to remember it.
Because on the other, the movement is so, so direct. 
Karina twists herself in an upward tilt, just an easy, practiced thing; she lets her tits spill around your cock and through her fingers, full and soft - and her lips part, mouth slacking alongside yours, matching the sounds out your chest with her own. Like she knows exactly which slide of slippery friction will make you moan, or which pull and drag will send your teeth straight into your lip.
"Isn't it crazy," she lolls her head a little, letting her own saliva drip down the center, onto your weeping slit. "How much I want your cum filling my cunt, even knowing she's the one you'd rather put the ring on," the drag and drag and drag - her tits are fucking incredible, and she knows it. She pushes up with her fingers and gives you a long draw right through the press, right where the nerve endings run electric, right where she keeps moving, up and down, and up and down- 
“-it must be hard, I mean, jesus christ. Here I am, needy and hot. Begging you to wreck me and my only sin, hm - the sin of being second best, right-"
"Holy fuck, you're-"
"Obsessed," she says, and drops her tits against your waist again. "I know, I know. How could I not be?"
You're left muttering into the titfuck alone, watching her rub your precum up between their soft shape, feeling the slight give, how her skin goes warm. The act itself: such a simple-thing-bordering-on-the-absurd that you notice how you coil and flex beneath her curves, how she feels so soft and warm. The slight pucker of her lips every time your cock escapes her cleavage does little to help. It's probably the fault of the brain-fuck but the wet of her mouth is practically everywhere you look. You could eat her alive right here, spread her legs on the coffee table and finish with a bit of screaming, groaning and tearing, and no one would ever stop you.
But instead,
"-it's a good color on her, really; but then every color is a good color on her, isn't it so unfair?" She's taking your cock into her tits, deeper on every rock forward and back, holding them close - a gentle lock of those long manicured fingers keeping it all together. "Even wearing no color at all; you must just love how all the freckles are so easy to see," she murmurs, squeezing tight. The sound is wet, messy. A filthy chorus between her dirty words and the dirtier action, and just that glimpse of friction when she strokes down again is maddening. You're all slippery. So sticky-slick, so tight.
Of course there's not a fucking inch of a reaction out of her; you want to get off so bad-
"You could close your eyes," she tells you. "She would still be there. The sound of her laughter. The image. In that dress or not," and her mouth furls into a half-smile before she pauses. Reaches down, pulls her tits around you impossibly tight. "Just so damn pretty-"
You cum just like that: 
"Babe," is what you let her have. The soft, undercurrent hiss. "Fuck."
You shoot clean up, all thick, hot splatter.
Well, mostly up - along the expanse of her neck and throat, coating where her breasts sit so pretty against the lines of your thighs. Across her sternum and the hollow of her neck - her body's covered in your shared mess: slick-filthy-hot, all strewn across her perfect tits.
"Jesus, Karina, baby you’re-"
"Completely covered in you." She's still smiling. That deep-cut and perfectly symmetrical curl of her lips. The gorgeous fucking shade, and her chin, how her cheeks flush, just a little - they've always turned pink in the most specific places when she gets fucking cum-soaked. “I know, just look.”
And her hands slide across her chest, trailing a path through the thick of your release, spreading the glaze all down her front. Making it messy, making the exact look a guy sees once and is driven to the ends of his sanity - just to spill his load out onto her. To get her all used, and trussed up: just how she likes.
(Sanity is being generous, considering.)
You can't do anything other than what's expected: take her up in a kiss, breathe into the mess you've made on her skin. The gasp is full, surprised - just enough, maybe, to count as genuine.
Such a mess - she murmurs - um, come on then, you can do a girl a favor. Bath bomb, bath towel, bath robe - and really it doesn't have to be a suggestion.
You’ll pin her down and fuck her right over the lip of the tub if that’s what she really wants. Just being in her company is indulgent and excessive and begging you to make a terrible habit of it. Have some self–restraint, she has this tone in her voice sounding more and more like a dare. There's just enough there in her hands: one reaching for you and the other reaching into the porcelain, swirling up the lather - and that look on her face, as if to say, can't believe you have me waiting, like some desperate, depraved pervert - only it’s more explicit than that. Only it feels worse - and her mouth is moving again, speaking into the air that already feels stifling hot, words cutting through the steam: you're not very nice, I mean really, it should come as no surprise how she turns out, having this jerk for a fucking boyfriend- 
Nevermind. Not a dare, it's a challenge. She was right the first day you undressed her, the brattiest girls always have the worst kinds of fantasies, the darkest little tendrils of self-destruction. How she's laying there, asking and telling, pushing and pulling; and how she thinks she's so clever too.
Though that is no reason, she laughs, for you to think she won't love having her pretty cunt cockwarmed and spoiled for an evening or more. - And so it goes, and so it goes, and so it goes, and so it goes.
-
(Really, to Irene’s credit, she had Karina pegged right from the jump. A character study in, well, herself.
She's seen as an ingénue by the press, and an outright savant to the executives. They know her as the obvious successor. They give her the runway, they watch the leggy-girl-turn, the model-posture, chin held high and aloof, looking down at the gathered throngs of photographers.
The protégé, the goddamn heir-apparent:  
But her favorite game - that bit of innocence served on a platter, ingenuous when it comes to spinning a flaw to gold, and the deception too - Karina loves and loathes every second she spends upstage from Irene's own, hectic, international production. Because if anyone asks her, that girl would claim it's never been a competition in the first place. 
So you see, if you and yours have both decided to ruin her-
It is a disaster-in-the-making, isn’t it.)
2K notes · View notes
hellsitegenetics · 2 months
Text
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?: no, just neurodivergent
How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?: my lawyer has advised me not to answer this question
How do I request things?: read the REQUESTS section of this post :)
Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?: yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
Tumblr media
1K notes · View notes
tearsofastraeax · 3 months
Note
hello, i hope u’re doin okay 🫶 i wanted to ask you could u write smth where we have an age gap in our relationship w Simon (legal ofccc) and we’re a bit scared of 141’s reactions ? thank u sm even if u don’t feel like writing this <3
hi, hun. hope you enjoy ♡
Tumblr media
⊹ simon riley never made a big deal about you being younger than him. he rather adored how sweet and innocent you were for him. he loved to have you by his side, and so he suggested you’d meet the 141. you were nervous, you weren’t bad with new people, that wasn’t it. but you couldn't stop thinking about what they might think, these guys were such an important part of simon's life, you wouldn't be able to handle it if they didn't like you. and what did your relationship look like to them? him being the older guy that spoils you and you being the bratty younger plaything? they probably wouldn't even take you seriously, maybe they’d see you as just another stupid girl. 
but simon was persuasive, he knew how to convince you to do his bidding. he trailed sweet kisses down your neck, whispering into your warm skin. 'they'll adore you, my love’, he'd say. his hands wandering from your waist to your hips, grabbing you in the sweetest way he could, just hardly leaving bruises behind. 'please come with me, just meet them.' he punctuated his words with a nip on your neck, his teeth grazing your skin, leaving a faint mark behind. you sucked in a low breath, hardly able to focus. his skilful fingers winding their way around your thighs, massaging them, and ever so slowly moving toward your throbbing core. 'trust me, love.' he captured your lips with his, pulling you into a dizzying kiss that left you breathless. you could only nod, barely able to register what you were agreeing to. 
            ⊹ so, the day came when you would meet the guys. with simon at your side, you stepped into the bar everyone had agreed to meet. your heart was beating so wildly in your chest that you were sure everyone would know just how nervous you were by just looking at you. but against your best beliefs, it was nothing like it. first, you met gaz or kyle, how he had introduced himself. oh, and how happy you were he was the first one of the bunch. with his easy smiles, he made you feel so at comfortable. so much so, that it barely shook you when you met the stoic captain price next. thankfully, the short-lived introduction was interrupted by no one other than soap, who with no time to spare swept you up to join him at the bar and ‘get fucking drunk, bonnie’. 
a few drinks and a couple of shots later you couldn't stop yourself, your brain-to-mouth filter having stopped working approximately 3 drinks ago. so you blurted out, 'I'm so happy that you guys like me, you know, I was kind of scared that you would think it's weird that simon and I have such an age gap.' you smiled shyly, immediately regretting even saying anything at all when everyone became a bit quieter than before. now you had ruined it. 
but instead, a low chuckle turned into a laugh. 'no, no, see we're happy for the old man here, getting some fresh meat', soap exclaimed, earning more laughter from the guys and you. except for simon who looked like he was ready to pounce on the poor guy. 
1K notes · View notes
hoshifighting · 4 months
Text
Tumblr media
Ways to Have a Man in the Palm of Your Hand.
Synopsis: In the flow of uncertainty that defined your situationship with Mingyu, you decide to take action, making Mingyu start chasing after you like a loyal puppy.
Word Count: 3.9k
Warnings: Smut, unprotected sex, overstimulation, degradation, begging on knees, oral (f. receiving), fingering– he watches reader fingering herself, handjob, dick riding, penetrative sex, humiliating, manipulation and etc.
Your life connected with Mingyu's since you both first met through your groups of friends, and a situationship had emerged between you two. It was just sex, with no strings attached and no promises made.
Yet, as the days turned into weeks and the weeks into months, it became challenging to keep your heart safe from the unpredictable tides of emotion.
Mingyu had a way of making you feel special. He'd surprise you with homemade dinners, he was attentive, considerate, and made sure to put your self-esteem on the highest with his skillful photography.
The tall and good-looking guy wasn't just amazing during sex; he was an enigma that both fascinated and frustrated you. Mingyu could vanish for days, leaving you on blue. But just as you were about to write him off, he'd resurface, as if nothing had happened. It was a maddening cycle, and yet, you found yourself caught in its web.
Mingyu: Hey! Been swamped asf with work lately. Let's grab coffee or something stronger soon? Let me know when you're free!
You couldn't help but scoff as you read Mingyu's message. His casual tone and nonchalant invitation stirred a mix of irritation and amusement within you. Swiftly typing a response, you questioned his unpredictable appearances.
You: Are you planning on always popping up out of nowhere like this?
Mingyu: I always come back, don't I? So, when are we catching up darling?
Despite the inner conflict and your ego's warning signals, there was an undeniable allure to Mingyu's charm. His words, laced with playfulness, had a magnetic effect that bypassed rational thoughts. With a sigh, you found yourself succumbing to the familiar pull.
The room was filled with the echoes of skin slapping as you both lay on Mingyu's bed, your eyes locked as you two moaned out loud, the crescendo of pleasure punctuated by the rhythmic thud of the bed against the wall.
Mingyu lays beside you, the heat of the moment still lingering between your bodies. You rose from the tangled sheets, picking up your scattered clothes. Mingyu's gaze remained fixed on you, an intensity that betrayed a deeper connection than the situationship allowed. 
"I really like spending time with you Y/N" 
"Me too Gyu." 
[...]
Seungkwan leaned in "Okay, spill. What's the latest drama with Mingyu?"
You sighed, running a hand through your hair. "Honestly, I can't figure him out. It's like a cycle. We talk every day for a month, hang out, fuck, and then poof! He disappears for a week or more. I don't get it."
Seungkwan chuckled knowingly. "You know, maybe you should try something. Do the same to him, but take it up a notch. Make him miss you even more."
You furrowed your eyebrows, slightly taken aback. "Seungkwan, I'm not into playing games or being spiteful. It's not my style."
He waved his hand dismissively. "No, no, hear me out. It's not about being spiteful. It's about making him realize what he's missing. Mingyu knows you'll always be there, right? So, he takes it for granted. Maybe he needs a taste of his own medicine."
You raised an eyebrow, intrigued but cautious. "And how exactly do I do that?"
Your mouth hung open as Seungkwan delivered his comprehensive lesson in the art of emotional tactics. The confidence in his advice left you both amazed and slightly apprehensive. Unable to contain your curiosity any longer, you finally asked the burning question.
"How on earth do you know all of this, Seungkwan?" you inquired, eyes wide with disbelief.
Seungkwan leaned back, a mischievous glint in his eyes. "Well, my dear friend, when you've been in the game as long as I have and witnessed enough romantic dramas unfold, you start picking up on patterns. It's like a survival guide for the heart."
You raised an eyebrow, still processing the information. "Survival guide, huh? And all this contempt, playing hard to get, and hurting egos – that's your secret weapon?"
Seungkwan chuckled, "Not a secret weapon, sometimes, a little strategic move can make all the difference. Trust me, I've seen it all."
With Seungkwan's advice resonating in your mind like a strategic playbook, you approached the next phase of your relationship with Mingyu, with a newfound determination. It felt like diving into a complex homework assignment, each step carefully calculated to shift the dynamics in your favor.
As you decided to implement the first step, a newfound sense of liberation washed over you. You stopped responding to Mingyu's messages immediately and resisted the urge to initiate contact. It felt strange at first, but there was a sense of power in reclaiming your time and not being at his beck and call. Mingyu's messages awaited your attention. 
The challenge of making Mingyu realize he could lose you sparked a newfound determination. Your calendar filled up with plans that didn't involve Mingyu. Mingyu, accustomed to your constant availability, seemed to sense the change, though he couldn't quite pinpoint it. He might have been the object of desire for many hoes, but your indifference challenged his accustomed narrative. 
After all, a man is not more important than your personal goals, right?
All while allowing Mingyu to observe your life unfolding without him. The realization that you were not waiting by the phone for him sparked a large curiosity.
Throughout the process, a mix of emotions surfaced. Doubt, at times, whispered in the back of your mind – was this the right approach? Seungkwan's advice, unconventional as it was, had brought a shift in Mingyu's behavior. Now, you wondered how Mingyu would respond to the transformed version of you – a person who refused to be taken for granted.
Mingyu's relentless messages flooded your phone. The janitor, a silent witness to the unfolding drama, discreetly shared the news of Mingyu's visits to your condominium entrance. Three times he had appeared, seeking a glimpse of you, only to be met with the absence of your presence, the deliberate distance, and the air of indifference were beginning to provoke a reaction from him.
You were determined to see this journey through, to understand whether Mingyu's renewed interest was genuine or a fleeting reaction to the perceived loss of control.
The persistent pings of Mingyu's messages had become a constant background noise in your life, infiltrating your workdays and even interrupting the serene moments of your brunches.
"Free today, Ms. Busy?"
"Pls respond to me. :(("
"Why are you acting like this?"
"Wtf…"
"Omggg, when are you going to answer me properly?"
"I'll invade your house."
"Y/N-ieeee, pleaseee!"
"I really want to see you right now."
"You make me so confused :("
The encounter at the pedestrian crossing unfolded in a scene of unexpected tension. Mingyu, spotting you in the midst of your Sunday morning run with Seungkwan, seized the opportunity to bridge the gap that had grown between you. As you halted, waiting for the light to change, Mingyu approached, a mixture of eagerness and confusion etched across his face.
"Hey there! Fancy meeting you here," Mingyu greeted, attempting to strike up a conversation.
Seungkwan, standing beside you, looked on with a side-eyed glance, a smirk playing on his lips as he sipped casually from his water bottle. As the pedestrian light shifted to green, you seized the moment to extricate yourself from the short encounter. "Sorry, Mingyu, I really need to finish my morning walk. Catch you later," you excused yourself, leaving Mingyu standing there, perplexed and surrounded by the bustling activity of the street.
He couldn't shake off the confusion – Why weren't you responding as before? Why weren't you as available as you used to be? Did you at least still like him? It dawned on Mingyu that the game had changed, and he wasn't sure if he understood the rules anymore. The pursuit, once fueled by the expectation of your constant availability, now seemed to slip through his fingers like grains of sand. The reality of being just one among the many who sought your attention was a bitter pill to swallow.
[...]
The doorbell's unexpected chime disrupted the tranquility of your self-care routine, with moisturized skin and a mind ready for a cozy movie night, you approached the door, curiosity dancing in your eyes.
As you swung the door open, the sulky face of Mingyu greeted you. A momentary pause hung in the air, your eyes meeting his in silent expectation. Before you could utter a word, Mingyu stepped inside, dropping to his knees and hugging your legs as if seeking solace.
Surprised by his sudden display of vulnerability, you widen your eyes, caught off guard by the intensity of his reaction. The door lingered ajar, and you managed to close it, arms crossed, a mixture of confusion and caution etched on your face.
Mingyu, still hugging your legs, looked up at you with pleading eyes, his voice laden with remorse. "What did I do, Y/N? Why are you treating me like this? I'm sorry."
"Hm?"
He looked up at you, his eyes brimming with a mix of confusion and regret. "I just… I don' understand. I miss you," he admitted, his voice trailing off.
Your initial surprise transformed into a mix of emotions – disbelief, a hint of empathy, and the need to assert your newfound boundaries. Crossed arms and a measured gaze met Mingyu's desperate expression. The sudden intrusion into your personal space prompted a silent assessment of the situation.
"What did you expect, Mingyu?" you countered, your voice steady but laced with the weight of unspoken questions. "You disappear, then reappear, and now you're kneeling in my living room. What's going on?"
"I messed up, okay? I thought I could keep things casual, but I didn't expect to feel like this. I miss the way things used to be between us." he confessed, his voice carrying a raw honesty.
"You ask me to come to your house, and then after you get what you wanted, you let me go. Do I look like a food delivery or something?" you confronted Mingyu, your words cutting through the charged silence that hung in the room.
Mingyu's eyes widened at your accusation, shock and a hint of hurt registering on his face. "No, no, no, Y/N, it wasn't like that."
You raised an eyebrow, a mix of skepticism and frustration evident in your expression. "It feels like you only want me around when it's convenient for you."
Mingyu, still on his knees, looked up at you, his eyes pleading for understanding. "It's not like that. I just... I didn't want to push you. I thought you preferred it this way."
You sighed, the weight of the unresolved tension palpable. "Mingyu, I can't read your mind. If you want me to stay, you have to say it. Communication goes both ways."
"Y/N, I'm truly sorry. I'll do whatever you want. I didn't see you as just a fleeting thing, and I want to be present."
Mingyu's earnest apology hung in the air, a plea for understanding and a promise to change. As he laid his face on your bare thighs, expressing his sincere regret, you cut through the moment with a tsk sound, a dismissive gesture that left him wide-eyed and caught off guard.
"Poor boy, begging on his knees for attention. What a shame," you remarked, a hint of teasing in your voice as you observed his reaction.
Mingyu, his hands now gripping each side of your thighs, sat back on his feet, his expression a mix of surprise and a subtle flush coloring his cheeks. He hadn't anticipated this response, your playful teasing catching him off guard.
"You didn't see me as a fleeting thing?" you continued, your tone mockingly contemplative. "Well, Mingyu, this is quite a sight – you, on your knees, practically begging for my attention. I'd never do something like this."
His widened eyes met yours, uncertainty and a trace of embarrassment flickering in them. Mingyu's bit his lip, cheeks flushing deeper.
"I'll do whatever you want, Y/N. Just tell me," Mingyu replied, his hands still holding your thighs.
You let out a soft chuckle, running a hand through his hair as you continued your teasing. "Oh, Mingyu-ah, the mighty one on his knees. Maybe you'll learn to appreciate what you have when it's not handed to you on a silver platter. Now, let's see if you can keep up with your promises."
As you spoke, Mingyu's cheeks continued to flush, a complex dance of emotions playing out on his face.  "How can you forgive me?" 
Mingyu's question hung in the air, a genuine plea for forgiveness. You paused, considering the weight of his words, before adopting a more serious tone.
"Get up," you instructed him, your voice carrying a command that seemed to catch him off guard.
Mingyu, without hesitation, rose to his feet from his submissive position. His eyes fixed on you. An arched eyebrow and a smirk played on your face, savoring the moment of dominance as you instructed him to follow you.
The atmosphere grew charged with anticipation as Mingyu attentively trailed behind you, his eyes inevitably drawn to your body covered only by a shirt. The click of your bedroom door signaled a shift in the dynamics, and when you turned to face him, his eagerness manifested in an attempted kiss.
Your finger halted his advance, a calculated pause preceding your question, "Do you think you deserve to kiss me?"
Mingyu, his eyes reflecting a mix of longing and remorse, shook his head no. Your smirk deepened as you delivered a verdict that left him whimpering.
"Then you won't kiss me today."
A whimper escaped Mingyu's lips, a sound that echoed the frustration and desire that simmered beneath the surface. The unexpected turn of events had left him yearning for a connection, yet you, in your assertive control, denied him that solace.
As the tension hung in the air, Mingyu's eyes glistened with unshed tears. The dynamics between you had taken a surprising turn, a power play that left both of you navigating the intricate threads of desire, forgiveness, and the consequences of a maybe – ex-complicated situationship.
With a commanding tone, you instructed Mingyu to kneel once again, a subtle smirk playing on your lips. He obeyed, sinking down to his knees with a mix of anticipation and eagerness. The air in the room crackled with a palpable tension as you laid down the terms.
"If you act like a good boy, maybe I'll forgive you," you declared, your voice carrying a hint of authority.
Mingyu nodded earnestly, a silent pledge to abide by your terms. As you proceeded to remove your shirt, next your pantie, allowing it to fall to the floor, the atmosphere became charged with a new layer of intensity. 
"How much do you want this pussy Mingyu?" you inquired, the question hanging in the air as you observed Mingyu's reaction. His shoulders slumped, a subtle expression of desire and longing evident on his face.
"A lot," he moaned, the words escaping his lips with a mixture of need and surrender. Your legs spread open, an invitation too tempting, as he feels his mouth waters at the view. 
"Open your mouth," you commanded Mingyu, your voice carrying an air of authority. He complied without hesitation, anticipation flickering in his eyes.
As he held his mouth open, you slid two fingers inside, the intimate contact a subtle exploration of boundaries and desire. Mingyu's tongue teased your fingers, a provocative dance that elicited a hiss from you.
"No teasing," you admonished, a note of warning in your voice. With a swift motion, you delivered a little slap to his chin as you withdrew your fingers from his mouth. The air crackled with a newfound tension, a moment that blurred the lines between control and submission.
Mingyu furrowed his eyebrows, as he watched your fingers slowly disappearing inside of your cunt, your fingers and your slick gushes out of you, and all he can do is watch. He sits patiently on his feet, watching your fingers leaving and entering your pussy in a too provocative rhythm. His bottom lip quivering to the desire of eating you out.
"Please Y/N…"
"What?''
"Please, let me eat you out, it looks so good…"
To tease him even more, you fastened your fingers, moaning while your cunt sounded like Mingyu's favorite song, wet, luscious, mouthwatering, appetizing, tempting. He cries out, his hands together on his lap. "Please, I beg you, I missed you so bad." 
The room was charged with a blend of anticipation and surrender as you stopped, taking a moment to look at Mingyu's mournful face. The desire in his eyes was palpable, and the silent plea for what he had begged for lingered in the air.
With a subtle nod, you allowed him to fulfill his request. Mingyu, starved and eager, approached the task with a concentration that hinted at a deep desire to please you. As he held you with a gentle yet fervent touch, mouthing your pussy, licking you clean, his focus on your pleasure was unwavering. The way he clung to you conveyed a fear of losing you, made you mewl as he sucked your clit, you held onto the sheets, a silent anchor in the sea of sensations. Mingyu's devotion and the way he concentrated on your pleasure only intensified the building release within you. Like a wave, you're cumming all over his mouth and chin, he hums in response flickering your clit with his tongue.
"Enough." You breathe out, closing your legs. "Strip, and lay for me." 
Mingyu rose from the floor, a determined look on his face, seemingly oblivious to any discomfort his knees might be feeling. The sounds of his clothing being discarded echoed in the room, punctuated by the soft thud as he settled onto the bed. The mattress shifted as he moved closer, his warm touch caressing your arm.
"What are you going to do?" he asked, his voice a low murmur, a hint of curiosity and desire lingering in the air.
"Don't touch me," you instructed Mingyu, your tone carrying a note of command as you climbed onto his lap. Leaving him momentarily frozen, his hands hovering in the air, uncertain of where to go.
The close proximity of his cock intensified the wetness between your thighs. Mingyu, eager and responsive, looked at you with a mix of desire and restraint, his hands now cautiously placed together on his chest.
The atmosphere crackled with a blend of dominance and submission as you straddled Mingyu, humping your wet pussy against his cock, your movements deliberate and provocative. His moans in response to your degrading words only heightened the intensity of the moment.
"Oh my god, look at you," you cooed, your voice a mix of mockery and desire. "I just stopped paying attention to you, and you came fucking begging me to talk with you. You're humiliating, Mingyu."
His moans, a symphony of pleasure and submission, filled the room. Mingyu's response to your degrading words conveyed a complex dance of desire and self-awareness. The acknowledgment that he deserved the degradation.
The room filled with a momentary hush as you sank your hips, Mingyu's length now fully inside. He shut his eyes, a silent surrender to the sensations that enveloped him. 
The unspoken admission hung in the air—though you wouldn't openly admit it, there was a trace of longing, a subtle acknowledgment that, despite the complexities, you had missed him a little. The air became charged with a mix of desire and restraint as your hips rode him, his length fully fulfilling the connection between you.
His angry tip brushed against that special spot, sending a surge of pleasure through both of you, cause now, you were so tight around him. "I'm going to cum, f-fuck"
"You better not." 
The charged atmosphere intensified as you edged Mingyu, denying him release, while simultaneously relishing in the control you held over his pleasure. He gasped for air, his eyes clenched shut, a desperate attempt to hold back as your dominating presence and the sensations of your movements threatened to overwhelm him.
Your hips moved with a purposeful intensity, driving him to the edge, and his body contorted in a desperate attempt to maintain control. The struggle was evident in the way his breath hitched and his eyes rolled back, succumbing to the overwhelming pleasure that surged through him.
"I-I can't hold it anymore," he stuttered, his voice strained with the effort of restraint.
"If you cum, I will-"
The moment of release was inevitable. Mingyu's hot cum filled you, triggering your own orgasm, he cried out your name, making your wall clench harder around him.
As Mingyu managed a string of apologies, you allowed him to slide out of you, leaving his lap coated with both of your arousal, your legs damp with his seed. 
The scoff echoed in the room, a mix of amusement and assertion. However, your actions spoke a different language. As you tighten your legs around the sides of Mingyu's legs, restraining his movement, your hands take control, pumping his cock fast. The focus on his red tip elicited a loud cry from Mingyu, his back lifting off the mattress in response to the overstimulation.
The wet sounds filled the bedroom as the intensity of your touch drove him to the edge. Mingyu's hands gripped the pillow beneath his head, a desperate attempt to anchor himself in the whirlwind of sensations that consumed him.
As Mingyu's body trembled under the heightened sensations, he felt a knot tightening in his abdomen, a sensation he hadn't anticipated. The overwhelming intensity built up to a point where he couldn't contain it anymore. A primal scream tore from his lips, his body convulsing in the throes of another orgasm.
His cum pooled on his abdomen, a physical manifestation of the powerful release that coursed through him. You observed his trembling body, struck by the raw intensity of his response. Mingyu's reaction seemed to surpass any previous experiences, his vulnerability and ecstasy on display in a way you hadn't witnessed before.
"Sorry, I came without your permission…"
"Enough with the sorry's, Mingyu," you said with a soft smile. "Let's just take a bath."
As the warm water cascaded around you, cleansing away the external worries, you both found solace in the simplicity of the moment. Emerging from the bath, you lay on the bed alone, the silence speaking volumes. Mingyu, holding his shirt, stood in contemplation. His gaze met yours, and he released a breath he seemed to have been holding.
The room felt charged with unspoken emotions when Mingyu finally gathered the courage to ask, "Can we sleep together tonight? Can I stay here with you?"
His eyes held a lot of shyness, and for a moment, you felt a genuine change in the air. You bit your lip, a subtle smile playing on your lips. In response, you patted the bed twice, a silent invitation for him to join you.
Mingyu threw his shirt away with a smile, a blend of shyness and excitement. He settled on the bed, maintaining a cautious distance, uncertain about what the night held. Your gaze met his, and you turned to face him. His eyes sparkled, and with a newfound boldness, he closed the gap and hugged you tightly.
"Don't be away from me again," he whispered, his voice tinged with vulnerability. And for the first time in those weeks, you let yourself savor the sweet taste of his pink soft lips, making him melt in response.
You smiled, your palms sliding gently along his back. The walls that once stood between you seemed to crumble as Mingyu embraced you, his actions speaking louder than any words. In that moment, it felt like a page turned, and a new chapter began.
Well, Seungkwan, you knew a lot. The five ways to have a man in the palm of your hand indeed. 
2K notes · View notes
eustasskidagenda · 6 months
Text
Okay, this post is not based on a request. I kept thinking about it for hours and finally decided to write it down: how the OP characters would text their s/o. So here are some texting headcanons for some of my favorite characters: Eustass Kid, Zoro, Sanji, Law, Sabo. I'll probably write a part 2 with my other beloved characters: Luffy, Marco, Killer, and Robin. :D
☆Texting HCs for Kid, Law, Sanji, Zoro & Sabo
CW : g/n reader, MDNI, Kid is cursing, fluff, funny, partly nsfw, mention of alcohol for Zoro 
WC : 2k
Tumblr media
Kid
Your name/photo in his contacts: mine. With a photo of your ass, obviously. And when he's mad at you, he renames you mid(ge).
Such a brat.
His wallpaper: a cool photo of his motorbike (I'm sorry but Kid is that kind of man in love with his own bike/car. But it's okay, he's still my favorite.) Or, a pic of your ass.
What kind of pictures are in his gallery: your ass, random photos of your face when he’s teasing you, his bike, and some punk stuff (music, makeup, outfit etc.)
His fav emoji : none.
He likes to send really, really shorts messages. Like : 
"Hi" "u know" "i have an idea" "So listen:"
Goddam Kid, just write the WHOLE sentence in one message.
He's sending you random pictures of his torso, just to flex with his big tiddies.
And you have to respond with a heart emoji and praise him each time.
If you want, he's more than willing to send dick pick too. 
Again, you have to praise him. Even if the pictures are absolutely non-aesthetic. He's blessing you with his cock after all. 
"Babe, you don't know how to take beautiful pics of your dick." "WTF SHUT UP???????? It's MY dick???!!! OF COURSE IT'S BEAUTIFUL??!!!" 
Yeah, Kid is clearly using extra punctuation. 
Oh, sure, each morning, you receive a mirror selfie of his outfit of the day. Such a punk fashion icon. "Rate my outfit on a scale of amazing to amazing" 
He doesn't use emojis because they sound too soft and stupid. "em0teS aRe f0r s0fT b0ys Y/N"
If you complain about his messages looking cold, he might use random emotes to annoy you like "UgH iF U wAnt 🦬" (with that stupid dumb sponge bob meme)
Whenever he calls you, it seems like he's yelling through the phone. 
He likes using caps lock like "HEY Y/N, WANNA FUCK TONIGHT??????" 
He's sending you random punk/rock music. And you have to listen and react to every single music, otherwise he's so pissed off. He is sharing his world with you, the less you can do is interact with him. 
He also loves sending some pics of what he's working on, because Kid likes to repare/custom some cars or motorbike. 
And last thing, I like the idea of Kid Pirates being a punk music band, so sure, Kid loves to send you some videos of him playing guitar. "My fingers are skilled in three things : music, crafting and fingering you all the fucking day long"
His phone is so damaged because he throws it every time he gets angry (like every two minutes).
Tumblr media
Law
Your name/photo in his contacts: y/n-ya. With a cursed picture of you. Just to tease you with it. 
His wallpaper: nothing, just the random by default home screen. In his view, wallpapers are useless and pointless.
What kind of pictures are in his gallery: random pictures you took of him, emo memes, and boring stuff about medicine or basic hygiene rules for Luffy. And a guide to "how to stop screaming and how to control your anger: a guide for children" for Kid. 
His favorite emoji: 🖕🏻
Whenever you annoy him with a stupid joke or a prank you saw on TikTok, his immediate reaction is to block you. He's so annoyed, please, leave him alone. He is immediately aware that it is a prank. Luffy always does the same to him before you do.
He's never using capital, it's for the emo aesthetic, like 'I hate bread'. Nope. But ✨"i hate bread."✨, yeah, much better
And yes, he uses "." everytime, it's for the dark and tired emo aesthetic. 
He always leaves a group conversation as soon as you include him. Please, he's so pissed off by those kinds of things. 
He's able to leave your message seen for days. Just because he was busy and forgot about what you said. If you need an answer, sure, try to call him. He always keeps his phone in silent mode. 
He likes to send you cool articles that he reads. Especially about medicine, tattoos or nerd stuff like movies, books, games etc.
"wanna go to a date tattoo with me tomorrow?" 
That kind of question is clearly his love language
He enjoys teasing you with random photos of his tattooed fingers or chest. "I bet you miss these fingers." And yeah, he's clearing curling his fingers on the pic like he would do when they are inside you. He's really good at teasing you with photos. 
Kid and Luffy steal his phone whenever he's with them. So be ready to receive a lot of ugly pictures of Law (taken by the chaotic duo), middle fingers from Kid, and blurry meat pictures from Luffy. 
Poor Law deserves a break.
Tumblr media
Sanji 
Your name/photos in his contacts : 💗💘🛐Mon Amour (my love)🛐💘💗 With the most beautiful picture of you. 
His wallpaper : a cute couple photo.
What kind of pictures are in his gallery : a lot of cooking videos or photos, you, aesthetic pic of the sky and a private album with some hot nudes that you sent to him.
His favorites emojis : 💘💗💖🛐💍🧎🌺🌸🌹🫦🥰😘🧑🏻‍🍳🍽🍷🥘 (yeah, Sanji LOVES emojis)
He's always texting you back. If he can't reply within a second, he won't open the text. Sanji, leaving his beautiful s/o with that awful "seen"? Never. 
All the mornings "good morning sweetheart 💘" and all the evenings "sleep well sweetheart, dream about me 💖"
He wants to take a cute and aesthetic pic of the both of you all the days. 
He bombards you with pictures of his cooking. It's cute, but also annoying because he can't help but send extra long texts. He describes every single action he did, along with recipes and tips. 
He enjoys seeing your outfit of the day. He can attempt to match his clothes to yours. 
Random "I love you 💖" and "if no one told you you were pretty today : you're the prettiest 🥰" 
He enjoys sending you cooking videos. "We should eat this tonight. What do you think? 🧑🏻‍🍳"
He's pretty good at sexting. He knows how to take aesthetic photo of his hands, back, or mouth. Not just an ugly dick pick (Kid, Zoro, I'm looking at you). And he also likes to leave you some message like.
I would sit you down on this table if you were with me right now. You know, the one in your kitchen where he had dinner with your parents yesterday? I would gently kiss your neck, fondle your chest, and slowly kneel between your legs until you shout my name. You would pull on my hair, begging me to keep going until you cum repeatedly on my face.  👅 "
And if you send him a nude, well, he's going to die from a nosebleed.
Rest in peace, Sanji. 
Tumblr media
Zoro
Your name/photos in his contacts : "y/n". You pick a picture for him because Zoro and phones are not compatible.
His wallpaper : a cool katana
What kind of pictures in his gallery : gym selfies, katanas and alcohol (all with ugly quality)
His fav emojis : 👍🏻 and 😴 Like:
"hey Zoro, you're alright" 👍🏻
"Zoro, wanna hang out?" 😴
"Babe, what are you doing?" 😴
"… am i annoying you?" 👍🏻
He can responds to absolutely anything with those two emojis. 
Zero is so oblivious, so let's be honest: he is not good at using phones. Almost every day, he forgets his phone at home. And even if he didn't forget about it, it's probably on silent mode or just off.
He doesn’t know how to use the keyboard, so prepare yourself for coded-message like "o!. @= sp⛑t t🧹day???/!df🆎e !!"He can't even use the excuse "my cat walked on my keyboard", he just sucks with technology.
Your messages are often "seen ✔️" and that's all. Not because he wants to be mean, just... he didn't understand the concept of answering every text. He takes all of your messages as random information. Like "Hey, I'd love to see you tonight!". Well. OK. Message understood. That's all.
The only application he has on his phone is Google Maps. Even with it, he still gets lost. "Turn left." Without a doubt, he turns right. 
Once, he tried to please you with a dick pic. But the photo was just terrible: bad luminosity, an ugly close-up of his cock, blurred as fuck, and you can see the dirty tissue behind him.
He doesn't answer when you call him because he's either asleep or at the gym (or drunk).
Once, he also tried to send you a voice message, but it was just the sound of the wind. He forgot to talk closer to the microphone.
Tumblr media
Sabo 
Your name/photos in his contacts : "my revolutionary 🎩💛". With a beautiful pic of your smiling face. 
His wallpaper : a symbol of revolution. 
What kind of pictures in his gallery : petition screenshots, his brothers, you, anti-capitalist memes and a private album with some hot pic of you (naughty Sabo)
His fav emojis : 🔥✨🖕🏻💛✊🏻😡😏😎🤩👉🏻👌🏻🫵🏻
Sabo is... complicate. Sometimes, he doesn't answer for WEEKS. And sometimes he's extra chatty. And when he's chatty well...
Sabo is always spamming you with petition links. "Save the dolphins", "save the monkeys", "fuck capitalism", "for the resignation of *insert random politician name*" 
"Hey sweetheart, manifestation tomorrow. See you there!! 🫵🏻" 
When it's not petitions, it's probably videos or articles. Sabo is a pure revolutionary. Be prepared to receive lengthy texts when he wants to fight for a cause. It's cute, honestly. He's really involved and passionate. 
"You, me, on a trip tomorrow?! 😏"
Sabo has a knack for surprising you with trips, so prepare yourself. This man craves adventure and surprises. He wants you to join his crazy journey. 
Sometimes, he's using proper grammar and punctuation, sometimes he's using a lot of !!!!!!!!??????? And caps lock. Especially when he's furious about something.  He makes a lot of typo errors because he's always in a rush while typing.
Let's fught  *figrt *fijkt *FUCK *LET'S FIGHT (and fuck)
He enjoys taking pictures of you unexpectedly because it makes you seem more natural. 
"So… sweetheart… we have a new roommate" with a cute pic of a dog/frog/duck/snail/whatever. Sabo has a kind heart. If he sees a wounded or abandoned animal, he feels obliged to adopt it.
And regarding spicy texts… 
Sabo is a kinky boy. So sure, he's thirsty when it comes to sexting/nudes. As a revolutionary, he is also very careful. He always asks you first before sending you nude or spicy texts. If you're willing, then prepare yourself.
A bunch of nudes. Since he's good with them, he won't display his dick in a weird and unattractive angle to you. He enjoys showing you his hands when he's wearing his gloves. Or a mirror photo of his back.
"I know you will scratch it when I'll fuck you tonight 😏"
You're not forced to send him nude or spicy texts back. He respects your boundaries without exception. And if you send him a photo anyway, he's also really nice. Always a comment like "your ass is soooooo good with this angle. I can't believe I'm that lucky 🥵" and if he wants to save a photo for his collection, he's always asking if it's okay with you.
"Sweetie, i have a new toy for you… 💛"
We all know what he's talking about. Naughty Sabo.
2K notes · View notes
wriothesleysgf · 6 months
Text
wonderland— wriothesley.
Tumblr media
★ : wriothesley is tired of your phone ringing. he's not going to let something like that stop him having fun.
cw : riding, teasing, exhibitionism, praise, m. m-sturb-tion, spit, fem reader.
Tumblr media
"fucking angelic," wriothesley growled, punctuating the phrase with a slap to your ass. the sound echoed around the room, combining with the grunts and groans emanating from the two colliding bodies.
you continued to ride him as best as you could, though the pace that he was attempting to set was becoming too much; the man was essentially using you like a toy at this point. what had begun as you slowly grinding on his thigh whilst he finished up some paperwork had lead to his thick cock kissing your cervix as he gripped your hips tight enough that the indents of his blunt nails were visible.
"is my pretty girl struggling? why don't i take—" he began, but was cut off by the sound of your phone ringing. he ignored it initially, letting it go to voicemail. the caller didn't leave a message, so certainly it couldn't be important, right?
wrong. after the third call, wriothesley grabbed your phone from his desk and checked the caller id. he turned the screen to face you, and before even a syllable could pass your lips he had hit the answer button. he put the phone to your ear, hinting for you to take it and answer the call.
"y- yes, monseiur neuvillette? is everything okay?" you spoke in the most professional voice that you could muster, given that wriothesley's cock was still nestled within you.
"stay quiet, princess. you don't want your boss knowing how you really spend your lunch breaks, do you?"
your raised eyebrows soon turned into a warning glare, as wriothesley picked you up from his lap and put you onto his desk. with your back flat against the hard wood, he took a moment to see exactly how messy he'd already made your sweet cunt. even just with one finger traced through your sensitive folds, and you were forced to bite your bottom lip.
"is everything okay? are you feeling unwell?" the iudex queried.
you had to use every last ounce of strength to maintain your composure. "i'm perfectly fine, it's just a little cold, that's all."
wriothesley's smirk gave you the urge to slap it off of his face. he knew precisely how to drive you crazy, and it worried you. whilst trying to maintain the conversation with your boss, he continued to tease you.
he bent down to place a kiss to your swollen clit, and the short whine that fell from your lips was almost certainly audible on the other end of this call. if he did notice, however, he didn't mention it. nor did he mention any noises you made from the subsequent kitten licks to the sensitive bud.
wriothesley was enjoying this a little too much. he decided to go all out, lining his cock up with your puffy cunt despite the wide eyes from you— it wasn't a plea not to do this, no, but rather a look of shock that he'd go so far. in fact, it was turning you on even more. the risk of being caught was exhilarating, and had your slick dripping onto the desk below you.
"oh, baby," wriothesley cooes as he slowly pushes into you. "always take me so well, 's like your cunt was made for me," he punctates the sentence by collecting a fat glob of saliva in his mouth and spitting directly onto your clit. the combination of such a lewd action with his praise filled words never failed to make you weak.
with a few more harsh thrusts into you, your phone lay forgotten about on the desk. your whimpers became more prominent, and from the look in your eyes you were bordering on overstimulation.
wriothesley removed his left glove with his teeth, throwing it aside before putting two fingers to your lips. he didn't gag you, instead slowly allowing you to suck on his digits as a way to stay quieter— how considerate. you swirled your tongue around his digits, your hands both on his wrist. soft pleas came out distorted, though from the way that your cunt intensely pulsed, wriothesley knew you were close to cumming.
"think you can stay quiet, princess?" he chuckles. you nodded sheepishly, and he removes his fingers from your mouth. "good girl."
however, that trademark smirk start to appear again.
instead of going easy on you, he immediately targets your pretty clit. a couple of taps followed by a few strokes had you writhing around. wriothesley tutted a few times, unimpressed. "he can probably hear you thrashing around on my desk, darling," he reminds you, nodding towards your phone. you assumed he'd hung up, though the quieted calls of your name made it clear that neuvillette was still on the line.
wriothesley moved you around a little, pushing your legs up into somewhat of a mating press. his goal was to keep you still enough that you couldn't shift out of his reach as your highs approached. your ankles were at his shoulders, his body pressed against your thighs. the hard, powerful thrusts continued, and you were a blubbering mess. the man took a moment to slap your tits, always finding the way that your flesh jiggled incredibly attractive. with a pinch of your stiff nipple for good measure, he returned to his attack on your swollen clit.
"go on, baby," wriothesley cooed. "you know you wanna cum for me, yeah? let me hear it, princess,"
there were tears in your eyes from the overstimulation. with his thick cock consistently grazing over all the spots that made your back arch and the gentle touches to your cunt, it didn't take too long before your nails dragged down wriothesley's back and your thighs to begin to shake. you babbled something incoherent again and before you knew it, your orgasm came crashing down on you. it triggered the man's own high, and he shot his load deep inside of you.
he leaned over you, allowing you both to be close to one another as you caught your breath. wriothesley mumbled gentle praises into your ear and carressed your cheek, wanting you to feel as safe and loved as ever.
what the two of you were unaware of, was the absolute bliss being experienced on the other end of the line too. if one were to listen closely, they would hear the esteemed iudex's heavy pants.
3K notes · View notes
heich0e · 6 months
Text
just saw talk of boxer au!gojo on twitter and i fear now i'm thinking about satoru—undefeated in his weight class, a sensation in the sport—gearing up for a fight against a fighter from the underground scene, ryomen sukuna, who's known to have seedy connections and to not fight fair. his opponents often end up hospitalized, or mysteriously retiring after his matches—and there are rumours that some meet even more sinister fates.
and you show up at gojo's training gym one night, long after the rest of his team has gone home and find him in the practice ring just laying on his back, his mitts tucked under his head like a pillow, asleep and totally at peace. you hesitate, not sure if you should disturb him, but eventually climb up onto the elevated platform of the ring. you slip through the ropes like you have a hundred—maybe a thousand—times before, and approach him quietly as not to wake him.
he strikes when you're within arm's reach, moving faster than you could ever hope to dodge even if you did anticipate it, and before you know it you're toppling down on top of him as he uses his body to break your fall—two strong arms cradling you to his bare chest.
"you weren't sleeping," you grumble into his neck sullenly, and you feel his chest lift with a laugh. "you tricked me."
"had to, otherwise you might've tried to run away." his hands pat down along your spine, then up over your shoulder blades, holding you tight. "couldn't risk that when you haven't been answering any of my calls."
he lets you pull away but only barely—just enough room to use his chest to push yourself up and look at him, but his hands on your hips keep you pinned in place where you straddle him. when you look down at him, at his pretty face and his bright eyes and the soft smile he always shows you, you feel like you might start crying again—just like the last time you were in this very gym a week prior. the gym whose route you could walk in your sleep, whose walls you have memorized with his name and trophies displayed proudly everywhere you look. Gojo. Gojo. Gojo. the same way the crowds at his fights chant for him and his triumph.
gojo—a name as familiar to you as it is foreign. it's his, but it's not. because the boy below you, staring up at you with that same lovesick expression you've never seen waver, will never be anything to you but satoru. means everything to you as satoru.
"it's not too late," you whisper, reaching up with a shaking hand and running your fingertips along the blush that sits high on his cheeks. "you can still call off the fight, there's still time."
satoru's expression shifts for a moment, so brief you may have missed it if you didn't know him so well. there's a flash of something behind his eyes that reads unmistakably like guilt. he dons a facade of petulance to mask it, his lip pursing in an exaggerated pout.
"i can't believe my own good luck charm doesn't think i can win against some loser," he whines, turning his face and nosing against the palm that was cupping his cheek.
it's not true. you believe in satoru unwaveringly, you know his skill and his abilities. your faith in him is, and always has been, implicit. it's his opponent you don't trust.
it's what the fight might cost him, regardless of the outcome, that terrifies you.
"hey."
your eyes focus again, and you meet satoru's gaze below you. he lifts his hand, cupping yours—so much smaller in comparison—underneath as he holds your touch against his face, pressing a kiss to your palm.
it's so impossibly still in the gym with everyone else gone, but everything about it is known to you. is wholly familiar. the dim fluorescents, the smell that lingers in the air, the hum of the fans, the sound of satoru's breath.
"stop worrying, okay?" he whispers against your skin, kissing your palm again to punctuate the request. "there's no way i'm gonna lose. i'm the strongest, after all."
and there's familiarity in those words too, since he's said them to you more times than you could ever hope to keep track of.
but this time they just don't seem to reassure you the same way.
1K notes · View notes
spiritofjustice · 1 year
Text
you could easily analyze Dororo through the lens of disability if you were someone who understands that more than me but the one thing i do understand is the way the narrative treats Hyakki after the halfway point really does feel like ableism. it’s just episode after episode of everyone around Hyakkimaru suddenly deciding he doesn’t need what he needs to survive, he’s fine exactly as he is and should be completely fine being disabled and he shouldn’t go after anything that will help his disability, and that he’s a bad person for advocating for himself and his body. meanwhile, in the early episodes, it feels like characters are constantly complaining about his disabilities, mainly his deaf and muteness.
the second half isjust him being surrounded by abled people (and also even another disabled dude) telling him he’s evil for fighting for a better body than what he has, a body he needs, a body that will give him the experiences he desires but has never had because of how little he was born with. there is literally an episode where Hyakkimaru’s adopted dad refuses to replace his broken prosthetic leg because he decides Hyakki will use it to continue fighting for his body. he destroys a prosthetic leg so Hyakki can’t use it. Hyakki has a way to fix his disabilities and the narrative stops at nothing to punish him for that. what even, dude
0 notes