#it's being blasted to ALL users | Explore Tumblr Posts and Blogs

theemporium · 10 days

Text

[1.7k] they want to believe jack when he says he has a girlfriend. they really do. it's just kind of hard to do so when they never see her. or, in which everyone is worried jack has found himself in a parasocial relationship.

“Fuck.”

Jack raised his head, finding his attention drawn to his captain sitting on the aisle across from him on the bus. He watched as the man began patting himself down before he let out a sigh, standing up to reach for his bag on the overhead shelf. Yet, whatever he was trying to find was a fruitless endeavour as he settled back in his seat with a frown on his face.

“You good?”

“Hm,” Nico hummed, letting out another long breath as he leaned back in his seat. “Yeah, I just forgot my headphones.”

“Nico Hischier not being organised?” Jack teased, a smile growing on his face. “Someone alert the authorities.”

Nico huffed out a laugh. “Ha. Ha. Ha.”

“Just messin’ with you, cap,” Jack mused, deciding to be the better person and not point out the fact he could see Nico’s dimple even if the boy tried to act like he wasn’t laughing. “Here, I’ll share my music with you. Because I’m nice like that.”

The older boy raised his brows. “Your music for the full five hour drive?”

Jack raised his brows in return. “Do you have anything else better to do?”

“Fair enough,” Nico murmured before he reached over, taking the airpod and slipping it into his ear. “But I get to add some songs too.”

“Yeah, yeah,” Jack waved him off before handing over his phone. “Maybe try more English rap songs so I can understand them too, yeah?”

“Sure, because I’m nice like that,” Nico said with a grin before he turned to shift his attention to Jack’s phone. He clicked on the queue, his brows furrowing slightly when he saw the songs lined up. “Huh.”

“What?”

“Nothing,” Nico murmured. “I just thought you were a country music kind of guy. Never thought you’d be into the rock scene.”

Jack’s cheeks burned as he let out a slightly strained laugh. “I was, uh, broadening my horizons.”

Nico turned to look at him. “So you chose one band? You know, I know a couple of bands if you want them—”

“I’m fine with that band,” Jack said, flashing his captain a smile.

“You’ve liked every one of their songs.”

“Mhm.”

“So, you know you like the genre, at least. Maybe you should try—”

“I’m good.”

“Jack—”

“Start queuing songs before I take my phone back, Hisch.”

Nico stared at him for a few moments, noting the way he fidgeted in his seat with his cheeks flushed far brighter than they should be with the bus AC blasting. But, Nico decided he would be nice this time around and not bring it up.

Not yet, at least.

Plus the band Jack had chosen was pretty good, if he did say so himself.

...

liked by jackhughes and 837,278 others

yourusername ready to rock north america❤️🖤

view all 13,738 comments

user i am going to the nashville show!!!

user she is THE moment

user omg i can't believe the tour has already started

user BKEWBFJBWEKFBKWEJBF

jackhughes congrats on the tour!! ur gonna kill it!!❤️‍🔥

user JACK HUGHES????

user who the fuck is jack hughes?

...

“What are you giggling at?”

“I’m not giggling at anything.”

Luke narrowed his eyes. “You literally giggled as you said that.”

“Don’t know what you’re talking about.”

Unfortunately for Luke, this had been a recurring conversation over the last few weeks because, despite what he said, Jack spent the better part of his free time giggling at his phone. It was sickening and annoying and Luke was so done with trying to scroll through TikTok with his brother snickering like some teenage girl in the background.

It was starting to grate on his last nerve.

“You’re so full of shit,” Luke grumbled as he shoved a spoonful of cereal into his mouth, narrowing his eyes on his big brother from over the kitchen counter.

“Maybe you should find someone to text and stop bothering me,” Jack retorted, the words slipping past his lips so casually, almost like he hadn’t realised what he said.

But Luke heard loud and clear.

He straightened up in his seat, his annoyance now replaced with curiosity and he flashed his brother an inquisitive look. “Who are you messaging that has you giggling?”

“I am not giggling,” Jack huffed out before he lifted his head, finally looking away from his phone screen to catch his brother’s gaze. “And, for your information, I am texting my girlfriend.”

A few moments of silence passed as both boys stared at each other.

Luke blinked. “When the fuck did you get a girlfriend?”

“It’s new,” Jack said with a casual shrug of his shoulders.

Luke’s eyes narrowed. “How new?”

“Just a couple of months or so,” Jack murmured, at least having the guts to look a little sheepish as a light blush spread across his cheeks.

“Months?!” Luke repeated with a scoff, the bowl of cereal he was snacking on now long forgotten. “How come this is the first time I’m hearing of it?”

“We are keeping things private!” Jack defended.

“I’m your brother!” Luke retorted. “You’re meant to tell me shit. I’d tell you if I had a girlfriend! Quinn would tell me if he had a girlfriend!”

“But neither of you do,” he snapped back with a shit-eating grin.

“And you supposedly do,” Luke muttered, shaking his head. “What’s her name?”

“That’s not important.”

Luke blinked. “Uh, yeah, dude, I think it is.”

Jack shrugged again. “Maybe I don’t want you to know.”

“Why not?” Luke questioned, watching his brother just shrug again—not that he was getting fucking sick of that or anything—before he glared. “Is it someone I know?”

“Maybe.”

“You’re being ridiculously vague right now and it’s annoying as fuck,” Luke told him.

Jack’s grin widened. “I know!”

“Fine, keep your stupid secrets,” Luke grumbled as he reached for his spoon again, rolling his eyes when he heard Jack laughing. “Like I fucking care anyways.”

But he did.

He really fucking did and he would find out who this secret girlfriend was if it’s the last thing he did.

...

liked by jackhughes and 213,839 others

yourusername las vegas, you ALWAYS make me feel at home❤️🖤

view 12,930 comments

user MOTHER!!!

user hot AND talented. your fav could never

user new music when!!!

user THE SHIRT-

jackhughes ur so pretty😍😍😍

user not this guy again

user not a man

notzegrasipromise JACK???

...

“Yeah, I mean, I love my parents but I wish my girlfriend could’ve made it out. It would have been nice to have her here for the family skate too.”

That was all it took for the hustling and bustling of the locker room to come to a screeching halt.

Jack frowned, his hands holding his jersey in his hand that he had just taken off as he glanced around the room. All of the boys were giving him different looks: some concerned, some amused, some confused. It was throwing him off.

“Uh, what?”

“You have a girlfriend?” It was Dawson who eventually asked, his brows furrowed together in questioning.

“Yeah,” Jack nodded, feeling an odd sense of deja vu from the conversation he had with Luke a few weeks ago. “Geez, I didn’t realise we had to announce stuff like this now.��

“I mean,” Jesper spoke up, shrugging his shoulders. “We’re close, yeah? We usually just tell each other these things. You’ve never mentioned her before.”

“Don’t bother asking for her name,” Luke grumbled from the other side of the locker room.

“She’s not coming to the family skate?” Nico questioned, focusing the attention back to Jack who simply shrugged.

“She travels a bunch for work,” Jack explained. “Or, at least, for right now. She’s out in Nashville right now so she couldn’t make it.”

“But I thought you were all over that rockstar girl,” Simon spoke up from his stall, leaning back against the cubby, half dressed and legs spread. “Every time I open Twitter, I see it.”

Jack’s cheeks burned.

Jesper gave him a disapproving look. “Don’t tell me you’ve been commenting on another girl’s instagram when you have a girlfriend. What does she think about it?”

“She likes them!” Jack defended.

Jesper frowned. “I find that hard to believe.”

“Yeah, you’re kind of desperate on instagram,” Simon continued with a snort.

“Well, she hasn’t told me to stop,” Jack huffed.

“Yes, because a rockstar with a couple of million followers would personally reach out to stop you,” Luke drawled, a heavy layer of sarcasm dripping from his words.

“She would, considering she is my girlfriend.”

Once again, the locker room fell silent.

“You’re fucking shitting me,” Luke eventually spoke up, shaking his head. “You really think we believe that you pulled her?”

Jack frowned. “What’s so hard to believe about that?”

“She’s an international rockstar and you’re just a dude who plays hockey,” Luke retorted.

“So are you!”

“Yeah, and I’m not sitting here trying to tell people I’m dating Taylor Swift, am I?”

“This is different,” Jack huffed before looking around the room. “I’m dating her! I really am! We met at that rock bar in Jersey City a couple of months ago and we’ve been chatting ever since.”

The boys all gave each other various looks.

“Fine, don’t believe,” Jack grumbled as he leaned down to start untying his skates. “I know I’m telling the truth. It’s not my fault you don’t believe me.”

For the record, only Jim and Ellen Hughes showed up to the New Jersey Devils’ family skate.

...

liked by jackhughes and 362,373 others

yourusername east coast, we are coming for you!!❤️🖤

view all 14,737 comments

user i cannot believe the tour is almost over

user NEW MUSIC WHEN

user i'm seeing you in eight days!!!!

user oh my god she is so hot

jackhughes coming back to the better coast❤️🖤

user omg he is copying the hearts too

user he is delusional

user it is the devils colours

user you sound just as delusional as him

...

“So, I’ve been talking to Luke.”

“Oh great,” Jack grumbled as he sunk further into the pillows of the living room couch.

“And I went on Twitter.”

“You must have been pretty bored to redownload it,” Jack commented, suddenly finding interest in the strings of his hoodie, instead of his brother’s face on the phone screen. He should have known it was odd when Quinn messaged to check he was home alone before he called.

“Jack.”

“Don’t look at me like that,” Jack whined as he tried to hide himself deeper into his hoodie. “Whatever Luke told you is bullshit.”

“So you’re not telling people you’re dating an international rock sensation?”

“Well, I’m not telling everyone,” Jack corrected. “But I am dating her!”

“Uh huh.”

“Not you too,” Jack groaned, throwing his head back and finding his gaze locked on some random part of the ceiling. “Quinn, why would I lie about this?”

“Because you took a rough hit to the head.”

His head quickly snapped down to glare at his older brother who had the audacity to smirk in response.

“We’re just worried, Jack. You don’t mention a single thing about talking to her. Then you’re showing up in her comments. And then you’re claiming to date her. All whilst playing and training like normal.”

Jack rolled his eyes.

“It’s fine if you have a little crush or something but—”

“She isn’t just a crush, she’s my girlfriend,” Jack repeated for the umpteenth time. “You’ll see soon.”

Quinn didn’t look awfully convinced but he knew better than to push Jack on the matter any further. He instead shifted the conversation to a power play from the game before and, thankfully, Jack took the bait. In fact, he was far too busy rambling to even notice Quinn typing out a message straight to Luke.

quinnifer: ur right

quinnifer: he’s a fucking lost cause

...

liked by jackhughes and 983,373 others

yourusername tour was a dream but happy to finally come home to you jackhughes ❤️🖤

view all 37,373 comments

jackhughes glad to have my girl home❤️🖤

user WHAT

user a hard launch post tour??? oh she is sick

user i can't believe we lost her to a man

user IS THIS NOT THE HOCKEY DUDE

user omg he actually stood a chance

trevorzegras WHAT THE FUCK

trevorzegras WHAT THE ACTUAL FUCK

user omg one sings rock and the other plays at the rock

user IT WAS WRITTEN IN THE STARS

lhughes_06 holy shit

_quinnhughes didn't see that one coming

trevorzegras HOW WHAT WHEN WHERE WHY

user i think hockey dude broke his hockey friend

jackhughes he will be fine

trevorzegras NO HE WILL NOT BE FINE

trevorzegras ANSWER YOUR PHONE ROWDY

jackhughes leave me alone, i'm trying to spend time with my girlfriend

yourusername it's true :) very little clothes included

trevorzegras i'm going to go throw myself off a cliff

user what the fuck did i just wake up to

#jack hughes #nhl #new jersey devils #jack hughes x reader #jack hughes x you #jack hughes x y/n #jack hughes fic #jack hughes one shot #nhl x reader #nhl x you #nhl x y/n #nhl fic #nhl one shot

895 notes · View notes

hellsitegenetics · 2 months

Text

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

#hellsitegenetics #faq #intro post #flowers #plants #requests #birds of paradise #asks #remember to keep checking back!

1K notes · View notes

i-drop-level-one-loot · 8 months

Text

Smile❤️ (Yandere X Loser!Reader)

Micky thought that he couldn't feel love.

Ever since he could remember, Micky couldn't connect with anyone on an emotional level. Even his own family members were like aliens to him, creatures that stretched their lips into strange contortions, ETs that became unreasonable when he wouldn't do the same. As a teenager many girls flirted with him in school, hell, a few guys did as well, but none of their confessions ever stirred any emotion from him, even at the height of his puberty. The smiles of the people around him never felt warm or welcoming. Just, tight. Cheeks pulled back, revealing teeth, expecting him to mirror their action, and Micky couldn't understand why.

Nothing made him smile.

College was further isolating. Group projects seemed to no longer be a thing, (at least in the classes he took) so his interactions with humans slowly became less frequent, making his classmates look more inhuman and monstrous.

Until someone in his college was doxxed for being a creep. It was interesting, watching how quickly people turned on their friend, forcing him into an outcast because someone online revealed his private post history.

An annoying young woman in his language arts class gathered people around Micky's seat to talk about what had happened. Micky wouldn't have searched up the drama on his own time, but he didn't see the point in pushing everyone away.

"This user on Xforums, anonymousXnightmare is the one who doxxed Nathan."

AnonymousXnightmare? How fucking lame.

"That's a lame username..."

"Maybe it's a kid..?"

Micky did his best to ignore them, but the username kept popping up in conversation throughout campus. It was getting a little annoying. Some people were mocking the name, while others were praising the "internet hero". It started interfering with his ability to focus in his classes.

But the gossip cooled down after a week, and life began to run as normal, until another student had their life ruined. A football player, they didn't post anything incriminating or disturbing. It was anonymousXnightmare who posted their own collected evidence. Pictures taken from afar of the player with his highschool sweetheart, as in sweetheart who was still in highschool. Recordings of the two of them. Months of stalking all compiled by the stranger.

Again, Micky was bombarded by chatter, excitable young adults losing their minds over the situation. It was... irritating.

Back in his dorm room, Micky was scrolling through Xforums, the most popular forum used by students in his university, made by students for students, searching for the loser with the lame username. Scrolling past the photos he had heard about, he found a post stating

"Dear Allen Brackens, if you cannot stop blasting your shitty music in the halls on your shitty speakers, I WILL ruin your life!"

and Micky had to lean back, to just take in what he had read. That must have been the name of the football player. What he was doing was genuinely gross, and should have been exposed by someone. But did this poster really stalk them for what looked like months just because he listened to music they didn't like?

It was so dumb.

He scrolled down farther into the mystery poster's history, to the first man they doxxed.

"Dear Nathan McAllister, we all know you're a two faced little bitch. Either stop littering the campus with your Jesus pamphlets, or else..."

Micky, for the first time in his life, was amused. The whole situation was so stupid. They really ruined their fellow students lives, just because they annoyed them?

He made an account just to follow his mystery poster, not sure yet why he was interested to see what they would post next.

Less than two days later, and Micky's phone notified him of another post.

"Dear Samantha Rudbeckia, your obnoxious laughter is driving me insane. Can't you see how annoying you are? Knock it off."

That was it?! That was enough to set you off? Laughter? Micky paused mid step, still staring down at his phone. Something felt off about his face. It hurt.

It was pretty easy to find anonymousXnightmare in his school. Micky picked up a map of the university, and mapped out the paths of the three people targeted. They ran into a lot of different students throughout their day. But they only ran into a couple of people who openly seemed to hate them, and only one of those people was a student named (Reader). (Reader), who constantly appeared as though they would collapse at any moment, the hollows under their eyes so dark they looked sickly. (Reader), who despite being borderline anemic, was very sneaky, and very good and being unnoticeable despite their extreme appearance. Unfortunately for them, they had someone watching them as closely as they watched their victims bullies. Micky watched as they stealthily snapped photos of students from around corners, how they seemed to blend into the background and nobody noticed them hiding in waiting.

Micky felt ashamed for ever thinking you were lame. You were.. cute.

The way you crouched like a bug, hunched over like a roly poly scared of being picked up. The way you bit your dry lips in anger to the point they bled.

Micky's face hurt more and more. Every time he saw (Reader) a pain he had never felt before would strain at his cheeks, and his face would feel hot all over. It wasn't until he caught a glimpse of himself in his reflection in a window that Micky realized he was smiling. He never knew that smiling hurt. But he couldn't stop it.

Pictures and videos of Samantha and her married professor were posted online, and Micky was excited to know what (Reader's) face would look like when they reaped the fruits of their labor. But when he snuck into their classroom, zooming in on their exhausted face with his phone's camera, he felt a new emotion seeing that (Reader) was just as annoyed as they always were. A hard pit fell from his ribs into his lower stomach. He was disappointed.

Why aren't you happy? You won. You should be rejoicing right now.

He felt conflicted and confused. Like an octopus was throwing a tantrum in his abdomen, squirming uncomfortably. And it ruined his day. Micky couldn't focus on any of his classes, and the rest of his day was like a foggy dream. What was it about (Reader) that attracted him to them so much?

A cute young woman with smooth black hair approached Micky, a dark blush complimenting her picture perfect face.

"Um, excuse me? Excuse me? Excuse me?"

Micky snapped out of his thoughts, turning his gaze down towards the beautiful person. Her rosey lips were slightly upturned in a posed way.

She's smiling.

Micky internally verbalized it. The same way he did whenever he saw anyone smiling. It never looked good. Smiling was so awkward, and strange. People loved seeing others smiling, and smiled when they were happy, but it always reminded Micky of how not one of them he was.

"Hi! My name is Maggie."

I don't care.

"We have econ together?"

"Okay."

Why was seeing her smile make her look fake, inhuman, alien? Just like everyone else. Then why was Micky so let down seeing (Reader's) lukewarm reaction to their victory?

"I was wondering, I mean, (laughs), a group of us are going out for drinks later, and we, I was wondering if you wanted to come with us.."

She giggled nervously, fiddling her fingers and biting her lip. The image of (Reader) practically eating their lower lip was triggered like a trap. This woman, whose name wasn't worth remembering, made Micky feel nothing. The uncanny feeling of speaking with a living mannequin or an advanced AI. Her movements weren't natural, her smile was just a contraction of muscles. Then, like an epiphany, Micky realized all at once what made (Reader) so special.

Maybe, it wasn't that everyone else was alien, but Micky. Micky was the only one who never fit in. The only one who didn't feel emotions or connect with others like everyone else could. And there was a bug walking around in human clothes, barely staying awake in class and casually ruining peoples' lives simply because they annoyed them. (Reader) wasn't a human either, just like Micky. That's why they didn't seem happy with their victory. Why would a human bring them joy?

Micky's lips pulled tight, smiling brightly at the young woman before walking away without saying a word.

You're the first person to make me feel, because you're just like me. Right, (Reader)? If no one but you can make me feel, then no one but me should be able to make you smile!

:::::::::::::::::::::::::

(Reader) slouched over their laptop, their messy hair pulled back in a top bun just to keep their untrimmed bangs out of their eyes in the privacy of their dorm, eating another cup of noodle while reading all of their "fan mail". Samantha wasn't getting kicked out like they had hoped, but Professor what's-his-nuts did get canned, so hopefully when Samantha comes back to class she'll be too busy sobbing "woe is me" to find anything funny.

Ba-ding♪

A private message popped up from an account with an automated username.

(Reader) snorted so hard a noodle went up into their sinuses.

user01793664544001: I know who you are <3

"Ah-ow! God damn!"

anonymousXnightmare: Who the fuck is this?

user01793664544001: ur prince charming <3

anonymousXnightmare: Don't fuck with me

user01793664544001: come find me

"Watch me, bitch."

Looking up IP addresses is a lot easier than people make it seem. It doesn't take a genius hacker to doxx someone. Of course, (Reader) goes above and beyond, often following assholes for months to collect evidence of their douche baggery. (Reader) got an address in less time than it took to finish their noodles, and took down their hair, quickly setting out to start getting information on their newest "bully".

The address took them to another dorm across campus. How dumb are they? (Reader) faux chuckled, feeling superior to this newest dick. No one was quite as smart as them.

As they crept through the building, no one payed them any attention as they began taking notes on the residents. It had to be one of these losers.

They didn't have a chance to fight back, as they passed one of the rooms the door opened and pulled them inside faster than they had a chance to scream. The man who abducted (Reader) wrestled them to the floor, panting heavily.

(Reader) glared up at the handsome stranger, smiling down at them in a creepy way, his cheeks twitching like he had never smiled before, like his face hurt from the small action. His face was pink and he was sweating, panting with a feverish moisture glazing his eyes.

"Aren't you happy? You found me~"

"G-Get off of me, you pervert!" (Reader) attempted to kick the kidnapper off of them.

This wasn't the answer he was looking for. His smile fell briefly before bouncing back.

"You're just upset because you don't know me yet. Don't worry, it took me a while to realize you and I were the same species as well, so don't worry. I'll wait, I'll wait for you to realize you love me too..."

He rambled quickly, pressing harder against (Reader's) body. A strange noise squeaked out of his throat as he seemed startled, (Reader) feeling a bulge form against their upper thigh.

"Ah, I'll wait.. I'll wait for you to love me too.. but I need you to do something for me while I wait.."

Micky stuck his fingers in (Reader's) mouth, pulling their dry lips out till they bled across his skin.

"Smile for me..."

#yandere x reader #yandere oc #yandere x darling #yandere #pathetic loser #loser reader #tw stalking #bully reader #yandere fanfiction #gender neutral reader #romance #not proofread

1K notes · View notes

amaranthineghost · 4 months

Text

| MATCHING PAJAMA PANTS AND LATE NIGHTS ( lando norris. ) |

ꕥ pairing: lando x reader

ꕥ summary: how lando spends the holiday season with his girlfriend.

ꕥ authors note: didn't know what type of christmas imagine to write tor lando so I just decided to do this <3 also I'm impatiently waiting for the mini vegas helmet of his I ordered (I'm just a teenage girl <3)

ꕥ warnings: suggestive words

THE HOLIDAYS WITH LANDO NORRIS consisted of a few must-do things. ever since he started dating her, there were things he had to do with every celebration, christmas being no exception.

MATCHING PAJAMAS AND LATE NIGHTS ON SNOWY ROADS

a good portion of the season was spent in the warmth of his mclaren, driving through snowstorms with the heat blasting and whatever music their hearts desired. they'd yell the lyrics at the top of their lungs, breaking into laughter with every voice crack and anytime they'd forget a word. lying on the hood of his car to stargaze on the outskirts of the city where light pollution hadn't yet touched the sky. all in their matching pajama pants.

if he didn't have as much money as he did, he'd surely have spent it all on matching sets for the two of them to wear all throughout the holiday season.

he adored the matching sets they wore together, smiles gracing his face as he stared at her lovingly as she wore the patterned pajamas he'd picked out. there was something so heart-warming to see her wearing the same thing he did.

he loved laying around the house in each other's presence, words unspoken would be exchanged through actions such as simply lifting the sherpa blanket one was under to invite the other into the comfort of their warmth, wrapping themselves in each other's arms or slipping into the same hoodie as she laid on his chest. they'd lay on their couch by the apartment window, watching the snow fall through the spot on the window they wiped with their hands.

decorating the christmas tree with ornaments passed down from generations, telling fond stories with each trinket and heirloom in their possession. it inevitably brought them closer to share such a peace of life and tradition with each other that they'd honor closely. he'd tell her stories of his childhood where he'd place various decorations on the tree, watching her inspect them in her hands. they'd been passed down from his parents to him to share with his love, though they'd visit his parents for a portion of the holidays.

ynusername

liked by landonorris and 32,283 others

ynusername I love the winter weather because I've got my love to keep me warm

view all 1,929 comments

oscarpiastri made me third wheel, but didn't even tag me.

ynusername we kind of forgot you were there

oscarpiastri yeah. I know.

user not them forgetting about poor oscar in the backseat 😭

landonorris he's fine

SKIING AND SNOWBALL FIGHTS

trips to various snowy countries and vast mountains were inevitable, despite lando traveling quite often for his career. he'd love ski trips before and even more so with her involved. he'd help her gear up, teaching her the way to do it without falling on her face so she'd be able to keep up with him. starting out, he'd rush to her every fall, cooing at even the slightest bruise forming, kissing it with his cold lips. but as she improved, she could find him bent over laughing, hand on his stomach before he'd trek his way to give her a helping hand.

late nights after skiing turned to snowball fights in the dark between the group that shared the cabin. lando often brushed off his girlfriend's attempts to give him a jacket, claiming he'd be fine. he'd end up getting sick and she'd be the one to take care of him.

landonorris

liked by ynusername and 502,827 others

landonorris ouch ☹️

view all 5,102 comments

ynusername I won the snowball fight

landonorris you only won because you nearly gave me a concussion

oscarpiastri she nearly did us a favour there

user why does lando never wear a coat 😭

ynusername I've been asking the same thing

user bro is just built different

lilymhe why is yn on the ground ?

landonorris I tackled her 😊

user BBYE NOR PQNDO ADMITTINT HE TAKXLED HIS GITRIENR 💀

ynusername the spelling goes crazy

BAKING AND BOARD GAMES

double dates were a frequent go-to thing between the couple and their friends, alex and lily. it was a good time for the couples to hang out and catch up from the chaos from the season. mostly organized by their girlfriends who simply wanted to spend more time together, and the boys being dragged along, mostly alex. lando was the one who had clung to his girlfriends arm, begging him to let her go, and it was only fair to make alex go with too.

they'd frequent christmas markets, with lando spending an unnecessary amount of money on anything his girlfriend pleased because he loved to spoil her, despite the comments of others saying she was using him for it. he'd gladly let her though.

they'd walk with mugs of hot chocolate steaming out of the cup with whipped cream and peppermint sticks. she'd laugh at her boyfriend for the whipped cream on his upper lip, lily joining in when alex had gotten the same style of white mustache. she'd withhold the napkins from his grasp, enjoying the sight before her as lando tried to reach around her back where she'd hide them in her palm. he'd gotten so close to her face, he'd smudge the cream across her lips too.

"that's what you get!" he'd exclaim to her before laughing it off and wiping away the remnants that smeared across her face with the swipe of his thumb. he'd suck off the sweet, watching how her eyes dilated and her throat move as she gulped.

he leaned in close to her ear, whispering to her so the other couple wouldn't hear, "I bet you'd taste sweeter." he'd pull away to watch her face malfunction, as she'd open her mouth but words failed to form as her face became red and flush. she'd end up just shoving him by the shoulder, pushing the napkins into his hands.

landonorris

liked by ynusername, alexalbon, and 628,910 others

landonorris she does NOT mess around when it comes to monopoly

tagged—ynusername, alexalbon, and lilymhe

view all 3,820 comments

user STOP THE DOUBLE DATE

user I know right 😭😭😭 I'm so painfully single

alexalbon yn is on board game ban

ynusername ☹️

alexalbon you bit me

ynusername I'm just a teenage girl

alexalbon you're 22

ynusername don't remind me

user not alex and yn bickering like siblings 😭😭😭

user right?! like the duo we never knew we needed

ynusername he's too ugly to be my brother

alexalbon you'd be adopted.

ynusername 😧

user no one asking what they even made like I wanna know

oscarpiastri something burnt probably

landonorris you weren't even there though

ynusername it was definitely burnt though and all lan's fault.

user yn calling him lan 🥺

ICE SKATING AND CANDLE-LIT READS

rinks set up around london would be occupied by the group of couples who'd find themselves falling over laughing as they tripped over the ice. they'd fail to keep their balance as they skated around the ice. he'd be bent over tying her skates as she watched from over his shoulder, carmen and george and alex and lily as the couples gripped each other for dear life. she'd break out into a toothy smile, exciting looking back at her boyfriend as he'd finish lacing her skates, watching her breath exhale from her nose, the pink across her face from the chilling cold.

she'd stumble on her feet at the unfamiliar feeling of walking across the ground to the gate that'd lead then onto the ice, taking the intial step with her boyfriend not far behind. his gloves hands firmly placed on her hips, making her stomach flutter even though she'd felt his hands on her numerous times before.

they'd fall countless times, racking up the number of bruises on their body that lando would later kiss it better as she laid in bed. candles lit as the only light in the room as she read. she knew it was bad for the eyes, but it was a one time thing—not.

he'd lift the cloth that covered her body, kissing every mark that ruined her even skin, which proved to be majorly distracting to her reading—his plan all along as she'd engross herself between the pages of whatever novel she'd held. moving his warm breath across her skin, from her arms to her waist and hips to the sides of her thighs where her breathing got particularly shallow. he'd groan when she tried to push him away, though he knew not in disinterest.

ynusername

liked by landonorris, lilymhe, and 71,927 others

ynusername

view all 2,928 comments

user THE SNOOPY SHEETS

user id like to think lando sleeps peacefully in her girly bed.

ynusername he does

landonorris I can't believe you just told them that

ynusername I'd post the proof

landonorris YOU HAVE PROOF?

lilymhe post it

ynusername for my queen, yes

landonorris NO

user YN BLACKMAILING LANDO IS CRAZY

user I aspire to be like them

they'd end up at his family's house for the rest of the christmas holidays, spending times in front of the fireplace with boards games at their feet—shed play over lando's shoulder despite being on ban.

eventually she'd shove him from his place and take over—he just couldn't do it like her.

"what the hell?"

"lan, you suck, just let me play!"

"you're banned from playing!"

"ok and?"

758 notes · View notes

machine-saint · 8 months

Text

the op of that "you should restart your computer every few days" post blocked me so i'm going to perform the full hater move of writing my own post to explain why he's wrong

why should you listen to me: took operating system design and a "how to go from transistors to a pipelined CPU" class in college, i have several servers (one physical, four virtual) that i maintain, i use nixos which is the linux distribution for people who are even bigger fucking nerds about computers than the typical linux user. i also ran this past the other people i know that are similarly tech competent and they also agreed OP is wrong (haven't run this post by them but nothing i say here is controversial).

anyway the tl;dr here is:

you don't need to shut down or restart your computer unless something is wrong or you need to install updates

i think this misconception that restarting is necessary comes from the fact that restarting often fixes problems, and so people think that the problems are because of the not restarting. this is, generally, not true. in most cases there's some specific program (or part of the operating system) that's gotten into a bad state, and restarting that one program would fix it. but restarting is easier since you don't have to identify specifically what's gone wrong. the most common problem i can think of that wouldn't fall under this category is your graphics card drivers fucking up; that's not something you can easily reinitialize without restarting the entire OS.

this isn't saying that restarting is a bad step; if you don't want to bother trying to figure out the problem, it's not a bad first go. personally, if something goes wrong i like to try to solve it without a restart, but i also know way, way more about computers than most people.

as more evidence to point to this, i would point out that servers are typically not restarted unless there's a specific need. this is not because they run special operating systems or have special parts; people can and do run servers using commodity consumer hardware, and while linux is much more common in the server world, it doesn't have any special features to make it more capable of long operation. my server with the longest uptime is 9 months, and i'd have one with even more uptime than that if i hadn't fucked it up so bad two months ago i had to restore from a full disk backup. the laptop i'm typing this on has about a month of uptime (including time spent in sleep mode). i've had servers with uptimes measuring in years.

there's also a lot of people that think that the parts being at an elevated temperature just from running is harmful. this is also, in general, not true. i'd be worried about running it at 100% full blast CPU/GPU for months on end, but nobody reading this post is doing that.

the other reason i see a lot is energy use. the typical energy use of a computer not doing anything is like... 20-30 watts. this is about two or three lightbulbs worth. that's not nothing, but it's not a lot to be concerned over. in terms of monetary cost, that's maybe $10 on your power bill. if it's in sleep mode it's even less, and if it's in full-blown hibernation mode it's literally zero.

there are also people in the replies to that post giving reasons. all of them are false.

temporary files generally don't use enough disk space to be worth worrying about

programs that leak memory return it all to the OS when they're closed, so it's enough to just close the program itself. and the OS generally doesn't leak memory.

'clearing your RAM' is not a thing you need to do. neither is resetting your registry values.

your computer can absolutely use disk space from deleted files without a restart. i've taken a server that was almost completely full, deleted a bunch of unnecessary files, and it continued fine without a restart.

#i just had to get this out of my mind

1K notes · View notes

mysterious-ocarina · 11 months

Text

Shinunoga E-Wa (NSFW)

Toge Inumaki x Female!reader

A/N i definetly headcanon that Inumaki listens to Fujii Kaze on blast!! also look at him, he's so pretty ughhhhhh

Main Masterlist JJK Masterlist Requests AO3

(3.6k words)

“Come on, it’s so obvious y/n,” Yuuta sighs.

“I don’t know what you’re referring to,” you reply defiantly.

About a week ago, Inumaki left for a solo mission. Since then, you have been bothering Yuuta to entertain yourself. You’ve been close friends with him since he came to the school so it wasn’t out of the norm for you to hang out with him a lot of the time.

You’ve had feelings for Inumake since you met him, but you didn’t realize it until Yuuta became desperate to get you to see past your denial. These conversations about your feelings for the cursed speech user happened pretty often.

“You know exactly what I’m talking about,” Yuta stared at you. He started waving his hand around as he spoke, “Anyone with eyes can see the way you look at him, as well as the way he looks at you.”

“We are just best friends. We’re only so close because I was the first student to meet him,” you explained. When he came to the school, you two immediately hit it off. Even with his rice ball language, you always seemed to understand what he was trying to convey. Panda likes to joke that your cursed technique is to read Inumaki’s mind.

As if reading your mind, Yuuta brought this point up, “Then explain how you are so in tune with him. You always know exactly what he’s saying and you guys can just look at each other and have a conversation without saying anything.” Yuta always found it confusing yet fascinating the way that you and Inumaki communicate.

This is the first time when having this conversation with Yuta, that you accepted that he was right. With Inumaki being gone on such a long mission, you’ve come to realize how much you miss him. And without him by your side like he always is, you’ve had a lot of alone time to read into your own mind to figure out how you felt about him. You never realize what you have until it’s gone, you guess.

With a resigned sigh, you finally relented, “Fine. You’re right.”

Instead of teasing you, like Maki or Panda would, Yuuta gives you a soft smile. “Why don’t you tell him then?”

“Are you kidding? I only just figured out these feelings this week. Plus I can’t ruin the friendship that we have,” you wave your hands in Yuuta’s face, trying to convey your issue.

“If he somehow doesn’t have feelings for you, you wouldn’t ruin your friendship. He cares too much about you,” Yuuta comforted you.

As if the universe was listening to the both of you, you saw Inumaki make his way to the tree you and Yuta were under. He had his duffel bag still in his hands, meaning after getting back from his mission he went straight to find you guys.

“Toge,” you screamed, getting up. You ran up to him and wrapped your arms around his neck. The force of your body against his almost made him fall back, but he kept his balance and wrapped his arms around you.

If you weren’t so excited and were paying attention, you would have noticed the painful grunt that fell from Inumaki’s lips from your hug. You also didn’t notice the look that Yuuta shared with him. You weren’t the only one that expressed feelings for the other to Yuta.

Later, you and Inumaki were in his room sitting in his bed, plates of food on both of your laps.

Throwing your empty takeout box away, you grabbed the tv remote, “What should we watch? I was thinking like a stupid rom/com.”

Hearing a quiet “salmon” you put on the first movie you saw in the genre list, not caring to read the description at all.

When you watched movies with Inumaki, you guys always cuddled. So it was second nature for you to lay your head on his stomach and wrap your arms around his waist. Inumaki winced at your grip on him.

“Is there something wrong?” you looked up at him. You guys always cuddled so you didn’t think he was uncomfortable with your arms around him.

“Bonito flakes,” he tightly replied, with a shake of his head. He didn’t want you to let go of him.

You didn’t quite believe him but you laid your head down and snuggled closer to him. He tensed again before relaxing a little.

You sat back up, “Spit it out, Inumaki.”

The irony of your statement wasn’t lost on you but you were too focused on what was wrong with him.

Inumaki knew better than to argue with you. He sighed and leaned his head back against the headboard. Pointing at his stomach, “Tuna.”

“What’s wrong with your stomach?” you questioned.

Inumaki sighed and carefully lifted up his school uniform. Normally, the sight of his stomach would send you into a frenzy with how good he looked, but this time was different. His stomach was littered with bruises and cuts presumably from whatever curses he was fighting during his mission.

“Toge,” you whispered, bringing your hand to his stomach. “Rough mission, huh.”

He chuckled at your observation. Most of the cuts had healed but the blue and red marks still showed evidence of the fight.

“Do you still hurt?” you questioned, dropping his shirt. He nodded his head softly.

“I’ll be right back then,” you smiled. He rolled his eyes at you as he watched you walk around his room, grabbing a cloth and then a cup of ice from the mini-fridge.

You sat back down next to Inumaki, fully facing him. You wrapped some of the ice in the cloth before softly laying the cloth on his stomach.

“Turn around. I want to give you a massage for all your hard work,” you broke the silence with a goofy smile.

Inumaki laughed quietly and took the cloth out of your hands, brushing his fingers with yours. The small touch sent electricity flying through you.

Now that you’ve realized your feelings for him, you’re starting to notice more things you didn’t think you would ever pay attention to. How soft his hands are, the ridges and muscles of his arms, the way his nose crinkles when he snorts at something you said.

These are things you already noticed about Inumaki since knowing him. You simply thought you were an observant person but you never noticed those kinds of things about Maki or Yuta. It was obvious now, why you noticed little insignificant details like that about the boy sitting across from you.

Breaking you from your train of thought, Inumaki turns his body so his back is facing you, offering you a quiet, “Tuna mayo.”

“Right,” you hoped he didn’t see the blush that was blooming across your face and ears.

You laid your hands on his shoulders, rubbing your palms in hard circles. At first, Inumaki tensed at the pressure but soon he sighed and relaxed into your touch. Eventually your hands wandered from his shoulders to his neck then back down towards his arms.

Feeling exceptionally bold, you wrapped your hands around his biceps. Inumaki didn’t need to do much hand to hand combat so you knew that his arms probably did not need massaging. That didn’t stop you from letting your hands wander indulgently. Despite his short and lean stature, you could still feel the hardness of muscles on his shoulders and arms.

Inumaki turned his head to look at you, smirking, “Salmon roe.”

“What are you looking at, Inumaki?” you huffed. You finally released your hands from his body as he turned back around to face you.

He leaned over to his night stand to grab the notebook and pen that were sitting on it. He flipped through hundreds of filled pages and eventually stopped on an empty one. He wrote something before turning the book towards you.

IDK. I think I’m looking at a beast ;p

“How rude,” you sighed, crossing your arms. You failed to hide the smile that was plastered on your face, sarcastically replying, “If I’m so hard to look at, I think I’ll just leave then.”

You pretended like you were going to get up but Inumaki grabbed your hands forcing you to stay put next to him.

You both giggled at the familiar banter you shared and suddenly you felt as if all your troubles were melting away.

“I really missed you this week, Toge,” you whispered, truthfully.

Toge simply replied with, “Salmon,” looking like he wanted to say more than that.

“Give me your pen,” you commanded. He looked at you confused before doing as told.

You started to write, simply letting the words fly off of your hands and then eventually into Toge’s heart.

I really like you, Toge Inumaki. I miss you when you’re gone and I care exceptionally when you get hurt. You are the most important person in my life and will always have a place in my heart. I would rather die than be separated from you.

You placed the notebook in front of Toge watching as he read your note. He quickly wrote something down too and handed the notebook back to you.

^ ditto

You giggled at him before throwing your arms around his neck, his bruises long forgotten. He grunted at the pain but only pulled you tighter into him.

You buried your face into his neck and started to leave small kisses there. Toge whimpered at the feeling of your lips on him which only encouraged you further. You made a trail of kisses and bites until you made your way to his face. You kissed both of the marks on his cheeks then hovered your lips above his.

He was breathing hard, trying to catch his breath, which made you smile at the effect you had on him. Toge pushed forward, trying to catch your lips, but you pulled back with a teasing smile.

“Do you want to kiss me?” you asked, your voice turning sultry. Toge didn’t expect this kind of teasing from you but he wasn’t complaining. He whined at your words.

“I think you should use your words. How else am I going to know what you want?” you smirked. You were surprised by what you said but you didn’t backtrack.

Toge was beyond surprised at what you asked him to do. He gave you a look as if to ask are you sure which you gave a confident nod to.

Toge wasted no time, whispering, “Kiss me.”

The sound of his cursed speech washed over you, forcing you to bring your lips to his into a passionate kiss. You initially thought that the lack of control on your body would scare you but the longer you kissed Toge, the more the feeling excited you.

The two of you made out for what felt like ages. You weren’t sure when the cursed command gave you control of your body back, still kissing Toge like you wanted to steal away his breath.

Toge pulled back and searched your face. For what, you weren’t sure.

“Mustard leaf?” he asked you, hands fisting your shirt.

“I’m okay. I’m perfect right now,” you replied. You moved yourself to sit on his lap and laid a soft kiss onto his forehead. He sighed and rested his hands on your waist.

“I would love to continue, but only if you’re okay with that,” you offered, shyly. You didn’t want to make him uncomfortable.

“Salmon. Salmon,” Toge replied, excitedly. He kissed all over your face making you giggle. You softly pushed him back until he was laying down and you were hovering above him.

“Can I take this off?” you asked, seductively, holding the edge of his shirt. Toge’s breathing was fast again, heart beating in anticipation.

“S-salmon,” he stuttered. You felt euphoric at hearing the crack in his voice.

You lifted it softly, kissing up his stomach as it was revealed. He helped you pull the shirt all the way off and flung it to the side.

Staring at him like this was a euphoric feeling. You never thought that you would be looking at a shirtless Toge who’s red in the face and breathing so hard.

You focused on his cuts and bruises from his mission, bringing your lips down to kiss each one. Toge whined each time your lips tasted his skin, even bucking his hips up in search of friction.

You sat on his lap to keep him still, “Be patient. Let me admire and take care of what’s mine.”

Your words sent a shiver down his body making him whine again.

Kissing your way down his stomach you stopped just above his shorts, tugging on the waistband. You looked back up to his red tinted face and made him watch you pull his shorts off until he was only in his briefs.

“Tuna mayo,” he breathed.

“You want me to take mine off too?” you questioned innocently. “I don’t know if you deserve it. You left your girl all alone this week.”

You both knew that a mission is important and can’t be skipped, that didn’t stop you from teasing him.

“Bonito flakes,” he moaned, shifting his hips under you, desperate for anything.

“Fine, I’ll stop teasing,” you sighed. You stood up and stripped down to nothing. Inumaki watched you with rapt attention, not letting his eyes leave you once.

Once you had nothing on, you sauntered back over to him and sat on his legs. You bent over him, kissing him until he was breathing hard again. The feeling of your bare chest on his as well as the heat that was radiating from your core was sending him into a frenzy.

He moaned into the kiss, encouraging you to get a move on. You bent until your face was inches away from the tent in his briefs. You blew air on him and watched as he squirmed at the lack of touch.

Eventually, you stopped teasing and pulled his briefs off. His cock jumped to life, now freed of its confines. You drooled at the sight of him, all flushed and pink.

“Geez, Toge. Didn’t know you were hiding this under all those clothes,” you giggled. He had the prettiest dick you have ever seen. It was the perfect length to fit anywhere you wanted it to.

Inumaki chuckled at your joke before whining again when you softly grabbed him. You put one hand on his cock and one hand massaging his thighs. You let your hand roam his thighs, feeling the lithe muscles twitch under your palms.

Inumaki’s breathing steadily increased as he watched you, patiently waiting for you to do anything. Eventually, you stopped teasing and moved your hand, jerking him off. You hadn’t put your mouth on him yet, so it wasn’t all that lubricated. You decided to fix that.

You put the head of his cock in your mouth, flicking your tongue on the underside of it. He moaned at the feeling of your lips around him and you moaned at the taste of his precum.

You put your mouth to work, drooling a bit to add lubrication for your one hand to jerk him off. You jerked him off switching between a fast pace and a slow pace. He was writhing in place letting pretty moans and whimpers fall from his lips.

You unwrapped your lips from him to catch your breath, licking the underside of his cock instead. Inumaki placed a hand in your hair, not to guide you but simply to ground himself.

As you held his balls in one hand and licked the bottom of his cockhead, he quickly pulled you off of him with a drawn out moan. He was breathing extremely hard and you knew that he stopped you from making him cum.

“Why don’t you wanna cum, babyboy?” you asked with an “innocent” head tilt. You brought your head down to kiss along a bruise on his stomach, careful to not put too much pressure as to hurt him.

“Tuna mayo,” Inumake responded. He looked extremely frustrated. You couldn’t tell if it was because he basically edged himself or the fact that he couldn’t voice what he was thinking about.

Inumaki placed a hand on his face and leaned back with a sigh. Worried that something was wrong, you sat back on his legs and stopped touching him.

“Is something wrong, Toge? We can stop if you want too, I won’t be mad,” you asked. You gave him a comforting smile so he knew you were being sincere.

“Bonito Flakes,” he quickly responded, shaking his head and hands in a no motion. You giggled at his expression.

“If you don’t want to stop, then what's wrong?” you asked, a sultry tone overtaking your voice again.

You crawled up his body so your face was closer to his. You kissed him, hoping to calm whatever nerves he may have had. You stopped upon having a realization, saying, “Would you like to tell me what to do, Toge? Is that what’s wrong?”

Inumaki gave you a dubious expression before slightly nodding his head. You would have missed the motion if all your senses weren’t in tune with his.

You gave him a wide, but comforting smile, “I don’t mind. I would love to try that if you’re okay with that. I have to admit that I’ve thought of it before.”

You had a crimson tint on your face at your admission but you trusted Inumaki with every fiber of your being so you didn’t have to be embarrassed.

Inumaki stared at you like you had hung the stars in the sky, a loving smile adorning his pretty face. You leaned down, kissed each mark on his cheeks before giving him a real kiss on his lips.

“You can command me to do more than just kiss you. I trust you,” you told him. Faces inches apart, he breathed a sigh before kissing you more.

With a raspy, yet pretty, voice, he commanded, “Ride me.”

Immediately, your body moved down until your cunt was hovering above his cock. Without hesitation, you slowly slid down until he was fully sheathed in you, both of you moaning at the euphoric feeling.

The best part about his command, you noticed, was that your thighs weren’t getting tired. You rode him with extra fervor that you might not have been able to otherwise. You placed your hands on Inumaki’s neck, leaning down to catch his lips.

He placed his hands on your hips to guide your movements until he was hitting the perfect spot inside you that left spots dotting your vision.

His command must have been wearing off because soon you could feel the burn of your thighs, constant movement and the stuttering of your hips. As you struggled to focus on riding him, Inumaki kept his hands on your waist to keep you still as he pistoned his hips up into you.

The both of you were moaning so loud that there was no way other people hadn’t heard you guys. That thought left your brain as soon as it came, distracted by the feel of Inumaki.

You leaned down a final time, catching a kiss from Inumaki, moaning into his mouth.

“I love you, Toge Inumaki,” you gasped between moans. Toge smiled and pounded into you harder.

“Cum, please,” he commanded begged. With a sharp cry of Toge’s name, you came. The feeling of your walls fluttering around him made him groan before he spilled all he had into you.

Inumaki guided your hips, until the both of you gradually stopped moving at all, prolonging the euphoric feeling of both of your orgasms.

With Inumaki’s cock still buried deep in you, you laid down on his chest, careful to not put too much pressure on the scattered bruises. He brought his hands up until his arms circled you.

You both laid in the aftermath of sex, basking in the feel of each other's embrace. You whined when Inumaki finally pulled out of you, getting up. He grabbed the towel from earlier, the ice now fully melted, and used the wet cloth to clean the both of you up.

He then sat against the headboard, bringing you closer to him until you were laying against his side. He leaned over to grab the forgotten notebook and pen and scribbled some words down.

I love you more than words can say. I wish more than anything I could say that to you.

You grabbed his face, pressing a kiss to his nose, then a kiss on his lips when he pouted at you. You gave him a loving smile before responding, “You don’t have to say it, for me to know it. I can see it when you look at me, or open doors for me, or even when we’re sparring and I beat your ass.”

Inumaki rolled his eyes at your last remark, giving you a small chuckle. You giggled as you stared at him, completely enamored by the boy in front of you.

You were kissing again when Inumaki’s phone lit up with multiple texts. He picked it up to show you, it was the group chat.

maki n cheese 🍜 <could you guys keep that shit down??? you sounded like pornstars and I was trying to eat in peace

BAMBOO DESTROYER 🐼🎍 <took you guys long enough

yuuta okCUTsu 🤺 <congrats guys ! 🎉🎊

inumaki 🙊 > /(/ /o/_ /o/ /)/

maki n cheese 🍜 < don’t blush you idiot. It’s your own fault for sounding like wild animals

Inumaki put his phone down, giggling to himself. You joined in giggles, embarrassed, but way too happy to care about a thing. The both of you laid together for the rest of the night, enjoying each other’s presence.

#inumaki #jujutsu kaisen #inumaki toge #toge inumaki #toge inumaki x reader #toge inumaki smut #toge inumaki x you #female reader #inumaki x reader #inumaki smut #jujustsu kaisen x reader #fanfiction

2K notes · View notes