#we also might have to evacuate at some point so I need to take stuff to the car (though my area is not even a level 1 i just want

[pencil-peach]

G Witch Onscreen Text: Episode 22

Welcome back to Part 23 of my Episode by Episode analysis of G Witch and its onscreen text. We're on Episode 22: The Woven Path.

<< If you forgot, Episode 21 will remind you of What You Can Do Now Or you can go to the Masterpost.

It's the dawn of a New World.

After Quiet Zero decimates the League's second attack, we get this brief display of it's current system report.

TEXT: (Lefthand side) - Link Strength with Aerial currently

(Middle) System Report -Permet Inversion Reactor STATUS:

Permet fluctuation reduced to [???]

Topological heat exchange catalyst replenished

Permet inversion reactor output decreased to 61%

Permet field stabilization in progress

(Righthand side) - Link Strength with Gundnodes currently

Lots of Permet based terms here that we might never fully understand...like what is "Permet inversion..?" Ahhh...I wanna know...

I wonder what the story is of the other staff members operating Quiet Zero are. Were they Shin Sei employees? I personally believe they were surviving members of Vanadis who were off base when the incident occurred like Bel, and who sympathized with Prospera's aims.

It's sweet of Guel to check up on Miorine, but I think even he knows he can't do anything for her now. She needs her wife....

The news report Rouji presents is from PNB, and the headline is:

Massive data storm, large number of GUND-type MS detected around mysterious Quiet Zero - Assembly League fleet devastated, evacuation warnings issued over wide area. - Suspicions that mastermind may be Benerit Group insider or [renegade?] "witch."

It seems that nobody is aware of who's really behind Quiet Zero, and a "witch" being behind it is merely speculative. That would explain why Shaddiq was able to take the blame for the crime in the Epilogue.

The bench where Suletta and 5lan have their talk (Left) is the same bench where El4n was supposed to meet her for their second date (Right).

We also learn in this scene that Suletta's wish list was actually just a bunch of stuff her mom suggested for her to do, and she just decided to go along with it for some reason. Even the things she "wanted" to do weren't wholly things she decided to do for herself.

Another thing that's interesting is that in this scene, wind is blowing. Asticassia is a closed environment, so there's no natural wind. It has to be produced by a strong force. In this scene, the wind begins blowing when Suletta affirms that she wants to stop Prospera and Eri, so I like to imagine that the strength of Suletta's will is what's causing the wind to blow.

I've already made a post discussing Guel and Suletta's final duel at length, but in brief, I think it's clear that at this point, Guel's duel with Suletta isn't about Miorine at all. I think it's about proving to himself whether he was truly a match for Suletta.

Guel and Suletta are rivals, in that they have the most onscreen duels with each other, and Guel's main motivation throughout the series is catching up with her.

But despite that, not a single one of their duels was ever fought evenly. One of them always had an unfair advantage, or there was some kind of outside interference on the outcome. And so, especially after the outcome of their last duel, Guel still isn't truly sure if he's caught up with her strength yet. And so this duel is the only one fought on perfectly even ground. No outside help, no interference. Just a pure one on one fight, to truly prove which of them is stronger.

And if you want to know why they chose fencing of all things, it's a reference to Char Aznable and Ray Amuro's fencing duel from the original Mobile Suit Gundam (Left).

On the whole, I can understand why some people might not like this duel (it's very out of left field) but personally, I like it, and I think it's an important conclusion to their rivalry, which was established in the first episode. I think it's just another victim of the absolute lack of time the series had to properly wrap up all its threads.

Suletta and Miorine's second heart to heart share some parallels/inversions to their first, so I will chronicle them here. (The first one is that their first heart to heart was in Episode 11, and their second is in Episode 22. Hehehoo !)

Firstly, the most obvious inversion is which of the girls is in pain. In Episode 11, it was Suletta, and now, it's Miorine.

Both girls believe, for one reason or another, that they've made a terrible mistake, and have receded into themselves as a result. Suletta believed that she was mistaken about her place in her friends lives, and should never have come to the school. Miorine blames herself for the tragedies at Quinharbor and Quiet Zero, and believes all of the choices she's made up till then were wrong.

In both cases, the other girl shares something personal about herself, and tells her that it's only because they met each other that that they don't have to keep running anymore.

At the end of their first heart to heart, Miorine refused to let Suletta see her cry, but at the end of their second, Miorine reveals herself to her fully messy and vulnerable, a sign of her complete trust in Suletta.

Their first heart to heart began with Suletta opening the door for Miorine, while their second ended with Miorine opening it for Suletta.

In the end, it's not violence that allows Suletta to rescue Miorine. It's love.

And while there (STILL!!!) unfortunately isn't an official release of EITHER track, the BGM that's playing during Episode 22's heart to heart is a soft piano cover of Season 2's opening, "Slash." This is a parallel to Episode 12's scene where Prospera manipulates Suletta, in which a soft piano cover of Season 1's opening, "Shukufuku" plays.

When Miorine and Suletta reunite with the rest of Earth House, the door they're standing in front of is numbered "7007." At the beginning of last episode, Felsi calls Guel about Petra from a similar looking hallway, and if you look closely, you can also see a door behind them with the plate number "7007." It's the same hallway, and I like to imagine the Earth House kids were there to see Petra, who might even be in that room.

Sometimes your father is a horrible terrible no good deadbeat sack of shit and you'll never forgive him.

And sometimes, he's still your dad.

Here's a quick visual reminder of the units at Plant Quetta that Prospera needs for Quiet Zero to operate at maximum capacity (Left). I wonder if these were internal or external units...probably internal.

It seems that Quiet Zero was being developed in (at least) 2 separate locations, and in their haste, Prospera and Godoy weren't able to retrieve the units before launching it proper. Hohn hohn hohn...

It makes you wonder though, what would Quiet Zero look like at full capacity? Probably woulda been scary.

Rolls up my sleeves

(Left, Top to Bottom) Quiet Zero - Current status summary

MOBILITY - After restart, movement velocity of enemy basepoint is predicted to increase - Velocity of each enemy MS also predicted to increase by average of 37% - Evasive Maneuvers of main unit will be complex

DEFENSIVE FUNCTIONS - Strong air defense barrier confirmed around Quiet Zero main unit, making it difficult to approach - Defense barrier strength 67942049 - Very difficult to invade domain while mutual defenses of basepoint and MS are linked

(Right, Top to Bottom)

WIDE-AREA DATA STORM CONTROL FUNCTIONS - Expands data storm domain and stabilizes it over a wide area - Domain is predicted to expand further in future

DATA STORM DOMAIN - 60%

PERMET DISPERSAL SYSTEMS - Permet dispersal index exceeds 200 - Permet density x 27.1 - Density increase is accelerating

REINFORCED LINKAGE BETWEEN QUIET ZERO MAIN UNIT AND GUNDNODES - Increases interconnectedness of overall enemy - Each MS appears to become a sub basepoint - Basepoint and all Gundnodes are linked - Link multiplexing confirmed, jamming impossible

A quick look into an analysis of Quiet Zero's systems. There's not much to say other than this really is an apocalyptic device. Interesting to note though is that even without the necessary units, Quiet Zero's capabilities are naturally increasing, presumably because Eri is slowly getting better at operating it.

In case you were curious, here's the description of the Demi Barding's Baori Pack, which allows it to operate without Permet Links

(Baori Pack) - Can be configured with various optional equipment evolved from the 'Daedalus' multi-tool system, an exclusive expendable stand-alone pack equipped with flight unit functions. - Can also be separated from the main unit...

The 'Daedalus' multi tool system...interessante...

In this scene, Guel expresses his concerns for Suletta's wellbeing to Miorine, only to be met with a confident gaze from her, an expression of her belief in and respect of Suletta's choice (Left). It's similar to the scene from Episode 9, where, in response to Shaddiq's concern, Suletta responds with a confident gaze of her own, affirming her belief in Miorine (Right).

When Miorine confronts Shaddiq, she asks him to believe in her, to which he breaks out into laughter. Maybe he's finally realized where he went wrong. Shaddiq cared a lot about Miorine, but despite it all, he never once trusted her. Not with her own company, not with her choice in Suletta, not with the future, not even with her autonomy.

If he had looked beyond his own ideals, if he had reached out and truly trusted her, saw her as an equal rather than something that needed to be protected, then maybe things would have turned out differently.

I won't bore you with transcribing the text from Suletta's flashback about uncovering the hidden message for Miorine from Notrette, but when Rouji decodes it, HARO uses the "Ytk-7791 Format" sequence to decode it.

Also, I'm a little obsessed with how Suletta is with Secelia and Rouji in this flashback. It occurred at some point within the ~10 days between Ep 20 - 21, and I wish we got an entire episode about it because I would love to know what lead up to this specific pairing...not to mention the dynamic....ARGH WHY DIDNT THIS SHOW GET MORE EPISODES FUCK !!!

Anyway, the interesting thing about the hidden message is that the Code actually follows a consistent pattern, so if you know the conversion rules, you can create your own messages. I'm sure it's already been done, but I went ahead and made a table deducing the conversions

I used the codes we see on the tablet and on the Quiet Zero terminal to intuit the letters we don't see.

The code is split between lowercase and uppercase versions of letters, starting with lowercase a as AAA.

If an acid sequence has a single asterisk (*), that means we don't specifically see that letter in the show, but was confidently intuited using the surrounding letters that we do now.

In the case of the punctuation, there was no real way to intuit the order, so those have two asterisks (**), indicating that I simply made my best guesses for placement.

'CGG' functions as a blank space between words.

So, for example, if you wanted to write, "I love you, Suletta." The code would be:

GTCCGGAGTATGCCCACACGGCGAATGCCACTACGGTCTCCAAGTCATCATAAACGT

In terms of numbers, we see on Rouji's monitor that the Number Table is separate from the Alphabet table, starting at 0 with AAA. (We know this because the screen shows both the Number Table and Prime Number Table, and by comparing the two, we see that AAG has to be 2.)

I think one day I'll try and code a tool that lets you convert messages to the code and vice versa, if you ever feel like letting your betrothed know you love them through. Nucleic Acid Sequences.

You don't need me to tell you how the scene with Suletta in Calibarn is a parallel to Elnora in Lfirth from the Prologue, but you might not have caught just how many of the shots are directly referenced.

But in the Prologue, Cardo Nabo refused to let Elnora make the choice to hurt herself for everyone else's wellbeing by raising the Permet Score, whereas Miorine, despite feeling that same concern, allows Sulleta to make that choice. (The moment when Suletta clears score five and Miorine bursts into tears...she was so worried...she was so afraid.......AGHHH)

Calibarn's entrance into Quiet Zero's data storm is a reference to Full Armor Unicorn's entrance in Mobile Suit Gundam Unicorn.

Sibling fights....

It seems the end is nigh. Is love strong enough to overcome all adversity?? Who knows...

To find out, Click here to go to Episode 23 >> Or maybe the Masterpost could remind you.

#g witch #gundam the witch from mercury

[theamityelf]

I enjoy calamity and details too much so I have to ask RE: your Undead Hope’s Peak AU… do you think Makoto and Komaeda would suffer SOME sort of side effects to being constantly exposed to the zombie virus? At the very least I can’t imagine either of them were able to be as vigilant on caring for themselves as they could be, especially being surrounded and essentially drenched in blood, rot, and death. If the virus was ever reversed, I have to wonder if that wouldn’t be the greatest time for both Makoto and Komaeda’s bodies to tap out and get some rest whether either of them volunteered or not lmao. Also judging by how awful the reserve course is getting the brunt of things I can’t imagine vengeance isn’t close at hand for them. This could end up causing the reserve course despair attack without Junko’s influence.

To your first point, I can definitely see them at the very least getting sick pretty regularly. They try to keep the room and their classmates as clean as possible, but yeah, the amount of stuff they're exposed to and the amount of times they get bitten and maybe forget to bandage it until later or just are too busy for a while, at the very least some of those bites get super infected with just regular pathogens. These guys have unbandaged bites while bathing with a bunch of undead people; I think at the very least, they feel sick.

I'd say one plausible way that the undead virus could affect them is that they develop a higher tolerance for those blood and meat smells. By which I only mean their disgust instincts are decreased, but they will still have a physical reaction if they're exposed for too long. So being around all that decay will still make them physically ill, but they won't feel the disgust leading up to it, so they won't know to be as vigilant as they need to be.

The smell of rotten meat doesn't bother them all that much anymore, but they will still vomit if they're in the room with a lot of it for very long. And they will still get sick if they're handling something that carries disease.

Their immune systems are definitely in a bad place on the basis of exposure, diet, and not getting enough quality rest, so they'd also be getting regular colds and stuff pretty often.

(If we wanted to, we could definitely also say that the undead virus that they're immune to, the regular infection in the bites, and whatever regular cold or flu they might come down with, end up mixing together and create whole new cultures of disease.)

To your point about the reserve course, I think Hajime could even be the catalyst for that. Maybe the reserve course didn't know that any of the lucksters were setting traps for them, because those who found out were already caught in the traps and so never got to tell anyone before they got eaten. Maybe Hajime is the first to make it back to the others with news of having been caught in an actual human trap to be fed to the main course.

I'm thinking, before that point, they didn't feel slighted by anyone in particular; they just felt like they got caught up in a zombie apocalypse, like in the movies, and it's no one's fault; just bad luck. They felt the faculty had no choice but to lock them here, since the disease had spread so much, and now they just have to survive until there's a cure. Maybe it occurred to some of them that they were here to be food for the undead, but those people were treated as conspiracy theorists. Hope's Peak may have its faults, but they wouldn't feed students to anyone. They just weren't evacuated in time, and the school had to barricade the campus so none of the undead could get out and hurt way more people.

But then Hajime gets back with news that there are human main course students setting traps to feed the talentless to the Ultimates, and that even the nice luckster who protected Hajime from such a fate is just being used by the school to take care of the Ultimates, and that causes an uproar. They realize they're being sacrificed, and they want to fight back.

Maybe they want to attack the undead, but more likely they want to charge the barricades and escape. They refuse to be the school's disposable sacrifices, even if it means the undead are able to leave the campus and infect more people outside.

#danganronpa #undead au #makoto naegi #nagito komaeda #hajime hinata

[dogtoling]

I dont think you meant bad by it, but the rogue kraken stuff in schools originally seems a bit insensitive. The rogue kraken drills, having to hide away from them to avoid being injured/killed, preparing through drills, society and police poorly handling them poorly, it also seems like a splatoonified version of school shootings, it seems as though people may use it to make angsty world building with little to no thought about how it may be perceived. Its personally upsetting to see as someone who’s been in a school shooting myself.

First off anon, I am so so sorry you've had to go through that. It was not meant to be a "splatoonified school shooting", and also not something anyone should just take and run with for cheap drama. The topic itself was submitted by an anon, and I think I tried to make it pretty clear that it might not be something that needs to exist in the first place. However I have to point out that dangerous people drills in schools are not exclusive to just active shooters (although I can't prove the original anon wasn't throwing ideas based on this), and I think those would be in their right to exist, as like, one of the numerous things that the Splatoon world has that mirror things that we have. I'm pretty sure most countries with schools have evacuation and sheltering plans. I don't know if there's a way to approach things like this without it being personal to some people that have been in shitty situations directly related to the context, so I don't really know what to say about it further. But again, sorry it hit close to home for you.

#mailbox

[thevulpinehero1]

Gwatch: Mobile Suit Gundam 0079 Ep 2

Time for Episode 2. After a high-octane first episode, EP 2 has some minor administrative stuff to take care of in regards to laying out the situation the protagonists will be in. As before, be wary of spoilers.

Pictured: the Captain of the White Base asking a sensible question about war machines that would later be almost exclusively piloted by people too young to legally drink

Let's talk about Zakus. People love Zakus. They're cute little cyclops guys, and they get totally manhandled basically from start to finish whenever they appear which gives them underdog points, but it's worth noting that at this point the story goes out of its way to establish that even a Zaku, the punching bag mook suit of future Gundam lore, is a huge threat.

Char reports losing two Zakus, and his superior cannot believe his ears. These are the shaky beginnings of mobile suits, and the Earth Federation doesn't really have any horses in that race yet. They're still trying to fight off Zakus with tanks and planes, and the Zakus are as far above conventional military vehicles as the Gundam is above the Zakus.

Two Zakus murdered entire crowds of people. They're stated to have wiped out almost every single military officer and engineer that was supposed to staff the White Base. They're directly responsible for the ongoing crisis that the protagonists experience throughout the series; those two random guys Amuro yolo'd in a suit he could barely get to stand up were more effective in stalling the Federation war effort than almost anything that follows.

And they sort've need to be that effective, because the audience needs to be sold on the premise of mechs as a weapon of war, subject to the logistics and concerns of the battlefield. Previous shows in the genre have been more super robot types, so they got a free pass, but the Zaku needs to show why you wouldn't just use a tank or more conventional vehicle, and that threat level has been established early on (even if it's mostly brushed over; as mecha fans will admit, the question "but why does it have to be a giant robot?" doesn't have any good practical answers outside of it being cooler. Even if you ignore things like the square-cube law and the difficulty in scaling up a humanoid body, even if you ignore how complex mecha would be in comparison to a tank loaded with the same armaments, the simple fact is that humanoid is not a particularly effective shape to be on a modern battlefield.)

Sayla Mass shortly after slapping a random civilian who has understandably elected to get himself away from an active battlefield instead of roaming around looking for survivors, then telling him he should be left behind to die instead of being evacuated. Her sweater has become part of her skin; she's a Na'vi from the neck down.

Sayla's an interesting character who basically never appears in other Gundam shows, despite the fact that she'd be pretty relevant to a couple of them and the series being quite happy to include previous major characters in later instalments. I forget why this is the case -- I think it might have had something to do with her VA? -- but either way, she's one of the few who doesn't return in any meaningful role, which means we can only enjoy her here.

Part of what makes her fun to watch is that, when she's not just randomly slapping potentially traumatised survivors of a military attack, she's generally pretty effective. Within minutes of us being told her name, she's pulled a gun on Char, who's snuck into the colony on foot to do a bit of spying (which is honestly something of a habit for him as the Gundam series goes on). He almost immediately disarms her because he's Char and also extremely effective when he wants to be, but hey.

Char Aznable playing Touhou in his off time. Seriously, this guy dodges lasers like it's going out of style.

As Char makes his escape with the valuable data, we're treated to what will become a fairly common sight: Amuro getting out the beam rifle and just kind of yeeting all of his ammunition at nothing in particular. This time, he has excuses; he's aiming at human targets in a mobile suit, and he's never really killed a human in cold blood before. He also pulls off a couple of neat shots where he hits two missiles mid-flight. But I remember the amount of times 'oh no I fired wildly with my rifle and didn't hit anything, and now I have no ammo!' became a complicating factor becoming something of a joke to me.

We're then treated to the first ever battle between Amuro Ray and Char Aznable, which ends up as more or less a stalemate. Make no mistake: Amuro gets completely manhandled by Char, who's an accomplished ace pilot with five battleship kills to his name. But the Gundam is so OP for this point in the series that, even though Amuro can't really touch him, Char can't really capitalise on the opportunity since the Gundam can tank his weapons head on. In the end, their skirmish is a mutual loss. Amuro loses to a pilot. Char loses to a suit.

But Char walks away with a head full of the Federation's military secrets and a much better understanding of the Gundam's threat level, and he has supplies and reinforcements on the way...

#mobile suit gundam #gundam '79 #anime blogging #spoilers #screenshots #char begins the gundam tradition of being way cooler out of the suit than in one #Bright's there but he's not captain yet #still chooses to be kind of an ass about things though #seriously the Gundam completely hard-carries for a while #Gwatch

[gofancyninjaworld]

Hello! I've been binging your posts abt opm and they're all so amazingly detailed and well written, there are some minor stuff I disagree with, but tbh that didn't lessen my enjoyment. Really, what makes opm so good is that you can enjoy it on a surface-level, but if you bother to prod and poke and investigate some more, it also greatly rewards the reader. Viewing it as a comedy or taking it straight as a bleak world, both could still work

Tbh when I read a part of Saitama's pov causing friction against the dog eat dog world of opm, from what I recall that you said something along the lines, if it's from Saitama's pov, it's a comedy, it's lighthearted, the monsters aren't threats they're annoyances (sure, some aspects of Saitama aren't always for comedy, but the point abt the pov still stands). It does serve as a kind of a break or at least a form of escapism that things would be ok, in contrast to whatever everybody else is experiencing (which is complete and utter hell). It was why Saitama could afford to be somewhat static in a sense

But I think 166 is such a crucial chapter, in that Saitama's pov greatly stops being comedic (there are some comedic elements still, but the lightheartedness has straight up gone and evacuated) and starts crashing and merging into the reality of the world of opm.

For once, we actually see some genuine, devastating consequences on Saitama's end, and it is something he is accountable for. I do recall that you said WC Saitama's issue is that no one really holds him accountable when it needs to (?). While manga Saitama gets a tasting dose of that from King countless chapters earlier, this time he gets a heavy and brutal dose of it. There's no sugarcoating this. While yeah I have no doubt the other heroes would come back, esp Genos, but the fact it escalated to this degree when it didn't have to, admittedly some of the blame fall on Saitama's shoulders. It may be God's will, it may have been Garou's fist that tore out the core, but it was also Saitama's carelessness that played a factor on why Genos is killed. For a man who can travel faster than the speed of light, was it really that impossible for him to arrive on time to stop Garou killing Genos?

He's not perfect. This is his lowest point as a hero — even a hero must be aware that people you care about can and will die in the field, but I guess Saitama got so swept up in his emotions and got his determination in his identity as a hero broken, that he pretty much said fuck it and tried to throw an earth shattering punch with everyone else as collateral. From what I can see it diverges from WC, this isn't really a "hero" vs. "monster" fight bc Saitama has stopped fighting this for the sake of righteousnes or justice or knocking some sense into Garou but rather bc it's personal and he's mad and he's grieving. Not to mention Garou has no agency here, his body hijacked by God.

By all accounts, I think Saitama genuinely wants to kill Garou — and I have no doubt Saitama will win the fight physically, ideologically... He may have already lost the moment he threw Serious Punch with complete and utter regard for those around him. The only thing I wonder if he'll lose again if he doesn't calm down and gets informed that Garou is being controlled by God.

On one hand, I'm sad that I didn't reply to this when you first asked this because my answer would have been very different. Still, events did unfold in an interesting way.

Thinking back on it, I agree that Saitama really did want to kill Garou. He might no longer remember this timeline, but we see it and we know that he can't claim not to understand where Genos is coming from on his revenge quest. He's the guy who would destroy everyone and everything.

The struggle he had with Garou was not so much to beat the guy down as it was with himself so that he did not lose who he was or what mattered to him in the process. That was a huge struggle for Saitama.

And that determination of his to keep Genos's core safe at all cost is probably going to be much more important than we realise even now but we'll have to wait and see what comes of it.

The fact that Saitama *did* come back in time in order to save everyone in time in the end would have totally pissed me off but for the fact that being able to do so came down to Saitama finding grace and empathy for Garou. That's what got through to him and got him to stop luxuriating in the bad guy who deserves to be hated schtick so instead he went '...but I can do better.' And did.

In a way, it's a shame that Saitama doesn't remember these events, or he'd realise that he also owes Blast his thanks for keeping the Earth safe from him. Hehe, instead he's slandered Blast, albeit without malice.

#OPM #asks #Saitama

[zrtranscripts]

Season 10, Mission 2: Empty Chairs at Empty Tables

Wild Goose Chase

~

AMELIA SPENS: What do you mean, Red Scorpion is gone? Well, satellite images aren’t good enough! I need minions on-site telling me what’s going on. Yes, it certainly would make sense to use Mr. Boujettif, except for the very small problem that he’s on an entirely different continent, which you would know if you read the morning briefing documents. I don’t care that they’re 50 pages long, Paul. That’s the job. And while we’re at it, my breakfast Moët was lukewarm this morning. Yesterday, it was Prosecco. I didn’t become PM to drink second-rate champagne knock-offs. Right, Jody.

JODY MARSH: Nice of you to join us, Amelia. Sorry if we’re interrupting your very important call. You know, by turning up to the rendezvous with New Canton Five you arranged. Also, why did it have to be Canton Five? No offense, Five. It’s just dead weird running with a different Five when the real Five’s missing. I mean, you’re not even the original Canton Five.

AMELIA SPENS: Excuse me for thinking you might find it comforting. This Five’s nauseatingly heroic too, if that helps. Also, I do so enjoy watching you froth with anger, Jody. It’s very stimulating.

PAULA COHEN: What’s going on, Amelia? You said it’s to do with our missing people. Is there some news about Maxine?

AMELIA SPENS: Not precisely.

PAULA COHEN: Oh. I thought... I thought I’d have something to tell Sara. She’s been having nightmares. Are you even looking for them? Or have you just written them all off?

AMELIA SPENS: Of course I haven’t. If Janine and the real Five were here, I wouldn’t have to rely on idiots like Paul to run my security service. I was hoping to appoint Sam as head of AmeliaCom, and there are some very interesting experiments I want to run on Peter. Frances, I could leave or take, if I’m honest. But in point of fact, I do have news. Not about Five, who remains frustratingly elusive. But two weeks ago, the Maghreb Protectorate offered to send us a message from their “honored guests.”

PAULA COHEN: Two weeks ago? And you didn’t tell us?

AMELIA SPENS: I don’t trust the Maghreb. Not since they got it into their heads that we stole this panacea from Red Scorpion Base. I’m not convinced the Maghreb didn’t steal it themselves and blame us. I needed to be sure the offer wasn’t some sort of trap.

JODY MARSH: And?

AMELIA SPENS: We’ll see, won’t we? They’ve arranged for someone to meet us at the duck pond in Barton in... Goodness, five minutes. I have been gabbing on, haven’t I? Chop chop, Canton Five. Show them the way.

~

JODY MARSH: We’ve reached the duck pond, but there’s no one here. I mean, apart from a few mallards.

AMELIA SPENS: Well, that is disappointing. I had to reschedule my hot stone massage for this.

PAULA COHEN: No wait, what’s that floating in the center of the pond? It looks like a document case. Canton Five, can you reach? [water splashes, case clicks] Oh, it’s just a scribbled note. [paper rustles] It says, “Go to the statue of Thomas Gainsborough in Marfield Lestone. Await further instructions.” Amelia, are you playing games with us? Because if you are, it’s terribly cruel.

AMELIA SPENS: Someone’s playing games, but it’s not me. I wasn’t going to mention it, but a V-type’s been spotted near Marfield. Terrible nuisance. The whole area’s evacuated, and my anti-gray berets are tied up dealing with a minor hoard in Chiswick. I did think I had the undead situation in hand. It was the one campaign promise of mine that I actually intended to keep, but there’s been a positive profusion of outbreaks recently. [sighs] I suppose we’d better give this outing up as a bad job.

JODY MARSH: No way.

PAULA COHEN: Absolutely not.

AMELIA SPENS: I can’t guarantee your safety if you carry on. Well, I suppose I could if I really wanted to make the effort, but I don’t.

JODY MARSH: [scoffs] Stuff being safe! This is the only sniff of a clue we’ve had since all our friends went missing. I’m not giving up.

PAULA COHEN: Marfield is east of here. Come on!

~

PAULA COHEN: I can see Marfield on the brow of the next hill. Lots of little Elizabethan cottages and a half-built McShell lane.

AMELIA SPENS: Therefore useless. I’ve ordered a squadron of my anti-gray berets to head your way, but it will take them at least 15 minutes. Honestly, do you have any idea the havoc you two have wreaked on my schedule today? Now I’m Prime Minister, my day has to be timetabled to the second. I’m not enjoying it at all!

JODY MARSH: You wanted the job, Amelia. Deal with it.

AMELIA SPENS: Admit it, Jody. I’m the best PM this country has ever seen. And the rest of them didn’t have to deal with the shambling undead outside of their own cabinets.

PAULA COHEN: There’s no sign of that V-type.

JODY MARSH: No sign of anything. It’s weird to see it all so empty. Corn ripe in the fields but not a single person. I’d sort of forgotten what it was like before the cure.

AMELIA SPENS: And before I reestablished order and a semblance of normality.

JODY MARSH: Yeah, it was definitely all you, Amelia. I used to do airdrop pickups around here. The road was cracked, grass growing up through. There was a cherry tree right in the middle. Now it’s all paved over again. Back then, it felt like nature had had enough of us. Game over, next player’s turn. Time to hand it all back to the foxes. It used to feel like we were an endangered species.

PAULA COHEN: We were an endangered species! And we still would be if it weren’t for Maxine. Veronica’s research was all built on hers. Without her, there’d be no cure! I’d still be... Without her, I wouldn’t be here. I wouldn’t want to be.

AMELIA SPENS: Please don’t cry, you’re not one of those people who can do it attractively! And what happened to that trademark Abel sunny optimism in the face of insurmountable odds?

PAULA COHEN: It disappeared with all our friends! Five’s just gone. We think the Maghreb are holding the rest prisoner. Veronica’s been hunting for traces of her other self, but all she’s found are bits of code and rumors of a brain in a suitcase. We know Maxie went to help the Maghreb with a measles outbreak. Apart from that, what do we really know? Just reports of a burn cube explosion, right back when they first went missing. Peter had a burn cube inside him. What was that?

JODY MARSH: Probably just the wind. But maybe we should pick up the pace. Not much further to Marfield.

~

JODY MARSH: We’re here. Marfield Town Square. Looks like they got evacuated right in the middle of a market day. This stinks of decaying cabbage and spoiled meat. [gags] The butcher store’s buzzing with flies.

PAULA COHEN: Here’s the statue of Thomas Gainsborough. Oh my God. Do you see that, Five? On the pedestal, it’s a tape recorder. A proper old-fashioned tape recorder with a tape in it! Jody, do you think this could... Could this really be a message from them?

JODY MARSH: It’s got to be, hasn’t it? What would be the point otherwise? Well, go on, then. Play it. The suspense is killing me.

PAULA COHEN: I know... I know. I’m sorry, I just... What if it’s not? Okay. Okay, here goes. Five, my hands are shaking. Can you figure out how to get this thing to play?

JANINE DE LUCA: Well, what exactly would you like us to say?

JODY MARSH: Oh my God.

PETER LYNNE: It doesn’t matter what you say. It’s proof of life, Janine. I mean, proof of how great our life is and how well we’re being looked after.

JANINE DE LUCA: Don’t be absurd, Mr. Lynne. Proof of life only works if it’s a live broadcast. They could record this and then kill us. Doesn’t mean anything.

PETER LYNNE: I think it might be nice for our friends to have some reassurance, Jenny.

JANINE DE LUCA: Well, yes. We really are... We’re perfectly fine. It’ll take more than this to break us.

DISTORTED VOICE: I think that’s enough for now.

AMELIA SPENS: You need to stop the tape right now.

PAULA COHEN: There could be more messages. We haven’t heard Maxine yet.

AMELIA SPENS: Quiet, for goodness sake! There’s movement on the monitor, doodahs. [sighs] It’s keeping to the shadows, but it’s very fast and it’s definitely heading in your direction. I hate to be all doom and gloom, but it’s probably our V-type. I don’t suppose you fancy acting as bait to lure it away, do you, Jody?

PAULA COHEN: We’re not risking losing anyone else.

AMELIA SPENS: [sighs] Why do I even bother asking? Then you’d better head east towards that ghastly industrial estate. And don’t dawdle!

~

JODY MARSH: Anything on your cameras, Amelia?

AMELIA SPENS: Not a sausage.

JODY MARSH: I can’t see anything. Can you, Five? It’s dead quiet. Just lots of half-demolished warehouses. But I can feel it. All the hairs on the back of my neck are standing up.

AMELIA SPENS: It seems to be hiding from the cameras, which it should be far too stupid to do. [sighs] I thought Paul was being hysterical when he started blathering on about signs of increased intelligence in solitary V-types. I suppose I should apologize to him. I won’t, obviously.

PAULA COHEN: Five, play the tape.

AMELIA SPENS: I really don’t think you should -

PAULA COHEN: I’m not waiting any longer. I can’t.

SAM YAO: I really don’t see why I should help you. Oh, are you already recording? Now that’s not fair! I said I wouldn’t cooperate. No, you’re not doing it to be nice. You’re trying to freak my friends out or-or manipulate them or something, and I’m not going to help you. Guys, no one knows where Five is, but we think they -

JODY MARSH: Stupid Sam. Always worrying about other people when he should be worrying about himself.

PAULA COHEN: There’s still... There’s nothing from Maxine.

JODY MARSH: Maybe it’s further on.

PAULA COHEN: That’s it. That’s the end of the tape.

AMELIA SPENS: Emote about it while you move. I finally got a clear and frankly stomach-turning look at your pursuer. It’s missing a head and still very much ambulatory, so call me an old worrywart, but I think it’s a V-type. I was really hoping we could avoid this, but there’s a place to the north where you can evade it. Just go on, then. Run!

~

[zombie growls]

JODY MARSH: Oh God, it’s nearly on us!

AMELIA SPENS: Just as well good old Amelia’s led you to safety. On your left, the side door to Marfield Storage. Five, enter 2574 on the keypad.

PAULA COHEN: I don’t understand. Why wasn’t there a message from Maxine? She was there. We know she was there.

AUTOMATED VOICE: Voice scan required for entry.

AMELIA SPENS: Let me just... Ah.

RECORDING: Sigrid Hakkinen, access code Sigma Alpha Epsilon.

AUTOMATED VOICE: Authorization granted, Minister.

JODY MARSH: Paula, Five, get in now.

AMELIA SPENS: There’s another exit at the far side of the complex. It should take you well clear of the V-type.

PAULA COHEN: Does it mean they don’t have Maxie, or does it mean they... they had Maxie and now they don’t?

JODY MARSH: There was nothing from Five, either. This was probably just like, a teaser trailer, something to get us interested.

PAULA COHEN: Yeah, no. [laughs] Yeah, you’re right. Why would they hurt Maxie and not the others? Except for the fact that she’s a doctor, and there’s this sudden outbreak of new diseases and maybe she knows something about it they don’t want her to know!

JODY MARSH: My nan always said don’t borrow trouble, you’ll get enough for free. And we think Van Ark’s got something to do with it, right? I mean, we got a message saying he wasn’t the real Van Ark, but that could have been faked. Van Ark wouldn’t kill Maxine. He’d use her. You know that.

PAULA COHEN: Yes, I know that very well.

JODY MARSH: Amelia, what is this place? I mean, it’s one of Sigrid’s secret bases, obviously. It’s all pastel walls and surveillance cameras and posters of her on every wall. I’d forgotten how smug she always looked. But why did you have the passkey, and why were all the lights on when we came in, like someone’s been here recently?

PAULA COHEN: I can see the labs through the glass doors. Some of the equipment looks like it’s running. The sign about this one says, “Bioweapons, alpha access only.” [door knob rattles] It’s locked.

AMELIA SPENS: I would like to explain, but I’m afraid the V-type’s found a way in.

JODY MARSH: Oh, bollocks. You just don’t want us to look around.

[zombie roars]

AMELIA SPENS: I might be lying. I could have recorded that sound and saved it for a rainy day. Or maybe you’re being hunted by a virtually unkillable zombie. Up to you, of course. You could keep trying more locked doors, or you could run!

~

[door creaks open and shut]

JODY MARSH: We’re out of the base. No sign of the V-type, if it was ever there.

AMELIA SPENS: No need to worry your pretty head about it any longer, Jody. My anti-gray berets have arrived.

PAULA COHEN: I can see them rappelling out of the helicopter. Rappelling... Is that the word?

AMELIA SPENS: Yes, they certainly made good time.

JODY MARSH: You don’t sound very pleased. I thought you were a big fan of efficiency.

AMELIA SPENS: It may shock you to learn I used to carry out a heist or two?

PAULA COHEN: No, not really.

AMELIA SPENS: Before every escapade, I’d send my crew to carry out a minor break-in, making absolutely sure to trip the alarm. Can you guess why?

JODY MARSH: I don’t care.

AMELIA SPENS: It was to test police response times. Terribly clever of me, really. Create a problem, and then see how the opposition goes about solving it. It teaches you an awful lot about them.

PAULA COHEN: You think that’s what this was about? A way for the Maghreb to test our V-type defenses?

AMELIA SPENS: Or to discover the location of a place I’d rather have kept under wraps for a while. And what have we really gained today? I suppose it was nice for you to hear your friends’ voices, although personally I’ve always found Peter’s rather grating. But Maxine is missing, we’re no closer to finding Five, and our opponents, whoever they truly are, have learned a great deal about us.

~

#zombies run #zrs10 #s10e2 #empty chairs at empty tables #zr transcript #zrs10 spoilers

[the-firebird69]

This kind of thing makes me feel bad for the poor guy it really does and if I have to take his place it makes me feel real bad right now we're wondering what's going to happen these guys are saying they're going to take all the stuff out of the tunnels and you can't go out the other side the flow rate slows down to about 50 miles an hour and just keeps going and people can send whatever they want and if you open it up it was like 80 and the ships might get ruined and they say they looked at it that's true too diamonds moving my smack into the ships or super structure we did encounter damage to the superstructure so wondering what they're going to do and how they're going to do it and this looks stupid Jason you look like a dick you don't need retail theft but for Christ's sake what are you going to volunteer for next removing all elevated homes s***

Mac daddy

I didn't know that you'd be taking the role I mean I did but I didn't do all this stupid s*** okay I'm doing it but I thought it looked good he says it looks okay and something looks real stupid but this is stupid for where you are and I looked at and said yeah that probably is a little dumb all of my kids do it frankly I'm upset with myself

Jason

I can't stand it he's so dumb even this guy knows he said wait a minute the invented those gloves with no fingers

Meghan Markle

How the hell are we supposed to get by if we can't even steal spam oh I know we can go up to Tallahassee and that's where Michael too and Chris got a fast food meal is the only food there was

Trump

Yeah it's stupid I hear a lot of it still he said dumb job there's plenty of me to do he says people evacuating you help them evacuate you didn't help during the storm so you can help now they won't think you're a big dick like saying don't steal this when you're leaving cuz you don't have anything I think I'm going to do that I can do things as Governor to make it easier open the highway is up 24/7 and having security so people don't do bad things making sure there's no fires or putting them out if there are that kind of stuff keeping the highways clear but with regular tow trucks and yeah we know how to do it and I can also have a lot of stuff delivered he says basic stuff water and food even blankets and pillows I mean people going to be evacuated they're going to need survival kits on food for 2 or 3 days that's dry that's sealed and edible and I got to get to it like peanut butter and whatever they use these days that you can get I noticed something else we need campers down here now and trucks to move those mobile homes and placement companies to place people elsewhere and I guess I can I have to get on this I know how to do it and a way to move things we won't be able to use shifts with this big ship here but we can move place and things from other places I'm going to have to do it now for many huge apartment complexes we can move country wants to so a concrete ones and see what he's saying we need to police ourselves and stop the crime we're going to have to prepare for a massive evacuation I'm going to start working on it and we're going to say it's something else and that's my job I do appreciate the help and the constructive criticism which wasn't meant to help for my kids are probably helping say I look like s*** and I'm doing stupid things I don't want me to go down like this guy so really we're going to need even trucks and some possibly Air transport at some point we can move them from a state like Alabama you know this is going to work it's not a bad idea there's a whole thing you can do as governor and he'll have to stay but we're going to try and get it to him and it's it's some sort of message

Governor DeSantis

Good

Trump

We needed this we need to do this and I'm going to assist and I can help out we need to police ourselves and stop being pricks

Bja

Olympus it'll be a miracle but they like to evacuate and they like to be refugees so and they like to have stuff while they're doing it

They love being refugees it's one of their favorite things yeah but they like to have all their stuff together so they're going to talk to him about what he's talking about and how to do it and they're going to organize and it's going to be probably a fake disaster

Thor Freya

Go ahead Trump this is your area

Zues Hera

Already talked about it fake disaster okay that's what it is it's going to go up there

Trump

[anakinkinnie]

(Diora file 2, part1)

CHAPTER TEN : another fucking attack

The man's eyes flinched as they fell upon Aleksander. "He is Bastien" spoke Inara "the friend that sent me and Onora here." she continued. Bastien smiled "as glad as I am to be standing in a room with two kings and two queens—" he paused "Ah who am I kidding I've seen more miraculous stuff" he raised his eyebrows. "Bastien" said Onora "why are you here?" she asked "I have been sent by someone, you need to leave this place" said Bastien.

"Why?" Morgana asked "Look, I don't know why, I don't get paid for that, all I know is you have to get out of here" Darcy narrowed his eyes as he felt a rather familiar aura around Bastien. "We can go to Elios or to Malachi" Nevan suggested "I don't think Malachi is safe" said Morgana, Bastien sighed "no castle is safe" he spoke "all four castles are literally like big red dots on the enemy's map don't you think?" he asked rhetorically.

"The forest" said Onora "we can go to the forest" she said, Inara looked at her offended "oh come on, stop acting as if you hate them" said Onora "I don't–" Inara breathed "I'm not getting Christopher in our forest. He will probably murder everything and everyone." she continued.

"I don't mean to rush you but you really should leave" said Bastien "Like, right now" he added. "Hey, no mean to offend you or anything but we need to arrange stuff first." Nafre spoke to him. "No offense taken sweetheart" Bastien smiled "but you should evacuate the castle, right now" he smiled awkwardly. "Evacuate?" asked Kenna "Yes" said Bastien "why didn't you tell us that since the start?" Morgana asked furious "I thought telling you that you HAD to get out meant something to you all, I was wrong" he frowned "anyway, my part here is done, bye bye" he waved at them "wait—" Kenna spoke as the man disappeared in front of their eyes.

"Wow" spoke Eamon "he must be a powerful sorcerer" he stated.

"He is no sorcerer" said Inara.

Eamon looking as confused as ever.

"Yes all the chit chat is fine but we should really announce an urgent evacuation of the castle" said Nevan "how?" asked Lisa "Are you going to tell the people here that they have to leave their shelter because some disappearing man told us to do so without even knowing why we have to leave?" she stated. Everyone in the room except Darcy, Nafre and Morgana stood silent and blinky. "Yeah" he said.

"We can say it's an exercise" said Darcy "that's perfect actually" said Morgana.

"Someone also get Christopher here" said Lisa as everyone looked at each other "on my way" said Nevan already rushing his way. "Darcy, you make the announcement" Morgana demanded as she and everyone stood up, doing things quickly.

"Grab the things we will need" Morgana said as they all walked in the halls.

"What about Darcy's stuff?" said Eamon.

"I'll get it" said Nafre "go go" she pushed her brother to move faster.

They all met at the entrance of the castle, along with the rest of the people living in it or that were present in it at the time.

Lisa checking to see if everyone was here, taking attendance of every single soldier.

"Guys" she shouted "I still can't see Christopher and Nevan." she said.

"Shall we go in there?" Nafre turned at the rest of them. "She'll go" said Inara as she pointed at Lisa walking towards them. "What?" asked Morgana "I believe she meant to ask, why?" said Darcy. "Christopher is afraid of her, I don't know why but he is" she stated "he pooped his pants earlier when she punched him" she continued "she punched him huh?" Darcy looked over at her with an amused smile. Morgana punched his arm as he looked at her surprised.

"Who's going with her?" asked Onora.

"Kenna." said Darcy "Firstly because she knows the castle better than any of us and secondly because this way, a sorcerer that could create a magic shield any time she might need to, would be in there with them." Morgana nodded at his words. "Alright come" said Lisa as she looked at Kenna.

The both of them running their way into the castle. "May luck be with you" said Onora as she closed her eyes "they'll be fine" said Eamon "those two are actually deadly, no need to pray for them" he smiled proudly. Nafre hit the back of his head "let the woman pray idiot, that is something she chooses to do" she said. Onora giggled at Eamon's expression.

"Christopher what is this nonsense" Nevan spoke.

"I'm not going anywhere" Christopher said "I don't care if this place turns into ashes, disappears, falls down, I am not leaving." he paused "not with them, not with you" he added.

"Come one now" Nevan approached "are you going to leave your men without a king?" he asked "the women too" said Christopher "Why leave? Just because some guy told us to leave? There's no way I believe him." Christopher continued.

Nevan only looked at him "why do you hate them so much?" he asked, his tone soft, his eyebrows slightly raised as his gaze was pitiful, looking right into Christopher's eyes. Christopher looked at Nevan, his stomach twisted at his puppy eyes. "they're evil" Christopher spoke as he looked away, avoiding Nevan's bright blue eyes and the empathy; the empathy Nevan showed towards him. "You should give them a chance" said Nevan, his vocals always soft "they are good people" he added, Christopher grinned very slightly.

Lisa entered the room "Where is he." Christopher flinched at the sound of her voice "Nevan, let's go hide" he grabbed Nevan's arm "Wha–" Nevan began to speak "Keep her away from me." "What is the matter with you?" Nevan looked at him.

Lisa and Kenna stood in front of them "we have to leave, everyone has evacuated the castle" said Kenna "That's great. But he doesn't want to leave" said Nevan as he looked at Christopher and so did everyone else. "He has got a point" said Kenna "how can we know this Bastien guy is telling the truth" she continued "Christopher looked at them "we are leaving." he said as he walked first waiting for the others to follow.

"Are you sure you asked him to leave before?" Lisa looked over at Nevan who stood, error was written all over his face. "I swear I did" he said. "Who cares now, let's leave" said Kenna as they all walked towards the exit. Following Christopher's fast steps.

"Alright all the soldiers have made their way to the village right there" said Eamon.

Nafre stared at the crowd leaving, making a bigger distance with the seconds passing.

Darcy scanned the area around, cautiously checking anything that could mean danger.

He kneeled down placing his hand on a large footprint, one that looked like it had been trying to get erased, he traced his fingers across the foot print, searching for any other ones.

"Guys" Inara spoke "Guys!" everyone looked at her as she was looking at the castle. "Why the fuck is it trembling." said Nafre. The castle began to fall apart as they all freaked out not knowing what to do "earthquake?" said Eamon "and why the hell aren't we moving?" said Morgana.

Darcy sighed so relieved at the view of Kenna having a shield around everyone as they rushed to get out, pieces of stone falling to their sides.

The castle had  corrupted to the floor by now. And as everyone seemed relieved to see they had made it out their hearts dropped at the view of a Dragon emerging from the ground underneath the castle leading to the caves. A humongous, breathtaking beast roaring as it flew up and up taking more of the high ground.

They stood practically jaw-less as they gasped, pathetically for breath.

"I have clear view of the target" the rider of the dragon shouted as he looked at his side, Deimos flying, spinning at times showing off. "you know what to do." Deimos flashed himself further from the dragon.

All of them had froze. Inara and Onora began to chant a powerful protection spell.

"Not enough time for that." said Eamon as he waited for the Dragon to get lower, attacking it with fire.

Nevan and the others approached soon enough, fear in their eyes. The magical attacks weren't strong enough, any attack was not good enough as they all did not have the quality to think straight at the moment.

Darcy jumped clinging onto the Dragon's foot, climbing his way up as the Dragon flew higher.

"We've got visitors my boy." said the man riding the Dragon as he observed Darcy's movements.

Deimos found himself down knocking out Inara and Kenna who casted the protection spells, Onora attacking him with fire and explosions. Maintaining balance in the fight, Deimos smirked, knowing damn well he only needed to occupy her, and to him that was an easy role.

The Dragon fired the floor, not catching anyone as if it was missing aim on purpose. The rider dragged Darcy upon the Dragon, punching his face, Darcy dogjed eventually, looking at the man right in the eyes "Malachi?" the man smirked as his fist fell upon Darcy's face once again. Darcy dojged making the man land a fist on his Dragon, the beast groaned as Darcy smirked at Malachi's surprised face.

Nafre watched as she smiled "Good job beasty." she mumbled as she rushed to Kenna, dropping down on her knees, holding Kenna. "Alright Nafre, you got this." She closed her eyes, as she moved her hands around, a small shiny ball of a magic shield now surrounding them.

"Listen to me" Onora spoke, her voice echoing inside everyone's minds "We cannot win this. We are not ready yet, escape and get to the forest as soon as you can.. Don't die." she finished as everyone seemed to agree.

Darcy looked around him finding himself standing in a dark cold room, reflecting the aura around him. He scanned the empty darkness before he found Malachi standing there, looking at him, his stance proud as bravery and confidence surrounded him "my child" he spoke "please don't tell me you're my father too." Aleksander couldn't help himself but speak sarcastically, Malachi laughed slightly "oh Aleksander, funny boy. You and I are far more similar than you can imagine." he said. "Really?" Aleksander's tone did not change. "And here I am thinking I'm not a mass murderer" he continued as Malachi approached him, the smile from his face fading.

Disappearing and appearing right behind him he grabbed the back of Aleksander's neck as he made him turn his head to look at him. "All you've ever known, ever since you were a child; neglect." Malachi whispered in his ear "feared by everyone while they didn't even bother to ask your name, for they knew it already" he kept going "poor little boy grew up with no friends, not feeling worthy enough to be around anyone for long, even his father" he distanced himself as he put his hands behind his back, still talking.

"left out, finding comfort in being alone. An adult since he was merely a five year old, for everyone's expectations were too high. A king at eleven due to his father passing. Destined to live a life he didn't want, a boy that would love to live as he lusted,  be happy but; that would disappoint everyone, because of that he chose to live for others, hating himself, to keep them happy." Aleksander only looked at him, directly in the eyes "someone who didn't know love, not a single kind of it, dreamt of it as if it was a thing you cannot achieve" Malachi's face serious and rather sad "you're on the wrong side, Aleksander."

he said, his face close to his ear, Malachi inhaled calmly as his hand wrapped around Aleksander's neck.

"I can sense it" he breathed "such divine, menacing power," his grip tightening "oh the lust you must be resisting." His hand now freeing the boy's neck as he takes steps back, distancing himself.

"I can help you" he bragged, as if he was inviting Aleksander over, Aleksander frowned as he shook his head, coldly rejecting his offer.

Malachi said,

"You know where to find me when you understand . The beast inside you knows." he grinned in amusement.

Malachi threw Darcy off the dragon as he had achieved a long height distance from the ground "You'll be fine, think about my proposal." Malachi smiled as he watched, riding towards the center of the battlefield.

Eamon caught Darcy in the air "I got you." he said, only then Darcy snapping out if it. Nafre and Nevan carried Kenna and Inara on their backs "we will meet you there" Nevan screamed. Nafre shielding all of them, exhausting her untrained self.

Deimos smirked as he looked at Onora, he placed his hand on his forehead, saluting her as he winked and disappeared.

They observed as the Dragon flew too close to the ground, Onora closed her eyes as she prepared a large attack. The Dragon was getting closer, closer, closer each second.

Darcy's heart lost count of beats as the beast got closer and closer to Lisa, his eyes widened as he screamed at the view of the Dragon wrapping its teeth around her, tearing her apart. Darcy screamed, shadows emerging off of him, his body shaking as he raged, as he tried to break free off Eamon's hands. Eamon struggled, he struggled dearly but he managed to hold him back. "She is gone. It's over man" he spoke to Darcy, Eamon clenched his jawline, breathed heavily, not wanting to cry.

All of them stood, fear and pain shattering their hearts. "Holy Fuck" Nafre breathed.

"Morgana be careful—" Nevan shouted at the top of his lungs as the Dragon consumed her too. Nevan's whole self froze as he kept on running, not knowing what he was even doing, he was lost. He fell, his body hitting the ground like he had no control of it. "Fuck." Nafre stopped as she waited for him to get up.

Nevan got his shit together, put things aside, he couldn't let anyone else die, he ran, recklessly ran as Nafre followed.

Christopher dropped on his knees, moments flashing before his eyes.

Onora opened her eyes at the moment the beast was about to attack Christopher as he was defenseless, her attack was ready. A massive explosion hit upon the beast's head, making it drop on the ground. Christopher had no clue what was happening, he only stared at the ground with wide eyes as he got paler and paler.

Onora grabbed him and began to speak in everyone's consciousness once again "run." She said. As everyone did so. Getting away from the battlefield.

     Two; there were two losses that day.

Nevan, Nafre, Inara, Kenna, Onora and Christopher were the first to arrive at the forest. Eamon and Darcy arrived later, the day after. Christopher had passed out, and when Eamon arrived he was still asleep.

In the battlefield, there lied Malachi on the floor, laying as he looked up at the sky. "They killed one of my babies" he said now looking at his Dragon. "You mean my babies, I created them." said Deimos "oh fuck off" Malachi rubbed his face, wiping the dirt on it "Let's leave now, our plan worked out." Deimos rose up to his feet.

"So those girls are dead huh?" asked Malachi as he himself stood up. "Yes, the dragon might have been one of my illusions but it did snatch those two didn't it?" Deimos spoke. "Now our plan is far simpler" Malachi grinned "though I could pay a visit to that village before we leave, I'm kind of starving" he said. Deimos scoffed "I'll be in our castle." he said "you go on your blood party" he added as he left.

They both left, Malachi later, and as they did Bastien arrived, looking at the Dragon. The Dragon disappeared shortly afterwards "finally" said Bastien as he kneeled down at the two female's left there. "Ah I don't get paid enough for this." he leaned down towards their way "Hello girls" he spoke at the corpses, the two ripped lifeless bodies in front of him. "I have a lot of work to do with you two." he kept on mumbling to himself as his hand held Lisa's face.

The females woke up in an dark cave, decorated only with candles,torches, a cauldron and a big hole filled with liquid in the middle of the place. Such a disturbing yet warm aura.

Lisa looked around, trying to figure out where they were, slowly the gruesome memory of Deimo's attack clearing out in her head, her eyes wandered around and eventually she looked at Bastien in confusion "did you save us?" Morgana asked. "No you died" said Bastien making them think he was being rather dramatic. He looked at them "oh no you actually died, like dead died" he assured them "the thing is you came back to life." he continued, Lisa and Morgana looking at him as he was spitting nonsense facts. "Congratulations, you're The Light." "The what?" asked Lisa "the Light" said Bastien.

Bastien sighed "please don't tell me I have to explain that too" he scoffed as they both waited for him to start. "The prophecy speaks of a promise to the mighty powers,  two children born and promised to be used for the greater good, the children live their lives but when they die they come back to serve the good, be the Light. They shall fight against the dark to defeat it and in the end one of the two forces gets defeated leaving the other one to fade." he spoke "of course that is not the known legend, everyone knows a different one instead, the Light is two newborns promised to serve the good throughout their life, during that time, they shall face evil and only one force remains." he added "that is the known version, though it is false." he smiled.

"So me and her" Lisa pointed at Morgana "are this Light?" she asked "Yes, apparently the sorcerer that knew both your families promised the both of you to the mightier, perhaps just in case things would not go as planned, you were both born at the same year right?" "1430" said Morgana as Lisa nodded "and the date?" Bastien asked "20th of October?" said Lisa as she looked at Morgana, Morgana nodded. "Then that's it" Bastien said.

"How do we know you're not joking right now?" asked Morgana looking at him. "Well I wasn't lying about the castle was I?" he raised his eyebrows, Lisa narrowed her eyes "Yes, but, how do we know you are not wrong?" she asked.

Bastien nodded as he helped her stand up "could you, think about blasting this tree right there while pointing at it with your pinky?" he said, Lisa nodded doing as he had told her. She flinched at the view of the tree blasting and her finger radiating a laser-like light. Bastien smiled as he began to speak "the fighters of the Light get gifted powers that work with light, for example fire, thunder, lightning, any beam, you know shiny things, while the dark, it usually works with shadow, water." he paused "Ironic isn't it? Since most people portray water as the good element" he raised his eyebrows "And that's not all there is" he spoke "what was your favorite fighting activity before, love?" he asked "combat, swords" Lisa replied, he grinned "now your combat and sword skills will be effective against demons too" he said, same for you he looked at Morgana as he helped her up.

Bastien began to walk away. "Where do you think you're going?" Lisa raised her eyebrow. "Leaving" said Bastien. "I don't think so." she said "you'll be explaining all this stuff to our friends, there is no way we are." , Bastien sighed "about that" he spoke "I have to inform you that you were sleeping for two months." he said "I've put a cloaking spell on us and stayed here with you" he added "two months?" Morgana asked "did the others defeat Deimos?" she continued. "Uh not exactly" said Bastien. "What? Why?" Morgana asked again.

"Well first of all, you were missing" he pointed at Lisa "you were their potion maker, remember? Now they've put someone else to study botanology, with Onora's help" he said "Plush the forest had gotten attacked before they arrived there, every druid is dead, so only Inara and Onora can help them."

"Wait a minute" said Lisa "you mean to tell me all of this was happening and you waited here with us for two months? Waited here with two girls that you weren't even sure would be that Light?" she asked as she narrowed her eyes.

"Listen" Bastien began to speak "I'll explain" he continued "We're listening." said Lisa as she pointed her finger at him ready to blast him, Bastien grinned "I shouldn't have taught you that" he said "speak." Lisa demanded. "You remember the thing we said, about the person who promised the both of you to the Light's purpose? Yeah that was me." he smiled awkwardly "You?" Lisa raised her eyebrow "Yes, I was hired to do so." he said "and honestly I hate the fact I had to travel to this universe so many times." he mumbled.

"Why didn't you say that earlier?" asked Morgana "well obviously because it's not even important." he stated, "Yeah he is right, that is not important" said Lisa "now could you be a gentleman and take us to them" Lisa smiled, as she batted her eyelashes at him, he rolled his eyes.

Bastien showed them the way, took them there, quickly. The women arrived there along with the man escorting them. Onora lurked to see who was invading the forest, her jaw falling as she recognized the two thought to be dead ladies.

"The forest looks like shit" said Morgana "the dragon must have attacked here first, before attacking our castle" she spoke.

Bastien had been ignoring their talking ever since they had started heading there, so he kept ignoring them, once he knew they had reached a spot close to the druid's little village inside the forest he just disappeared "Motherfu—" Lisa sighed and then looked back at Morgana "he is a bloody idiot." she said, Morgana nodded.

Nevan noticed the two of them walking towards the village as he was collecting water from the river, he dropped the bucket and pulled his sword out yelling "who are you???" his eyes softening as he recognized them.

He remembered the day of the attack, how he came here after it, how he began to scream and cry as everyone just watched him with sad eyes, how Eamon held him, trying to make him relax. Christopher only stood there before he walked away unable to see Nevan that way.

Nevan's eyes began to water, as he ran their way, hugging the both of them, jumping on them making them drop on the ground as he held them. Morgana giggles as she sed tears herself, she couldn't understand why but she kept crying, allowing her tears to fall and her breath to quicken.

Nafre and Darcy had been practicing a few meters away; sparring. They had rushed to see what Nevan was yelling about, now seeing him on the floor on top of two other people.

They looked at each other before approaching. Darcy grabbed Nevan off of them as he only observed him, he didn't feel the urge to look at the people on the floor until a familiar aura travelled across his veins, making him shiver.

He mechanically offered his hand to the girl on the right before noticing her and as she grabbed his hand his gaze softened once his eyes fixated on her, the view, his lips parted as he felt deceived at the moment; as if he was dreaming.

Nafre had already helped Morgana up, hugged her even as Nevan stood smiling behind them, overjoyed. Morgana and Nafre looked at Darcy and his reactions, how strange he acted around Lisa, they had noticed before too, now they looked at each other as they raised their eyebrows.

Lisa was looking into his eyes as she was trying not to smile but her eyes did differently, they gave away a slight warmth. "You're" Aleksander paused "here" he spoke.

"Isn't that awesome?" Nevan spoke breaking the moment. Aleksander finally let go off Lisa's hand as he looked away avoiding her image to be caught by his eyes.

Nafre hugged Lisa, Nevan hugged Morgana, once again.

Aleksander had already began to walk away, rather embarrassed, not knowing how to act, heading back to practice, anything that would keep him away.

Lisa melted at the view of a giant scar in the back of his neck. "He got that while preventing himself to turn" said Nafre as she observed Lisa's face. Lisa's eyes saddening slightly. "Why don't we gather everyone and we will tell you what's going on?" said Morgana, changing the subject "perhaps you could tell us what has been going on as well."

                                   V

All of them, Nevan, Morgana, Nafre, Eamon, Lisa, Kenna, Inara and Onora sat around a fire, Darcy wasn't there. Lisa and Morgana explained everything Bastien had told them.

"So he told us we are the Light some profecy speaks of" said Morgana "Yes" said Lisa "though he is not telling us something, I'm sure" she continued "what do you mean?" Inara asked "Well" Lisa began to speak "why choose us?" she said.

Onora narrowed her eyes as thoughts filled her mind.

They kept talking about the prophecy until the subject changed, Lisa and Morgana explained them everything about it, now they were talking about other matters, how the world had changed, how their world had changed.

"Wait, Bastien didn't tell you?" Kenna asked "not only the forest, everything has been attacked" she added. "What?" Morgana turned to her "It's true" said Nafre "the whole land is corrupted, full of monsters here and there, dead people walking, werewolves, vampires, skinwalkers, rippers, demons" Nafre continued. "Yes, people remain alive, but they hide, they are spread all around the Kingdoms." Nevan completed.

"When did this happen?" Lisa asked "around a month ago, maybe two." Nafre replied "Yes Deimos apparently had enough power to free some demons and then when the land was destroyed, slightly, and the rumors spread about the loss of control in the Kingdoms all the monsters felt the confidence to get out, apparently they all are on Deimo's side now" said Nevan "yeah except for the dead people, they don't have minds, they're just dangerous and make people scared so they automatically give strength to their master by producing fear" Eamon spoke.

Morgana nodded in shock, she then narrowed her eyes "where is Christopher?" she asked as they all remained silent for a while "he left us" said Nevan "he wanted to be alone" he added "you know where he is?" asked Morgana "no clue" said Eamon. "And we cannot track him, he either has placed a cloaking spell on himself or someone else has, but that is strange, for him." said Inara. "And Darcy, why is he not here with us?" Morgana asked, everyone turned around, suddenly finding the grass, the trees, the mud, interesting. Everyone except Nevan "Darcy is here" he spoke "you saw him earlier" he added. Nafre slapped her face in disappointment. Inara turning to Nevan and speaking softly said "that is not what Morgana meant." Nevan nodded, confused.

"He is" Kenna paused "busy." She continued. Morgana almost nodded but Nafre spoke, making her rethink her action "must we lie to them?" , Morgana and Lisa looked at each other once Nafre's words were spoken. Kenna sighed as she began to speak "Bastien, visited us while you were gone. He came to speak to Darcy, specifically" "And what did he tell him?" Lisa questioned. "We have no idea" said Nafre, Eamon sighed "I know" he said, Nafre turned to look at him offended.

Morgana raised her eyebrows "And? What did he tell him?" she asked. Eamon looked at Darcy's cabin and then back at the fire "Darcy is cursed, we all already knew that. But what we don't know, and what he didn't know either, before Bastien told him, is that, Darcy isn't only cursed to turn into a beast once in a while, the real curse he carries is immortality. He cannot die, like ever" he said "and how do you know all this" Nafre's tone full of judgement and disbelief "I misheard them talking." Eamon spoke with pride "misheard" Onora mumbled before she scoffed a laugh, Eamon gasped in silence.

Lisa set her eyes upon Aleksander's cabin before, her eyes saddening slightly.

"But yeah, ever since Bastien and him talked, Darcy has been distant, not cold but distant, he isolates himself, more than he used to" Nafre spoke. "I see" Morgana sighed as she sat back.

They all sat in silence for a few more minutes, enjoying the night breeze, the fire protecting them from feeling cold, awkwardness not allowing them to speak more words.

Kenna placed her head on Nafre's shoulder. As Nafre placed her head on Kenna's head, both of them resting. Lisa smiled at the view, glad Nafre's hopes had come true. Nafre would talk about Kenna to her everyday back in the palace, complain about how Kenna made her stomach move and her lungs pop.

After the attack at the castle, when they arrived at the forest, Nafre watched over Kenna until she would wake up. She did wake up, hours later and the first thing she did was to approach Nafre, she held her hand before looking up into her tired eyes, Nafre's cheeks flashing red gave her courage for her next actions, Kenna held her face and kissed her. Not wanting to lose any of the time they had together. Nafre melted against Kenna's lips, she wasn't like that, Nafre had the dynamic, she was the cold and mean but golden hearted kind and Kenna knew just how to make her heart twist, and as hard as it is to believe considering Nafre's personality, Kenna was the one to hold the dominant title in their relationship.

Eamon raised his glass breaking that awfully awkward yet comforting silence "I think it's time we celebrated our friends returning from the dead" he suggested, pouring wine for everyone.

Nafre and Kenna soon excused themselves heading to their cabin, Morgana and Nevan talked for hours, Eamon annoyed Onora and Inara but then they all started telling stories to each other, Lisa was listening too but she wasn't able to focus, wine had practically replaced the blood in her veins.

Lisa's eyes fixated on the cabin that a  light could be seen from, a candle flame burning so bright. Her actions influenced, she stood up, slowly walking toward the candlelight.

She entered the cabin finding Aleksander sat on a desk, scanning pages of some book, he looked so focused he had lost himself in there, entirely absorbed by the information he was reading.

Lisa approached him and he did not even realize she was getting close. She placed one of her hands at the side of his neck making his eyes go wide as he shivered, checking with the corner of his eye who was it that interrupted him, she leaned her face towards the scar on the back of his neck, pecking it softly. Aleksander's skin burned, he melted as he froze, Lisa rested her head on his shoulder as she now pressed a kiss at the side of his neck, closing her eyes as she hugged him.

Aleksander seized her hand off the side of his neck and stood up slowly, holding her gently, she placed her hands on his cheeks as she looked into his eyes, her cheeks were red. She caressed his face, now her hands had made their way on his nape, pulling his face closer to her own, Aleksander placed a hand in front of her lips, not allowing her drunk self to do something she would later regret, not taking advantage of her.

He held her by the hand, preparing her his bed for her to sleep in. He tucked her in, covered her up and made his way back to the desk.

He found the spot where he had been interrupted and kept reading the book, few minutes later Lisa's voice interrupted him once again "what are you reading" she asked, her tone so tired, raspy. "A Book" he said "No shit" she scoffed lightly. "How was your day Lisa?" he asked, trying to make her fall asleep by tiring her. "Good" she answered "Why don't you tell me about it?" he said, Lisa hummed a no but then she also spoke "you won't be listening to me" she said "you just want me to fall asleep as I get more exhausted by talking" she continued.

Aleksander smiled "goodnight Lisa" , Lisa scoffed louder as she fell asleep while observing Aleksander and his insisting focus on that damn book.

She awoke in the morning, a terrible headache making her feel as if the veins in her head were constantly pumping. "I hate wine" she mumbled as she rubbed her forehead, fixed her hair.

Lisa then realized where she was, remembered her actions from the night before, yet she didn't care as she could just pretend she didn't remember anything. Her eyes fell upon Aleksander's body asleep on the chair, his head and hands on the desk, his head specifically placed right next to the opened book.

She raised her right eyebrow, taking the chance to sneak a look at the book he so felt the need to read. The urge to tease him by waking him up just to see his moody face left her body as soon as her eyes read the title, recognizing the book.

"herbs of life" the title read "botanology." she whispered to herself. She bit her lip trying not to smile as she kept digging the stuff he kept upon the desk. Notes, notes everywhere, about herbs that cured, diseases, herbs that lived longer, ones that died faster, about chemistry. Lisa couldn't fight the urge, she sighed a soft smile as her gaze slid on him.

Onora entered the cabin pulling Lisa out of her thoughts "There you a–" "shh" Lisa pointed at Aleksander sleeping, she approached Onora and took her out of the cabin. "What is it?" Lisa whispered to Onora "it's about the prophecy" said Onora as she took Lisa a bit further, so that no one would hear them. "What about the prophecy?" Lisa asked as she followed her,

"There is no such prophecy" said Onora "I wanted to tell you yesterday but I did not want to worry the others about it. The prophecy does not speak of two children that were born to become The Light, it does speak of two people that are destined to become it but it does not mention how they become the Light. Now, I did sense Morgana, she is one of those people" she paused as she looked at Lisa "I don't know what the hell you are though." she continued.

Lisa looked at the sky as she narrowed her eyes "I will definitely blast that guy." she said, Onora giggled "Do not hold a grudge against Bastien, he is only hired to do what he did to you." she spoke, "I thought he could choose to accept the jobs he is offered?" Lisa looked at her "Oh, no" said Onora "Anxos are hired to do some jobs yes but they all have one master, somewhat of a sire. They have to follow everything that their master demands them to, plush they cannot do anything without their master's permission, basically they have no freedom, no free will" she continued, Lisa raised her eyebrows "you don't say."

CHAPTER ELEVEN :  no title for real

At Elios kingdom Malachi strode his way through the halls as he had just got done with another one of his feeding parties. He entered the throne room as Deimos awaited for him, his hands behind his back as he looked at him, Malachi's steps became slower as he approached and halted.

"I'm afraid I have unpleasant news for us" Deimos said as he looked at the miniature of a kingdom he had built to observe the life line's of their enemy. "The two girls are alive" he spoke, Malachi looked at him in anger and question "their presence was here again, since yesterday" Deimos continued "how?" Malachi's anger took over the calmness in his still low tone, Deimos stood clueless. "You mean to tell me that not only the doctor but also one of the two is also alive?" Malachi approached the miniature, stood over it "So now both of that fucking Light people are alive? I should have known better. " he bared his teeth.

"We should have killed both of them back then." he rumbled on. "Why are you freaking out, they're just two people." Deimos stated "One of them just came back from the dead Deimos. And we still don't know who the second person is, it is unclear." Malachi looked at him straight in the eyes "still" said Deimos "Do not underestimate our power, all of the dark side is with us." he added "we shouldn't underestimate them either." Malachi snapped calmly.

Deimos nodded, he smirked "you have me on your side and I will not accept defeat" he said, Malachi looked at him "and don't forget what you promised me for me to accept working with you once again." Deimos grinned "I was fine left alone all those years, it was you who summoned me with a new offer." "Don't fret me, Deimos." Malachi said "A deal, is a deal." he finished.

Deimo's face turned into a pleased one as he began to walk away "we have visitors, fellow friends of yours" he said "Vampires?" Malachi asked as he sat on the throne. "Vampires, witches" Deimos spoke as he left the room. "Have fun with the boring ones, meanwhile I'll be entertaining myself" he continued "and then you call humans sex addicts." Malachi mumbled to himself mocking Deimos. "I heard that." Deimos spoke while fading away.

The sun shined, shined goldly upon the little village into the enchanted forest.

A calming breeze travelled across, from tree to tree, leaf to leaf.

Darcy was practicing near the lake, along with Nevan and another girl, her red hair being complimented by the sun, so shiny.

Morgana and Nafre sat observing, tired by their own practice, they had woken up before everyone else, practicing along with Darcy first thing in the morning.

"Who is that girl?" Morgana leaned and whispered to Nafre. Nafre whispered back "her name is Elinor, she is a witch, she used to work for Deimos, Malachi, for the dark side,but, not surprisingly they did not treat her very well. Darcy found her hurt on his way here, we decided to take her with us." Morgana nodded as she observed.

A playful feeling taking over Elinor as she pushes Nevan into the river, laughing softly. "You don't have to be jealous you know" Nafre mumbled to Morgana "I'm pretty sure she is not interested in him" she continued as Morgana almost gasped at being caught.

Nevan got out of the lake, an angry pout on his face as he managed to keep his cool, Elinor turned around to look at Darcy who very slightly chuckled at her gesture to Nevan. Elinor smiled tenderly as she then looked back at Nevan and helped him find his sword into the lake. "Lisa is not gonna like this" Morgana mumbled to herself quietly "what?" Nafre asked, not having heard Morgana's words. "I said, 'the weather is always like this?' It's lovely." Nafre raised her left eyebrow "Yea, right"

"What are you two fussing about?" Darcy took a seat next to Nafre "fussing? I was not fussing about anything" Nafre raised her eyebrow once again as she threw her eyes on Morgana for a second. "I was only commenting on the weather" Morgana raised her eyebrows "And the weather, is a cloud's name Lisa or something?" Darcy stated smoothly, Morgana's jaw on the floor as Nafre began to laugh not caring about her surroundings, she laughed so hard she ended up on the floor with her hands on her stomach.

"What would Lisa not like?" Darcy asked, not too recklessly, as he cleaned his sword, clenched it with his other blade. Morgana's face fell serious and yet awkward as she spoke her next words "the weather, she would not like the weather."

Darcy grinned slightly as his eyes shifted on her"If I didn't know you liked Nevan I would say you have a thing for the weather" he spoke, his grin still there, Morgana pinched his shoulder as he chuckled. "Do not tease me." she demanded as she avoided eye contact, Darcy sat closer as he eyed her once again "Do not worry about Elinor, she is just glad we saved her and didn't leave her to die. I am sure she has no such feelings for any of us" he paused "As I am also sure Nevan sees and hopes for nothing but friendship with her." a small smile curved on his lips, Morgana felt amused, she hadn't seen that sarcastic man in two months, he hadn't changed, or at least he didn't show he had, like always, hiding his feelings.

[rottingfontanels]

24 june 2022

1

good morning. it's currently quarter past 10am, and i just finished my morning routine. it's a pretty small routine– i get up, brush my teeth, take my meds, wash my face, moisturize my face, and put on lip balm. then i'm all set to do whatever!

the past few days have been a bit difficult. i had three or four really amazing days, and then as soon as i got home to rest, i spiraled and ended up in a depressive episode. my routines were out the window. it reminded me a lot of when i was in high school, but this time around is a lot better even if it's still not good.

even though my mental health has been rough, yesterday i did some good things. my dog woke me up at 6am, so i got up and made sure she had everything she needed. since i was already up i had a bowl of cheerios. this is pretty big for me, since i hardly ever eat breakfast and have an overall bad relationship with eating. then i went back upstairs to relax and at some point ended up dozing off. i'm pretty sure the previous night i had gone to bed at around 1 or 2am, so napping after waking up at 6 makes sense. i woke up from my nap around 2pm, pretty upset that i wasted the day.

so i decided to un-waste it! i got dressed and went on a walk. there's a really lovely place near my house with lots of greenery, bugs, and wild animals. i walked around there and went to my favorite spot: a tree overlooking the marsh. i sat under the tree for a while, got bitten by a caterpillar twice i think, and then climbed the tree to read my book. it was really nice!

i even had some good creative ideas!! i'm currently writing and sketching out some stuff, and even thinking about rewriting this thing that i'm into that wasn't made in a text medium. i would take quite a few creative liberties and overall try to make it into a genuine book-level story. worldbuilding, setting those rules, et cetera. it would be really fun... but the first thing that comes to mind is how fast i would be to abandon it.

anyway, after my walk i got home, talked on discord a bit, drew, and then made dinner! i made kraft mac n cheese. it didn't taste very good, but i was super hungry so i ate a lot of it anyway. usually in my house, whoever cooks a meal for everyone doesn't have to do the dishes. my mom ate with me. maybe it was selfish, but i kind of expected her to do the cleanup afterwards. all that was left was the strainer, wooden spoon, and pot with the leftovers. but when i went downstairs to lock up around midnight the pot was still on the stove with the leftovers in it. i felt really sad about that. it feels like a waste of food.

i know this is bad of me, but i didn't put the leftovers away then either. i just went upstairs and went to bed. i haven't been downstairs yet this morning to see if the pot and leftovers have been put away.

i also had a really vivid dream last night! my dreams are hard to describe but i'll try to lay it out in a way that makes sense...

so initially it took place in this big skyscraper-like building in a downtown area. i think it was supposed to be some kind of summer camp, but the camp counselors were exploiting the kids who were sent to the camp (i was one of the kids). instead of activities, we were forced to stand at standing desks with computers, handcuffed, and draw the counselors' characters for some kind of promotional thing. all of us were struggling with drawing. we were hungry and tired and scared. the counselors were really, really scary.

at one point, i was looking around the different keys on the keyboard and pressed f1. the building's alarm went off. the f1 key must have been linked to the alarm system, and immediately i was utterly devastated. i don't think i've ever felt such helpless fear as that moment. i knew that once we were all evacuated and the counselors found out it was a false alarm, they would find whoever tripped the alarm and punish them. i don't remember what exactly i thought would happen, but i know it would hurt, and that i might even die.

as we made our way down the stairs and out onto the sidewalk right beside a main road, i was having a meltdown. i sat down on the pavement, wailed and screamed, and scraped my bare feet against the concrete until i had ground away the bottoms of my heels. i was bleeding now. i knew i was going to die. i had to do something. i was already going to die, so i decided screw it.

there were cars going by on the main road. i threw myself onto the curb, waving my bound hands and screaming for help. most of the cars kept driving, but one stopped. i tried to tell them everything– how we're trapped, they're hurting us, this isn't a summer camp, everything. but i was so frantic that i couldn't articulate it very well. the worst part was that even though the counselors are terrifying and mean and hurt us, they never left bruises. i had no physical evidence of their wrongdoings. my bloodied feet were concerning, but i had done that to myself.

the car drove away. i think two more cars stopped and i tried to tell them as well, but with the same results. finally the counselors rounded everybody up, including me. the dream goes blank at this point– i assume we were all taken back inside.

that was the main part of the dream. after that, the scenery changed to a huge building in the woods. all the kids were still in a bad situation. my feet were bandaged, but for some reason only my left foot was ground down at the heel. i walked with a limp. i think i also wore a long off-white dress, something very plain and simple. i think i was tasked with helping the younger children. i think i might have been a girl at this point.

some strange things happened, all warped by the dream. i escaped. my point of view started switching back and forth. at this point i think it's too confusing to explain, so i'll end the recounting there. that was my dream last night.

when i woke up, my eyes still closed, i genuinely thought that i would open my eyes and find myself in a twin-sized bed in a massive room filled with other beds with the other kids. i thought i was there. it was kind of scary, actually. i'm glad that i'm here now.

what's my plan for today?

i'd love to go on another walk, climb that tree again and read my book. but i really need to do laundry. i think that as soon as i post this, i'll gather up dark clothes and do that load first. then once that's washing i can tidy up the kitchen if it's not clean already. we don't have bread to make toast– i'll have some tea instead. then i can carry on from there. i should brush my dog too.

i'll mention now that i haven't proofread this entry. probably silly since this is the very first entry, but i'm not in that mood. i'm in the mood to dump out all my thoughts and feelings and be done with it. consider it organic!

okay, i should go now. bye, i'll see you soon!

[icewindandboringhorror]

hgghhhhhhhhhh...............smonk ..............

#I can barely see out the window lol... #With the wildfire smoke making the air quality so hazardous it almost feels claustrophobic like.... normally if you can't breathe well you #can just open a window and get some fresh air - but in this case there's literally nowhere to turn for fresh air #if the air inside your home gets worse or anything then that's it #Like if i burnt toast or something I couldn't air out the place.. I would just have burnt toast in the air forever now #which is a bad example ghghj but you know what I mean #Especially because I think I might be sick and am having slight chest pressure and coughing and congestion #all I want to do is breathe good clean crispy air and feel comfortable but it's like HGHj what am I going to do.. open a WINDOW?? #I hope my symptoms don't get worse or that if they do it's around the time that the smoke clears up and etc. #so far I think they said it should be getting a little better by monday but that feels so far away #plus it's summer so the air inside is like... warm and muggy and uncomfortable but the air outside is worse. I guess I just don't like #feeling trapped lol.. but ANYWAY .. #you know those photos of the surface of mars or whatever where everyhting is all yellow/orange? that's like literally #the view outside of the window. it feels like another planet and is so weird #we also might have to evacuate at some point so I need to take stuff to the car (though my area is not even a level 1 i just want #to be ready? especially if we had to go in the middle of the night like.. I'd rather pack a few things into the car then than now) but I'm #afraid to open the door and also to go outside in general lol.. #I also need to water my poor plants but I don't want to open the door long enough to do so lol... I am so sorry my children.. TuT #(for reference I'm around portland in oregon so that's the specific area out of the list that I'm talking about ) #*'now than then' lol not 'then than now' .. I mixed them up .. whoop

[mysterylover123]

Mysterylover watches MHA: “TDBKDK Family Dinner #2: Anime Version”

So yes last episode we did cover the first half of the family dinner. Now we’re covering part 2. BTW this music is BIZARRE. Why are we recapping all this angst with triumphant music?

Anyway so let’s talk about this arc in general. Since I already posted about the manga chapter, I’m not sure what to add about the anime episode other than “hey, music choice” or “line delivery”, but I’ve reread this arc a lot so I feel like I wanna analyze it instead.

3. Let’s talk about Bakugou. Bakugou’s arc throughout most of the series has been all about learning to care for other people. Learning the “save to win” part of things. He comes to the internship wanting to find “what he was missing”. In the climax, he rescues Natsuo from Ending. But the odd thing is, Bakugou already showed in the Joint Training arc that he was capable of saving people now. So it wasn’t that he needed to learn to save.

What Bakugou got from this arc, many fans believe, was the realization that he mistreated Deku and needed to make amends. All Might at the start of the arc points out that Bakugou is like Endeavor. This comparison was probably one Bakugou was making since the Sports Festival when he overheard Todo’s Backstory Confession to Deku. And here, Bakugou witnesses exactly what being an obsessive, violent asshole who pushes their loved ones away to become the top pro will end up with.

Complete alienation. A family who will never forgive him.

And Bakugou, I believe, wants Deku’s forgiveness and friendship back. He pushed Deku away - he admits to bullying him and hurting him in Chapter 284. And he’s trying to atone for his actions. From this arc, Bakugou learns that he needs to make things up to Deku. He doesn’t say so explicitly, but that’s what most fans take from it. 

Endeavor can never truly make it up to his family, it seems, for all he did. Natsuo will never forgive him, Shoto probably won’t either. Now, currently in the manga Endeavor’s actions have spiraled out to pretty much destroy hero society thanks to Touya, so he’s become even more of a cautionary tale for Bakugou.

What makes that even more interesting, though, is that Bakugou and Midoriya are two halves of one whole. So the same person who is an interesting foil and cautionary tale for Bakugou has to be one for Midoriya too. Given Deku’s current arc in the manga - pushing everyone who loves him away in an obsessive quest to be the best - it’s clear that Deku could maybe have benefitted from comparing himself to Endeavor too.

This hard-hitting examination of his own flaws is what makes Bakugou so compelling, especially in recent times. Unlike Endeavor, who seems to keep floundering back into the same mistakes, Bakugou just keeps improving. 

Shoto and Midoriya mostly got New Cool Moves out of this arc, and less on the Character Development scale. Deku’s conversation with Shoto about being a “nice person” was something a lot of the fandom eviscerated him for back in the day (before the arc had wrapped) since Natsuo overheard it and felt bad about it. 

Deku is a very forgiving person, I’ve never seen him hold a genuine grudge (he’s currently on a quest to save the Supervillain who kidnapped his soulmate, which is about as forgiving as you get). But while holding grudges can be bad, Deku’s mindset may also be problematic. Being too forgiving of evil done to you and others can also cause problems. Deku’s advice to Shoto was well-intentioned, but it had the unintended side effect of guilt-tripping Natsuo and making him feel like a bad person.

Interestingly, even though Deku is the unofficial Todoroki Family Counsellor, he’s never really been able to help Shoto and the fam get through their trauma all on his own. “It’s your Power” was a great moment, but in the aftermath Shoto wasn’t sure what to do with it. He needed to go work through his own problems afterwards. Deku can’t magically fix all the Todo family’s problems, even though he’d like to. To some degree, given the Sports Fest and this arc, it seems like Shoto may need the help of both Halves of the Wonder Duo.

Fighting Bakugou forced Shoto into the position where he had to face his past trauma. His fight with Inasa revealed that he still holds resentment against Endeavor, and that resentment wasn’t something he could - or should! - just be zen about. So what’s Bakugou’s approach to being harmed by someone?

Bakugou has channeled his anger over Shigaraki abducting him into productive motivation. Maybe I’m letting my recent FMA binge watch bias me as to how the story is going to go, but my guess is that the message may be something like Winry’s story there. No need to forgive people who’ve done something terrible for you; instead, learn to channel anger into motivation and power. That seems to be how Bakugou is handling Shigaraki, and maybe it’s how he can help Shoto handle Endeavor too.

Well, that’s not so much clear in this arc, but anyway. Back to Deku and Kacchan’s story. So Deku pretty clearly holds nothing against Kacchan for mistreating him (look at how cheerfully he interacts with him in this arc! Very, very shippy stuff, they’re every bit the Old Married Couple here). So if Bakugou needs to make amends to Deku, and Todoroki needs to channel his anger, what does Deku need to do?

Given the most recent arc, it’s clear Deku needs to learn to rely on other people. That’s his overall arc. In this arc, we see him doing the Evacuation portion, using BlackWhip to save lives. But we also see Kacchan saving Natsuo and Shoto beating Ending. When the Trinity work together as a team, they surpass the #1 pro. That’s probably why they weren’t able to do so before Natsuo was taken.

Deku needs Kacchan’s strength and confidence. Shoto needs Kacchan’s ability to channel his anger. Kacchan and Shoto both need Deku’s kindness and compassion. Deku and Kacchan needed Shoto’s cautionary tale to mend things with each other. Together, of course, they are the best trio. Who win, rescue, and save together. 

in other words, The trinity need each other. Duh. 

#bnha episode 106 #bnha spoilers #bnha season 5 #shoto todoroki #izuku midoriya #katsuki bakugou #endeavor #natsuo todoroki #katsudeku #tododeku #todobaku #todobakudeku #bakudeku #origin trio #super analytical post

[theseerasures]

While you're doing reactions, if you're up for it, how are you feeling about all the finale predictions you made on March 23? By my count, you scored pretty well!

hooooooo boy (the alluded post, for those just catching up)

how i feel about my predictions is that...you’re right and i scored pretty well, but much like the characters doing right in the episode itself, it didn’t matter. part of the reason why the finale made me feel so much--why i loved it, despite still being emotionally hungover from ugly affect--is because i WAS right, but i was so often right but wrong on a smaller scale, or right but wrong because i completely misunderstood the overall thematic stakes, or in one case right but in such a phenomenally cruel and roundabout way that i’m still reeling from it.

more detailed breakdown under the cut (as in “let’s unpack this,” and as in “i have an emotional breakdown”):

WHERE I WAS MOSTLY RIGHT

Team Green, Yang, the non-Robyn Happy Huntresses, Klein and the non-combatant Schnees were gimmes from the beginning, even the ones of whom we didn’t have visual confirmation by the end of Worthy.

Pietro and Maria are still MIA so i’m putting them here, but...Winter’s gonna have to tell Pietro, when he shows up again.

Cinder and the Relics i was correct about, but even though i knew going in that she would win i didn’t imagine the scale of her victory. mostly because i thought she might have learned some self-discipline and just skedaddled with the Relics in an attempt to trap as many people as possible in superhell, but a) she didn’t, and b) she won without needing to.

Salem, Watts, and Ironwood are where i predicted, but i think part of me really bought into the fan theory that maybe Salem would want to keep Atlas around. both Watts and Ironwood lasted much longer through the episode than i expected because i was working from that assumption, but with the direction the episode actually took it makes perfect sense that they exited the stage as Atlas fell--they are, after all, twin architect-destroyers of Atlas. brains and brawn.

Nora ended up in Vacuo, but she’s...uh, not happy about it. not that i expected her to be happy, but this is much much worse. og JNPR is now JUST Renora, and much as i love freewheeling modular megazord JNPR, that’s gonna hit like a truck. last time they lost someone Renora were consciously trying to play supportive teammate to Jaune, who’d just lost his partner, and Nora especially also had to talk Ren off the edge with the Kuroyuri stuff. i expect they’ll swap the dynamic this time, especially since Nora was already planning to go all independent woman before this.

Qrow, Robyn, and the AceOps are stranded, but in transit and not in Mantle, because Mantle the place is no more. and Vine is dead. the reason i posited that the AceOps might be split up was so they could find their team dynamic after it’s been unsettled, and...well. having one of them do a heroic sacrifice should do a similar trick. because i didn’t think Atlas would fall on Mantle i thought Qrow and Robyn (particularly Robyn) would get more to do, but both of them are pretty much exactly in the same place they were in at the beginning of the season: trapped in a cramped environment, cut off from the people they love and uncertain what happened to them, and unable to contribute in a way that they would consider meaningful. i’m guessing we won’t check back in with this crew for a while, but if we do it’ll be interesting to see if the Qrow and Robyn dynamic changes--like, if he has to be the one to talk her down from cabin fever and despair. (before he finds out that he was the one who should have been despairing all along.)

WHERE I WAS MOSTLY WRONG

Neo is in superhell. i had put her in Atlas because i’d overestimated Cinder’s ability to play the long game, but what the show ultimately doubled down on was that Cinder remains at heart a petty and impatient opportunist, and that’s where she’s most effective. which i dig! i dig that she has not so much improved (in means or ends) so much as learned to hold the beneficial and detrimental parts of herself farther and farther apart, because in the end they’re all the same parts, and because presumably she’ll end up starfishing out so much (who knew the way she took care of Winter’s death pigeons was foreshadowing?) that she breaks in two. and i dig Neo in superhell without Cinder, because it’ll be our first chance to see Neo not working for anyone outside of that one time she fought Cinder. if superhell does end up being part afterlife, she might also get some closure with the Torchwick stuff.

Jaune being in superhell points to it being part afterlife, because the chance for HIM to get some closure is also right there. that was always the case, but the reason i made the prediction i did was because i assumed that Jaune would remain the person he has been this whole season--this stolid, clueless but incredibly effective supporting leader. having a Jaune who is at the top of his game meet up with Pyrrha again is obviously appealing, especially to me, a person who scribbles misshapen hearts labeled “Arkos = 5evr” on all my notebooks, but at the time i didn’t think it was necessary to his story...and then the story dramatically shifted his character and threw all my carefully hedged bets off (which is something we’ll also get to with...later).

having a Jaune who has just effectively EUTHANIZED someone meet up with Pyrrha again isn’t just appealing--it’s vital. and it’s vital because the exact parameters of how and why Jaune ended up having to kill Penny is a point-for-point echo and escalation of the way the Amber to Pyrrha transfer was supposed to go. last time Jaune Arc was party to a Maiden transfer process he had no idea what was going on, and he tried to intervene when he worked out that whatever Oz was doing was going to hurt Pyrrha, and that however minute thing contributed to Pyrrha’s death and the Fall of Beacon. this time it’s not just that he knows what’s going on and the stakes of it. it’s not even just that he is the Ozpin operating the Aura Transfer machine. it is that there is no machine--there is just him, holding the knife. he knows the Amber better than the Pyrrha this time, and this time the Amber is his friend, and still whole, and choosing. not just consenting, but asking him. trusting him. so he carries it out. the old Maiden dies, and like Ozpin he dies shortly after, but not before he watches the new Maiden fail.

but he does prevent history from repeating, because a new Maiden is created, and she gets to live. and Cinder Fall has made him a murderer on top of everything else, but she WILL remember him, now.

there are other people i was wrong about, but that’s...for later.

WHERE I WAS RIGHT AND IT DIDN’T MATTER

Ruby, Blake and Weiss are all in superhell, so on paper i was right, but...well. sing it if you know the words. the reason i’m putting them in their own section is because it’s not just that they fell and didn’t jump like i thought; it’s that they would not have jumped, and that changes everything. you know how i realized that we would lose everyone, and not by choice? it was Weiss. it was when Weiss said we have to do this for Yang. Jaune had reminded Nora of what was priority one minutes before, but the implications of that didn’t sink in for me until Weiss confirmed it. they PLANNED for this. not just the eventuality where they would have to die, but the one where they’d have to watch everyone else die and do nothing except keep going.

which...has implications. the best way to read this--and i think we’re all dying for some good news--is that even if it certainly does not feel that way, RWBY was able to snatch a partial victory from Salem’s claws. they lost the Relics, but they got the Maiden powers away, and most importantly: they saved Atlas and Mantle. by the time Jaune intervened Grand Central was empty. there was no one left to evacuate. they didn’t get everyone, but they got a lot. even before Cinder intervened so catastrophically they knew how many things could go wrong, so they made a plan, and largely stuck to it. on a purely material level they only lost one thing vital to the war effort--the Staff. but they got everyone else out, which was priority one. the show in general and this arc in particular has emphasized that our heroes don’t think they should be exceptionalized, that they’ll fight tooth and nail to make sure everyone is given the treatment and respect they deserve, and they’ve made good on that. they’re Huntresses, and Huntresses be thou for the people. they chose, and they won what mattered to THEM.

but on the flip side: they chose, and there’s no way to read this choice as anything but a compromise...and a very Atlesian one at that. when confronted with calculus similar to the one JYR faced after they lost Oscar in War, our heroes chose...the opposite. one, then three, then four, then five, then six for the many. what was that number compared to two entire cities’ worth of people, especially when they’re the ones who signed up for this? i’m not trying to take this down the slippery slope where our heroes are no better than the dictator they just dethroned, because when the time came for sacrifice they chose themselves first. but it remains a sacrifice, which means that when the time came to test the hard moral limit they set for themselves, they...moved. they decided ahead of time that some risks aren’t worth taking. that this is not a situation where everyone wins, so they had to go for the next best thing, then the next best thing after that, and so on. i’m honestly not sure where it points to yet, except my usual refrain that this show is a lot less didactic than it seems, but...yeah. this is going to lead to some invigorating discussions in-universe.

and maybe it’ll start with this: that Jaune and Weiss--the two who had to verbally advocate for leaving the fallen behind--fell last of all, which means they had to watch everyone else go first. and the last person they saw was the same person. Weiss, who executed the plan to brilliant perfection, saw the past--the first family she ever had--streaking after her in an endless void, forsaking the priorities they all agreed upon, for her. Jaune, who followed the plan to execution and broke a part of himself, saw the new Maiden he crowned, backlit and pulled away by the bright future that he ensured was possible, but can no longer access.

QUEENMAKER

i’m starting with Penny, because Penny came first. there has already been a ton of discussion on the ways that she’ll come back, and while i absolutely agree that she will, for now i am not so much interested in that as i am in eulogizing this Penny. the Penny we had just now, not identical but continuous with the Penny we had before that, in the same way that everyone is not identical but continuous with who they were in the past. the Penny who IS dead, her eventual resurrection notwithstanding.

because she DID die, and her death matters. that’s the thing about the deaths in this season, and it furthers my point re: RWBY’s presumed didacticism--the show’s treatment of death has changed as our heroes have changed. it is no longer (and never was) as simple as “death and sacrifice are always senseless waste,” and more something like...”death has to matter, and we will give it meaning.” Hazel and Vine sacrificed themselves, and the fact both resulted in a “positive” outcome (more lives saved) does not make the deaths any less tragic. but neither should the tragedy of it take away from the fact that they saved lives. what separates our heroes from a Salem or a James Ironwood even now is that they recognize the importance of grievable life even as they accept inevitable death, that what is worth it all about preserving life is not to make sure that lives go on forever, but that lives have meaning and are remembered, that when you’re gone the people who are still here respect you enough to carry that meaning with them. it’s a tenuous balance to walk, but all the more important for that reason.

Penny--though her death can and will be reversed--is much the same. in every arc there has been a Game of Three Maidens (which i guess would make shogi the better metaphor and not chess because--what AM i on about), and in every Game there has been sacrifice. and i thought that would encompass Winter, here. we’d get away with it not being literal death, since Fria already took care of that, but she would be trapped on the other side of the gate--in pretty much the exact same position James Ironwood ended up in the episode itself, actually. it just seemed obvious: she’s the decoy, the one who missed the call by inches, the last revealed defector when there still was an Atlas from which to defect. all of it pointed to Winter’s story ending with one last delay barring her from salvation, of her finally being too late...

and well. i WASN’T wrong in the broad strokes, but first there was Penny Polendina. Penny could have let Jaune try to save her and Weiss die for her, but she knew she had to make a different choice to save as many lives as possible. so she offered herself up as the sacrifice instead. last week i waxed prolonged poetic about how Winter defected so recently, how it has been just IronwoodandWinter for so long, how Winter doesn’t have a team and only the healing shreds of a family, how no one would think to look for her...and then Penny did. you were my friend. (given Winter’s rough age and the hazy creation dates for the PENNY Project, it’s possible that Winter is Penny’s OLDEST friend.) Penny thought of Winter as she was dying, thought about the good Winter could do if Winter had her powers, believed in Winter, and in doing so, saved Winter’s life before anyone else’s.

she ceded the spotlight to Winter in this last episode, but this season as a whole belongs to Penny Polendina--the myriad ways she creates herself, the ways she defends her self-creation, ultimately culminating in her new body, created by no one but herself. but for her final act the Maiden of Creation did something different and no less miraculous: i thought of you. a thought was all it took.

she created someone else.

KINGSLAYER | THE MAIDEN THAT WAS PROMISED

the thing about Winter is that she came first.

no, i’m serious. i checked the fairy tale and everything--Winter came first. as the Wizard’s first visitor she encouraged him to reflect and meditate, and when probed about why she was here at all, she answered: i am waiting for my sisters. Spring and Summer have to wait, too, of course, but. Winter was the first.

Jacques and Willow named their firstborn Winter. it is not the way this story begins, but it is certainly is one of them, because the story begins with Winter, and Winter begins the story--a new retelling, a new cycle of heroism. we’ve since been introduced to other characters in that indeterminate age group between RWBY and STRQ, but Winter--by virtue of being Weiss’ older sister--anchors herself to the new generation in a way those others (even Cinder, who comes closest) do not. she started things, in the mythical emblematic way that this show likes to move, and the way she started things--the way she MADE herself start things, thanks to the house she grew up in--was with love, and protection. she took care of Weiss and laid the groundwork for the person Weiss is today, and conversely: she took care of Weiss, and through Weiss, laid the groundwork for herself and how to take care of everyone. so eventually the steel thread she tied to Weiss she also linked to Whitley, to Penny, to Marrow, to all the people they love, and on and on it goes. Winter loved Weiss, so she made herself learn how to love Weiss, and so when i say she started things what i mean is she started family. a new home, for a new generation of the orphaned.

Winter came first. but as the show demonstrates time and again, especially with Winter: first does not mean best. because being first also means you’re the prototype, a volatile thing that must be tested and tempered and then discarded to make way for what comes after, what gets improved. and it is THIS part of being first that Winter has internalized most of all. Winter, the first Maiden, taught the Wizard peace and prepared the earth so that her sisters could grow and foster and harvest the life within it; Winter, the first Schnee, laid the groundwork in her siblings, but did not wait for them. and let herself fallow in the process. she left, and every time they tried to follow or stay with her she sent them away. (she keeps sending them away; even after defecting and taking down Ironwood, the first thing she says to JNPER is go.) Winter laid the first stone in the foundation, but she cannot take credit for the home her family turned it into, for all the ways it has flourished, because she willfully absented herself of that (birth)right.

and the reason she did this was very simple: she was afraid. she could not bear the thought that while she had to learn how to love she made mistakes, the idea that instead of preparing the earth she might have poisoned the well. so she ran. she turned her face away so she would not have to look, so they would not look to her. she left, and every time one of her siblings superseded her after that, every time she was made to be their Esau--passed over--it just seemed to confirm that she was right to leave. look how well they’ve all done without her.

in the stories, eldest siblings aren’t here to win. they’re here to be made an example of, and Winter...had resigned herself to that. she was prepared to be left behind for good by all the people who have outpaced her.

but then there was Penny Polendina. Penny didn’t follow her, or try to stay; Penny came back for her. Penny remembered Winter when all Winter wanted was to be forgotten, because she’d gotten it in her head that it was what she deserved for all the things she’d done or enabled or failed to do. why did Penny remember Winter? because you were my friend. there is no divine complexity to it, nothing for Winter to fall hopeless short of. there is only the fact that Winter gave Penny something, made something together with Penny, even as she was trying her hardest not to, for fear that she would create something terrible. and this does not take away from all the ways Winter did fall short, but it is still SOMETHING. and it is enough.

it was your power, after all. Penny means the Maiden powers, but she also means THIS Maiden’s power: the power to create. you made this home, Penny is saying to Winter, you should get to reap its fruit, even if you weren’t around for the labor. all you have to do is say yes.

this was a gift. she says yes. she accepts, because in the end Winter Schnee loves her family more than she hates herself.

but then--

(a gift for what? Winter will ask herself wretchedly later, after she has failed in the two tasks she thinks Penny set for her.)

the thing about Winter is that she came first. she taught Weiss everything she knows, and she was so busy doing that she never had the time to show Weiss everything she feels. so in the end what Weiss never predicted was that for all of her team’s painful planning, for all of her own pained enforcement of that plan...none of it was a match for her sister. that when the time came it was would be WINTER who defaults to the absolute ideal of “no one gets left behind,” of “every life” meaning every life, priority one be damned.

or that Winter, in trying to choose both, in finally and fiercely trying, with surely enough power to make a difference, would fail.

what are you doing? Winter heard as she watched Weiss fall into nothingness. my life doesn’t matter.

so here, then, is the story of Winter in The Final Word: a girl returns home after having left it, but in this version it is the home who has changed and the girl who has not. and from this both are unmade. but she gets to live, because she was invited back home. and she gets to go through the portal as its last passenger, into the Promised Land.

and she is still the Maiden of Creation. even after all this, THAT is still her task. to build a refuge for her people, to collect the broken strands of the family she began and her siblings continued and expanded and reinforced, and gather them up again into a new home. it will be impossible, but at the same time: she has done this before.

and this time, she will wait for her sisters.

(a gift for what? for nothing, would be the answer. gifts aren’t FOR anything. they’re gifts.)

#typeoneninja #rwby #helen writes meta #VERY LONG OBSCENELY LONG META CANNOT EMPHASIZE HOW LONG #at least it didn't take me a whole month this time

[redrosesartcabin]

Kenji x first perspective female reader:

Things happened

—————————————————

(Hey, how is it going peeps! This was requested by @xxno-0xx . I hope you all, and especially the requester, like it. Only one warning: It involves some swearing, so if you don’t like that don’t read. If the requester doesn’t like it, please tell me and I’ll edit the story! Also: The story plays somewhere either between season 2 and 3, or somewhere around season 3. Though not in a canonical episode)

It’s crazy how things sometimes happen.

A very vague description, I know, but it’s the only way I can convey how I feel.

Things happened that made me have the opportunity to go to Jurassic Worlds Camp Cretaceous.

We had won the league as the best female Baseball team, with the price being -besides the typical golden trophy and some media glory- a trip to Camp Cretaceous for one of us. And as the team leader, I was chosen as the one who can go.

“Oh no it’s fine!”, I had said. I already had a funny feeling about the trip. But they all had insisted, “it’s fine”, they had said, “it’ll be cool” they said.

Oh and weren’t they just so right. I am super peachy.

Practically prancing through the jungle and killing Dinos with my little finger-

Ok that’s enough, I think y’all got the gist: The shit had hit the fan.

Things happened, that made everyone be gone, and suddenly it was up to us to survive on this pretend Prehistoric nightmare.

At least my beloved baseball bat had survived the fall of the Camp Cretaceous building. After that discovery I didn’t let go of it anymore. I took it everywhere with me, hitting every living being that even dared to breath in my new found friends direction.

Friends… I had never thought, before the evacuation of Jurassic World and all that crazy stuff happened, that I’d ever call any of them that. I hadn’t really found any of them to be friendship material. I love baseball and building things out of wood in my free time and had a dry, sarcastic sense of humor. The only person in the group who had come close to that was Yaz, but she had been so closed off, that I couldn’t really tell before we became a group that fought for their survival. Darius also had been ok, but I was older than him and we didn’t have anything in common, so that checked itself out. Everyone else sort of annoyed me in one way or another. Especially Kenji’s pompous ass. He had appeared very full of himself and just generally narcissistic, or at least painfully self centered and pretentious.

Now imagine how surprised one might be, when one figured I was crushing on the guy.

Let’s just say, that things happened that made me see Kenji in a completely different light.

Turns out he has a good enough sense of humor to catch my drift when I speak “in sarcastic” as he likes to call it. Turns out, he was a loyal and fun friend. Turns out he was just a lonely soul, neglected by a father whose work is more important to him than his own son.

Everything turned out different than it appears about him. He still sometimes annoyed me with his pranks and especially when he wouldn’t shut up about his wealth. The latter however became very apparent as the means to show that he was someone, although he didn’t need to prove that anymore. But of course he would think that’s how people would like him, his father had taught him no better.

The first thing I mentioned somehow makes me love him even more. It annoys me, gets such a rise out of me, that it’s somehow funny again. It gives me a spark and Kenji seemingly seems to enjoy seeing that spark. And him enjoying that spark makes me somehow happy as well. It would start with a cat fight and ended in rigorous laughter.

“Why so serious?”, he would sometimes ask when I’d respond with a glare towards him when he’d steal my bat for what felt like the fifty millionth time.

“You’re getting so creative. I barely saw it coming”, I answered dryly and one could practically see the words alternating between being written in small and big letters.

“Well then you should have no problem finding your sweet baby bat then”, he cooed. Looking deep into his dark brown eyes and almost devilish handsome grin made me both want to punch and kiss him, which may have made me irritable and even madder.

“Finding? Why should I find anything if I have a living and breathing treasure map. Come here!”, I demanded with a creepily sweet grin as I’d walk towards him. Then he’d run, I’d run, we wrestled for a second on the ground only to break into a laughing fit, rolling on the floor, crying tears, resolving this nonsense prank and then getting back to either relaxing or fighting off Dinosaurs… again.

I didn’t think, however, that anything could happen between Kenji and me.

For many a reason, though only two are essential: For one, we were busy surviving, one barely had time to get downtime with the group, yet alone for themselves. Secondly, I didn’t really know, or couldn’t really tell, if he felt the same. Maybe it was my own insecurities coming to light or something, but I just couldn’t really believe it.

Seemed unlikely.

But then things happened.

Kenji and I were on the run from an especially nasty, big Dinosaur. We had been collecting some water in big canisters and wanted to head back to camp when it sneak attacked, unexpectedly.

It snared at us, opening its huge mouth, showing a row of thin, long, sharp teeth.

“Fuck off, you tooth pick mouthed asshole!”, I hissed back at it, flailing my bat at it in panic.

The reason for my irrational action was mainly, that we were stuck between two huge rocks, backed up against another rock with no way out.

Maybe hills or mini-mountain were a better description, but it’s also not important.

All that I could think of was that we were stuck and that little fucker wanted to eat us.

“Calm down, y/n, this isn’t making anything better!”, Kenji tried to reason with me. I was close to shouting some obscenities at him or a dry ‘got a better idea, genius!?’, but this time his dark brown eyes, that often had a mischievous twinkle, calmed me, instead of creating the usual spark. I crawled closer to him as we were pressed to the stone wall.

The Dino however wouldn’t give up. Vehemently, it pressed its ugly snout between the walls, stretching its uncomfortably wet tongue towards us and exhaling a nauseating breath.

I was paralyzed, as I looked at that thing, not knowing what would happen next.

Suddenly, I felt my bat being taken out of my hand. I watched as Kenji took on a fighter stance, the bat positioned over his head, ready for the hit.

“What are you doing! Didn’t you just tell me that we should calm it?”, I asked. He turned around, a frown adorned his face, “I said you should calm down”, is all he answered before he darted towards the animal.

“NO!”, I heard myself scream. I had never heard such a sound come from my throat. It was shrill, loud and all in all I couldn’t recognize myself. I was terrified, even more than when I first caught sight of this beast that had brought us into this situation.

Everything seemed to pass by in slow motion as I saw Kenji swing the bat towards its snout. At first I thought it was over for him as the Dinos mouth opened, the teeth seeming to scrape Kenji’s head, that’s how close it was to him… but then I saw Kenji swinging the bat again, directly hitting its head so that it flew against the stone wall. The beast wailed in pain, seemingly backing up, and just like that, it was gone.

“I… I made it”, Kenji first whispered, before he laughed, repeating, “I made it!”, even louder, jumping into the air and forming a victory fistbump in the air.

“That was awesome! Did you see how- Y/N?”, Kenji’s joy subsided as he looked into my angered expression. With a swift motion I took my bat back, glaring at him as I pressed out, between gritted teeth “let’s just go, hero”

Kenji seemed to have caught the sarcastic undertone of me calling him a hero, because I could physically feel his mood shift closer to mine, “hey what’s with that attitude? I just saved our lives!”

“By doing what I also wanted to do. Great!”

“You were panicking! I don’t know if you would’ve gotten a good hit by panicking. Besides, I couldn’t risk you getting hurt!”, he explained.

For a second I could feel my heart flutter, but that didn’t help my opinion on what just happened.

“But you were ready to risk yourself?”, I asked, my tone bitter.

“Why are you so mad?”, he asked, “we are safe, what more could you want?”,

“I-“, I stopped in my tracks, thinking. Yeah: What was I so mad about? He was right, I had panicked. Panic never helps with concentration and right decision making. I found it impressive, that he had the courage and the focus to fight the Dino off. But I just couldn’t fight off the thought of it going wrong. What if he would’ve been eaten?

“What-“, I wanted to repeat what I had been thinking, but could feel a hiccup, breaking the tear flood inside me. No- I was not going to cry. I took a deep breath, looking directly into his confused visage, “- what if it would’ve gone wrong, I’m just… I- I wouldn’t have known what to do without you. I can’t imagine being without you anymore”.

I saw and heard him gasp, his glance unfreezing from his confused state.

“I didn’t realize I was that important to you”, he answered.

I chuckled, too embarrassed to look him in the eyes, “everyone is important to me from the group, I wouldn’t have liked any of them to risk their lives for me but- but especially not you. I- I can’t believe I’m going to say this - I had vowed to take this to my grave ya know-“

“- Get to the point”, Kenji urged me.( I wasn’t looking at him, but he later told me he had smiled whilst saying it, I however thought he was getting annoyed and was almost too scared to continue. Stupid how that sometimes works)

“- I, eh- I’m in love with you I think. Or at least I definitely feel very strongly for you”, I confessed, “there! Now you have something to use against me. Finally got something you can laugh at again on this miserable Isla-mpf”, my self deprecating monologue was interrupted by soft lips catching mine. It almost took my breath away, but then I leaned in, still not believing this was happening, though it definitely was.

“I’m not going to laugh, I love you too. I wouldn’t be stupid enough to risk everything if I didn’t”

“That’s cheesy, but I appreciate the honesty”, I said, wearing my usual shit eating grin as I regained confidence back.

“Oh look who's talking now”

“Oh shut it!”, I laughed and just like that, I found myself kissing him again.

“And here I thought I had to worry, but you two just ran away to make out”, I suddenly heard Darius in the background, half serious, half amused by the moment he found us in.

I quickly broke away from Kenji, grinning sheepishly, “You know how it is Darius: You get chased by a Dino, and then you need a kiss to make the boo boo go away… just so happens I got a bit of a chap on my lips, and Kenji wanted to make it real good again”, I explained, earning a silent chuckle from Kenji.

Darius rolled his eyes, but couldn’t hold back a smile either, “let’s get you love birds home”

————————

And so things happened. Did we have much time to enjoy us being a couple? Not really.

Did more things happen, making everything crazier and tougher?

Did the rift between Darius and Kenji make me anxious as I was sitting by Kenji’s side, as he, with an expression that was too serious for my liking, drove the yacht?

Absolutely.

But I know, that at least he’s by my side still, as am I, and we will make things happen so that we can finally be free from this place.

Hopefully, we’ll make it.

Depends on what the Dino on the yacht has to say about it...

#request #kenji kon x reader #kenji x reader #kenji camp cretaceous x reader #kenji kon #kenji #fanfiction #jw cc #jw cc season 3 #jw cc spoilers #camp cretaceous spoilers #camp cretaceous

[itsclydebitches]

RWBY Recaps: Volume 8 “The Final Word”

Well, we made it to the finale, everyone, and if you're reading this it seems you've survived the watching of it too. Barely. To say that some questionable choices were made across these 20 minutes is... an understatement.

But before we delve into the episode, I want you to cast your mind back to November 7th, 2020. A horrible year that heralded a horrible RWBY volume. There, coming off the shaky writing of Volume 7, I posed a number of questions and concerns that the show needed to tackle, with the promise that we would return to these expectations in four months time. Now, here we are! Let's refresh everyone's memory, yeah?

Taken directly from that recap, what RWBY promised us, through various teasers and Q&As, included:

Emphasis on Ruby’s leadership and how Summer’s death has impacted her

Insight into Ren and Nora’s flaws

May Merigold will supposedly have a larger part

More information about The Long Memory (Ozpin’s cane)

Theme of the volume is that you can respect someone but that doesn’t necessarily mean you agree with them

Very short timeline (supposedly just two days)

Yang in particular is very suspicious and distrustful

And you know what? They did all this. In the spirit of being fair and honest to this show, RWBY succeeded in delivering on everything they promised... it was just our foolishness that expected that these ideas would be delivered well. Ruby's leadership took center stage in the form of her hiding for multiple episodes and then others telling her she's still The Best before the plot dropped a solution into her lap... one she could have used at any point prior to this. Summer's death certainly has an impact, though it's an impact born of a crazy reveal that Summer likely isn't dead, but turned into a horrifying grimm monster. Ren and Nora both delve into their flaws, but heaven forbid either grow from that reflection. Ren learns that if he pushes past his primary flaw of keeping his emotions buried and actually expresses his doubts for once, he'll be yelled at and ignored until he admits how wrong he was. The "real" flaw is being a bad friend, with "bad friend" equaling "Not agreeing with Ruby 100%." Meanwhile, Nora considers that maybe she shouldn't rush in recklessly and hit things with her hammer... which is why she rushes in recklessly, hits something with her hammer, gets grievously injured, and is told that this is just who she truly is. No growth there, not unless we count her sudden desire to figure out who she is without Ren... but that exploration hasn't started yet. Too bad she wasn't the teammate separated at the end of the volume!

Meanwhile, May did indeed have a larger role to play, one I quite liked, it's just that this role — like all the others — inevitably circled back to realizing how wonderful Ruby is. May challenges Ruby to make a decision, but instead of being the catalyst for Ruby's growth, May becomes another forgotten side character who does a sudden about-turn regarding her perspective, leaving the group with the contradictory message that Ruby is actually doing her best, she's just a kid, no need to try any harder... everyone who claimed otherwise up until now was mistaken. May is another Cordovin. She's another Qrow. She's another Maria.

Fun fact: we don't even know if Maria is alive right now. That's how little she means to the show!

Actually, wait... anyone remember this nonsense from Volume 7? 

I was too lazy to change the date.

Moving on, Ozpin's cane turned out to be a stakes obliterating bomb that came out of nowhere, makes no sense logistically — how do battles store energy that only hurts grimm? — yet nevertheless seems to have killed Hazel? It's a disaster of unanswered questions. Similar to the disaster of our two day timeline when, I'm fairly sure, we've had an unnatural number of sunrises and sunsets. I'll have to take a look back at the volume as a whole now that it's complete to be sure of that though. As for our themes... did we really explore the idea of respecting someone even if you disagree with them? Because Ironwood wasn't shown any respect. Ren wasn't shown respect. I think the closest we got was Oscar calmly validating Yang's worry about getting buddy-buddy with Emerald, but the whole point there was that Yang was wrong. She wasn't wrong, but that's what the text would have you believe. She is indeed "very suspicious and distrustful," but that's hardly unjustified in these circumstances. I'm still boggling at the fact that it took the group three volumes for forgive Ozpin, even while he was actively working to assist them, yet I-helped-destroy-Beacon-and-tried-to-kill-everyone-you-love Emerald is the group's new BFF after she... ran away with Oscar? She didn't save him, she just went along for the ride. At the very least we might have gotten a scene where Penny was like, "Hey, why are you all laughing with the woman who just tried to kill my dad?"

But oh yeah, the story doesn't remember Pietro exists either. His daughter is DEAD and he hasn't been on screen since Episode Five, let alone there when she passes.

I had my own list going in, including such expectations as "Ozpin bb you got done dirty please acknowledge this" and "Queer baiting, queer baiting… you’re on thin ice at this point, RWBY. Just skate on over to the queer snack bar before you fall straight into the lake." Obviously these needs were not met.

So what, given this mess of expectations, did we end up with?

Our finale — for some reason — breaks the one word title trend with "The Final Word." It's an expression that refers to the final word in an argument or a discussion, the idea of winning by making a last, devastating point. It can also refer to making the final decision on something, which is the best way I'm able to apply the title to this episode (outside of any “final” comparisons). Penny's death is certainly all about choice and making some kind of decision... but on the whole, this title doesn't feel like it fits well. Not like "Worthy" or "Creation" or "Risk." The two latter titles had obvious connections to the episode in question through dialogue and plot, while the former was a deliberate callback to Watts' speech. "The Final Word" feels... less obvious in what it’s trying to say.

That's a minor nitpick though. Let's get into the meat of the episode.

We open on the grimm whale still disappearing, which is weird. I get that it's massively bigger than any other grimm we've seen, but they all turned to dust near instantaneously and it's been, what? At least an hour since Oscar blew it up? Likely longer when we factor in their walk back to the manor, the fight with Ironwood, fixing Penny, and this entire evacuation. It certainly makes for a nice visual, but like so many details in RWBY, it raises unnecessary questions along the way.

The important bit though is that amidst the whale carcass a blob of evil is swirling about. Salem, obviously. 

She’s not reforming in time to actually do anything though, don't worry.

Instead, we cut to the Ironwood vs. Winter fight and there's at least some dialogue this time. Ironwood yells that he's sacrificed everything to keep Remnant safe. Winter yells back that he actually sacrificed everyone else. Obviously, Ironwood should be called out for things like, you know, his unprompted murders, but instead they have Winter listing stuff that she was never shown to have a problem with before. The embargo? "Squeezed Mantle until it broke?" She, as Ironwood's second hand, understood and supported both the decision to close the border and the need to collect resources for a plan designed to take out Salem. I hate that no only did she turn without an ounce of hesitation or grief, but now they're having her act as if Ironwood forced these decisions on everyone, rather than everyone supporting him through them. We all remember Volume 7 when Ruby pressured him to finish Amity, right? And in trust RWBY fashion, most of these words are meaningless. Mantle "broke"? What does that mean? The class disparity did not come about through Ironwood: that's been in the works for generations. The lack of resources made things harder, yes, but when they were reclaimed by Robyn nothing improved. Watts is the one who turned off the heat and Salem attacked Atlas, leaving Mantle alone. Now, all the citizens have escaped through magical portals. So how is Mantle "broken" exactly? More importantly, why is Winter upset over this vague, nonsensical dilemma when she could be yelling about Ironwood wanting to bomb Mantle?

Again: this woman watched Ironwood shoot the councilman, shrugged, and continued to believe in him up until she realized his bomb threat was real. That was one of the main reasons why I thought the councilman might be alive, with Ironwood only shooting a warning shot past him. Because this is how you react to a good person unexpectedly killing someone else

whereas this is what we got from Winter and Harriet.

Hell, Weiss has more of a reaction to Yang telling Ruby things aren't super great right now.

So either Ironwood didn't do something that bad, thereby justifying these tame reactions (unlikely, given where his character ended up), or we should believe based on the animation that everyone was super chill with him killing an unarmed civilian. Which is then directly contradicted when they're like, "You're going to shoot Marrow? Bomb a city?? How could you do such horrible things??? 😲" Friends, buddies, fictional pals... you already watched him murder a dude.

The point is, there's a lot for Winter to be upset about, but she's not upset about that. There's a lot that Winter herself believed in, but the writing has forgotten that. This entire arc went off the rails a volume ago.

Also, why is Ironwood fighting with that giant gun? This is his final battle, presumably ever, and he's wielding this awkward, sluggish weapon we saw him randomly pick up two episodes ago? Let him use his regular guns! Give us a fantastic battle like he had with Watts! Instead, RWBY's final showdown consists of him using this no-name weapon as a unwieldy club in some of the most boring choreography we've seen to date. It doesn't help that this fight needs to share time with three others. Instead of an epic showdown, we're given glimpses of the battle before continually cutting away from it. 

During that first cut we return to the Team RWBY battle where Penny, doing her best to stay out of Cinder's reach, is whisked away on Weiss' wasp.

Too bad she didn't do that for Yang...

Jaune and Nora watch this horror unfold until Jaune says, "Priority one!" and they split. Except... what is priority one exactly? Helping the civilians? I guess, because they don't enter the fight until the very end of it, when everyone else seems to have made it to Vacuo. And you know what, I like that. For once it feels like the group — or at least the B Team — is acting like huntsmen, putting the needs of the people over their own, personal desires. I'm sure Nora wants to help the group after Yang's (presumed) demise and that Jaune would like nothing more than to get his hands on Cinder, but they put those grievances aside to do the work they signed up for. Good job!

My only real gripe is that we don't really see this struggling in the animation, I'm just assuming it's there. In particular, there's a moment when Jaune sends Nora through the portal for reinforcements — not knowing they can't return — and they seem a little too jovial when, by this point, three friends have died.

There's letting your cast be supportive, and then there's having them ignore that three teammates have perished in an abyss. It really doesn't help to sell the idea that Yang, Ruby, and Blake are in any danger here.

But I'm getting ahead of myself.

Penny tells Weiss that since Cinder is really just after the Maiden powers, she can buy the rest of the group time to escape. Weiss, obviously, isn't fond of this idea... and then the both of them are blasted off the wasp by Cinder's fire. Which they deserve, frankly. They're just having this casual conversation about sacrifice while in the middle of a battle. Did they somehow forget that Cinder can fly too?

Note that multiple attacks from Cinder, another blast, and a hard landing on the pathway gives their auras a knock, but doesn't break them. The primary defense for Yang's aura shattering in a single, simple hit was that everyone is exhausted and running on little to no power... yet here the rest of the cast is, tanking multiple hits as we've come to expect. There is no explanation for Yang's defeat except that the writers chose to ignore the rules of their world for a dramatic death scene... even though that drama was erased a week later as half our team falls into the void too.

We'll get to that though. For now, Cinder corrects Penny's belief with "I want it all" and proceeds to try to finish them off, only for Blake to arrive, having made her choice from last episode about who to help. It's a legitimately nice attack, but I happened to pause at the bEST MOMENT

Anyway.

We leave that fight to return to Qrow and Harriet who have, off screen, started an entirely different battle. What I mean is, last we saw Qrow had broken through the windshield of the airship, roughly pinned Harriet, and was taunting her about getting the fight she wanted. Now, suddenly, he's going “You’re making a mistake, Harriet, what happened to Clover—” as if he's been trying to talk her down this whole time. It's jarring, especially when we consider that Qrow had a volume long "kill Ironwood" arc that was dropped because... Robyn reminded him that murder is bad? RWBY feels like a storytelling pinball machine. Characters bounce from one personality to the next, one perspective and another, round and round until you don't know where they'll end up.

Harriet screams for Qrow to just shut up already and honestly? Same. I love Qrow, he's one of my favorites, but I can't deny that he's been done dirty like so many others since Volume 6. I love who Qrow was, not the mess RWBY has created the last few years.

Time to delve back into fic after recapping!

Sadly though, this strange dialogue wasn't the only "wtf" moment. Harriet is still trying to drop the bomb — which is its own mess of confusing motivations — when Vine and Elm show up on Harriet's ship. Elm begs Harriet not to do this "because you’re our friend!”

Am I glad that they finally acknowledged that the Ace Ops have always been friends? Sure, but why did we spend two volumes claiming otherwise? They were friends, a fantastic team, then Harriet announces that's a lie and we get a bunch of "Team RWBY is superior because they're actually friends" messages. Except this entire time we're still watching the Ace Ops be kind and playful with one another. But they're not friends, the story says. Not friends as they fight these battles. Not friends as they grieve for Clover. Definitely not friends as they react in horror at Ironwood nearly shooting Marrow. No, there's nothing there... until Elm claims there is! Then Harriet reacts in shock. I have friends?

Except Elm was labeled the one "just following orders" by Yang. Elm is the one who shook off Vine after the whale exploded. This isn't the story of one character, Harriet, thinking she was alone and then realizing that people do care for her, this is a story that, seemingly at random, had this group being BFFs or acting like they hated each other — and at each point the visuals are contradicted by the story's message. When they act like friends, we're told they're not friends. When they don't act like friends, we're told they really have been this whole time. I mean, do any of them even care that Marrow teamed up with Qrow and Robyn to take them out five minutes ago? All three were going along with Ironwood's scheme until they were physically stopped, but now Elm is convinced this is a bad decision she needs to talk Harriet down from with the power of friendship?

None of these characters are characters, they're just slapped together reactions based on whatever the plot needs. Who is Elm? I've got no clue. Her personality changes every episode.

Also, love that Qrow moves to stop the bomb from dropping and Harriet screams at him to "Get out of the way!" rather than just... attacking him? She even throws her hands out like she's having a temper tantrum. This feels like schoolyard bickering, not a life or death struggle.

Even though, you know, the audience is aware that the people of Mantle have already been evacuated and Qrow's group is aware that Atlas is falling on top of Mantle as they speak, so... why does the bomb matter? It's going to, what? Destroy the city thirty seconds before Atlas does? Oh no, the horror.

Things then, if you can believe it, get even worse. The bomb is still about to drop, so instead of doing anything to stop it — I mean seriously, we know it takes four people to shoulder the bomb's weight, but you're telling me Qrow and a reformed Harriet can't snag it in a pinch? — Qrow sits there, looks at Clover's pin... and the bomb careens towards the side of the airship instead, stopping.

Because I guess Qrow has good luck now? Or always did and somehow never noticed it? Or his semblance evolved?? Again, we don't know, but it's a bad moment any way you slice it, imo. Qrow has always been defined as the guy with a bad luck semblance and, much like Penny's android struggles, the allure was in watching him overcome those challenges, not having the show erase the challenge entirely. Especially when we don't even understand how it was erased. Qrow just... stops drinking, stops caring for Ironwood, stops wanting to kill Ironwood, stops causing bad luck, I guess. RWBY takes major character traits and flips them off like a light switch, leaving the audience with no emotional tether. We didn't watch Qrow overcome his drinking, or realize he can't bear to kill Ironwood, or discover a way to live life with the horrible hand he was dealt, he just blinks one day and those things are gone. Why? No one is sure. Not even the writers, I'd wager, because otherwise they would have written explanations into the text.

Many in the fandom insist that any basic information provided by the story amounts to "hand holding" when in fact there is a massive difference between the sort of unnecessary exposition that bogs down a tale, and having facts enough for the audience in its entirety to be on the same page about what is actually happening. For example, recently someone argued strongly that the "Penny is human" take is incorrect because Penny isn't human, she has an inhuman body made entirely of aura... yet where in the world does this exist in the story? Ambrosius may have been unsure about what Penny would be prior to removing her robotic parts, but that ambiguity is gone once her body forms, the equivalent of worrying about that gun only for a flag with 'BANG' to appear instead of a bullet. Worrying about something doesn't mean that something actually occurred. Penny appears human, expresses human sentiments, and then, this episode, dies as a human. If it walks like a duck and talks like a duck and succumbs to the mortal peril that all ducks face... it's probably a duck. As I said in a recent ask, I implore the fandom to stop writing RWBY's scripts for them. Or rather, do so in some amazing fanfics. Don't do it on critical posts as a means of insisting that your revision is canon.

So Qrow has good luck now, maybe, but this character change doesn't amount to anything because Watts remotely starts the bomb's countdown.

At least he’s entertaining and competent. We had that for a time. 

Back to the main battle, Neo is kicking Ruby's ass. Why? Because there's no consistency in power levels in this show. The ancient woman who hasn't fought in decades dances circles around Neo, highlighting how weak she supposedly is, yet now Neo dances circles around our main character. None of us should expect fights to follow the logic of the world, only what drama the plot wants to stir up. Ruby is eventually knocked down from a hard hit — yet her aura's intact! — and is saved at the last second by Weiss tossing Neo into one of the portals. 

Far more of a problem than the power leveling is that Ruby gives no indication here that Neo just murdered her sister. Again, that's what the characters are meant to believe, yet Ruby is as stoic as she would be fighting a bunch of White Fang grunts. If you showed this scene to a RWBY fan on its own and asked, "What do you think happened prior to this?" the answer would be, "Uh... nothing? Ruby is just fighting Neo like she did on the airship in Volume 3." Nothing about this scene — from dialogue to animation — sells the idea that Ruby just lost the person most important to her in the world.

When we do finally mention Yang, it's Weiss who goes, “Come on, we have to do this for Yang” and the delivery is... meh. Honestly, I normally don't pay much attention to the voice acting, but I had a problem with most of Weiss' lines this episode. The "Leave her alone!" during this fight and later a "Get back!" as she attacks Cinder both fell really flat for me. Given the devastation and charged emotion that's supposed to be here, we can't give her anything better than generic cries that, again, she’d throw at any grunt? In that later scene the animation absolutely helps sell Weiss' distress, but the dialogue is common and the delivery has no emotional punch, leaving it feeling like Yang is just hanging out in Vacuo and they promised they'd beat the baddies before catching up with her. No one but Blake is acting like Yang died.

In fact, we see more emotion from Ruby when Weiss shoves her back, taking the brunt of Cinder's blast.

Weiss' aura breaks, not that that's a danger or anything. Everyone falls before they're injured, Winter gets the Maiden powers, Ren barely has to fight. Losing aura in this show used to be a moment of peril, where just last volume Winter was bruised, bleeding, and now needs an assistive device because she had to continue a battle with no aura. Now it's a joke. Aura breaks left and right across the volume with no repercussions attached to that.

We see a bit of the Blake and Penny vs. Cinder fight where Cinder blasts Blake off the edge. Penny rushes after her because at least one character remembered that they can fly.

Ruby, meanwhile, remembers that she can fly when it benefits her. After getting hit down onto a lower level and watching Crescent Rose plummet, she taunts Neo into an attack with a move that's actually quite good. I like the confidence with which Ruby riles her up and I like the strategy of darting behind Neo to knock her off the path instead. “Whatever you wanted, I hope it was worth it."

The only thing I don't like is that this speed and ingenuity had to disappear to justify Yang falling.

Cinder breaks Ruby's aura from behind though, sending her over too and grabbing onto Neo's leg. In an obvious moment born of the trope, it looks as if Cinder is reaching to help Neo, only for her to snag the Relic instead. “You should have never threatened me," she tells Neo and to Ruby: "you should have never been born.” 

Love that they erased all that cool growth from last episode! And by "love" I mean "hate." As I said last recap, I'm not going to pretend that Cinder's character isn't riddled with problems, but realizing she was stronger by teaming up with Neo and Watts was one of the best things they've ever done for her. It made Cinder dangerous again and showed Watts' speech having a clear impact. It also made her more entertaining, creating a new dynamic among the three villains. Now though, Cinder is just... Cinder. The same boring, stupid Cinder we've had since Volume 4. She betrays Neo and then later betrays Watts.

So Cinder kicks Neo and Ruby both over the edge because why would we want to make her interesting? Neo falls, but Ruby has friends there to catch her! Unlike Yang. Jk. Weiss’ aura is gone and Blake actually tried both times, so major kudos for her. Using momentum supplied by Penny, she snags Ruby and hooks her weapon into one of the pathways... only for Cinder to cut the ribbon. Both plummet and once again Penny has a more believable reaction to all this, just like she did last week

Speaking of reactions, does anyone else find it weird that Cinder finally succeeded in killing Ruby and... doesn’t seem to care? 

No? Just me? 

At least we get that good animation with Weiss I was talking about before, even if the dialogue is lacking. I love that she snagged Blake's weapon and uses it to try and take out Cinder, shaking the whole time. Those are some great details. 

Back to the bomb, Qrow is trying to escape, but Harriet says there isn't enough time to get out of the blast range. "I've killed us all." Vine has the solution though, using his semblance to wrap up the airship, thus containing the blast when it goes off. His final words are to reassure Elm that he can give his life, "if it means saving all of my friends." Just in case you missed the part about the Ace Ops being super close this whole time. Even though they also weren’t. Trying to eat your cake too, RWBY? 

Frankly, I didn't feel much of anything during this scene, not when Vine made the sacrifice, nor when Elm and Harriet look on sadly while Robyn pilots them away (that's her contribution this episode). 

All I can say is, good on RWBY for not killing one of the three dark skinned characters, or just murdering the Ace Ops as a whole. What the story is going to do with them though, who knows.

Jaune and Nora have that ‘You can do it!’ moment after three of their friends have presumably been killed. I swear, about 80% of Jaune's scenes do not work tonally and oh boy, things only get worse from here.

First though, I like his entrance. He slams into the fight against Cinder and lines up with Penny and Weiss, who is still dual-wielding her and Blake's weapons. That's an epic shot.  

It looks as if they stand a decent chance against Cinder — Weiss' lost aura notwithstanding — except then Cinder's arm starts going crazy and she gleefully announces that Salem has returned.

Working on a time limit now, Cinder unleashes a volley of attacks that Penny steps in to protect the other two from. It's here that Cinder grabs hold with her grimm arm.

It's here that Penny dies. Again.

For the third time.

Friends, I am tired. This moment honestly deserves the most epic of rants, but that, in turn, requires energy. Energy? In this economy? Ha! That's hilarious. Taking this seriously though, the problem here can — as usual — be boiled down to a single question: What was the point?

Penny died in a horrible attack that shook the cast and audience both to their core.

That emotional impact was erased through her resurrection.

The resurrection did not create a new emotional impact for our heroes to grapple with.

Penny is given the Maiden powers, solidifying the fact that she's always been a "real girl."

That lesson was erased when the story decided to make her human for unexplained reasons (because no, she never needed to be human to survive the virus).

Penny then dies, passing the power to Winter... who was set to get the power in the first place.

We have, once again, come full circle. You can take Penny out of the story and nothing changes. Does Ruby lose any lessons or emotional growth? No. Does anyone survive who would have otherwise died? No. Does her getting the powers lead to someone unexpected snagging them upon her death? No. Penny's existence was filler. She was put in the story to take up time and, that done, was removed from the story once again. It's a choice that wouldn't be half as horrible if that filler hadn't done so much damage along the way.

First is the obvious: that Penny didn't deserve this. As a character, she didn't deserve to be brought back just to be killed off again, seemingly without narrative purpose, serving only to draw in viewers who RT knew loved the character. Second, keeping her in the story led to her entire arc unraveling. Initially, Penny died as an android in the world's eyes, but those who actually knew her — Ruby and Pietro — mourned the girl she really was. Now we have this horrible message that being a machine isn't real enough, so she has to die as a human being. It's a disservice to her character and, as an allegory for many minorities, downright insulting to the audience. Third, this offensive 'better to die as a human than live as a robot' message is wrapped up in the claim that Penny finally gets to choose something — “Let me choose this one thing. Trust me” — but she already did that when she chose to take the Maiden powers. We already had the better written version of this last volume!

And the fourth issue...well.  

Fourth and fifth are the real kickers. Fourth is that Penny's death was an assisted suicide. She explicitly asks Jaune to kill her so she can ensure she's thinking of the right person when she passes (never mind that her thoughts would probably be on Jaune while this is happening) and that's... pretty horrible. Look, I'm no purist. I like a great deal of dark, gritty stories whose plot exists to make us uncomfortable. That's a valuable emotion that fiction can generate. The problem is not that RWBY is tackling a sensitive topic, but that they aren’t tackling it well. Yes, they put in a content warning and (from what I've heard) a suicide helpline as well, but providing the already necessary resources is not the same thing as writing that kind of scene with respect and care. All of the above tells us that, no matter what RT may have intended, that respect and care weren't communicated to the audience. Like Yang, they didn't even bother to keep Penny's death within the rules of their world. Jaune is right there ready to heal her and Penny says no, there's supposedly not time.

Um... since when?

Jaune's aura boost is instantaneous. The second he amplifies aura is the same second the healing starts and their talk could have been spent saving Penny. There was certainly time to save Weiss in Volume 5. To have a character go, 'Nah, it's too late' when the solution is right there is the ultimate cop-out. Suddenly announcing that the solution will no longer work For Reasons is not a legitimate limitation and it's made doubly insulting that RT didn't simply use the limitations already available to them. Jaune has been running low on aura since the whale. He then expended a great deal of aura boosting Penny to keep the virus in check. Every other ally has had their aura broken in this fight so, there. That's your solution. Have Jaune take a few hard hits from Cinder, his aura breaks, and then when Penny is mortally wounded he no longer has a semblance to heal her. It's that easy! Yet instead they had Penny reject help so that she could ask to die. That's what's offensive here.

Finally, reason number five... why is this moment given to Jaune? That's another easy solution: Jaune has gone through the portal and can't get back to heal Penny. There. Done. But logistics aside, this scene should have gone to any other character. Who is Jaune to Penny? Or Penny to Jaune? No one! They don't have a relationship. I get that the writers didn't want any of the girls at her side because then it would be hard to justify Penny not passing the power to them (which I get: making one team member a Maiden changes the show drastically), but you know who should be there instead of Jaune?

Pietro.

Pietro, who built Penny as a weapon and who was never given the chance to apologize for that. Pietro, who told Ruby he could only rebuild her once more, setting up an expectation that he'd sacrifice himself for his daughter (despite the complicated racial issues that would bring up). Pietro, who watched Penny plummet and has no idea what happened to her, let alone that she's been made into a human girl. Pietro should have been at her side, saying goodbye to his child and helping her complete her last wish.

And it would be so very easy to pull off. All it takes is a single line where Penny remembers that her father exists, asking Ruby to ensure a portal opens up in Amity. There's a quick reunion along the pathways before Cinder attacks. We hear a cry of despair as Penny falls and she looks, seeing her father racing towards her, though she thought he'd already made it out. There, you’re done. We open ourselves up to a lot of attacks whenever we say, "Why didn't RWBY just do ____?" because those who vehemently defend the writing like to go, "Oh, you think you could write RWBY better?" and no, I don't. I struggle with long-form storytelling and massive casts. I don't think I could do justice to the sort of show RWBY wants to be, but I do think I'm a decent enough writer to spot when there are major problems like this. The question of "Why doesn't Penny remember that her beloved dad exists?" and "Why, out of that massive cast, is Jaune the one to do this deed?" are both things that a newbie writer can spot, and a sometimes okay writer can figure out how to fix them both simultaneously. A good writer will start thinking about themes — what might it mean for Pietro to kill the creation he made? — and a great writer will find a way to pull that off without having that insulting, discomforting feeling pop up. At this point, our RWBY crew feels less like new writers making mistakes (because they're not new, not at all), but rather just writers who haven't bothered to learn from their mistakes after eight years. That's a lot harder to watch.

Because putting Jaune here doesn't just mess with RWBY's internal rules (not using his semblance) and it's not just useless in terms of Penny's development (she doesn't know him outside of "dude who boosted my aura for an hour"), but it also falls back into a pattern I thought RWBY had finally broken from: making Jaune the story's emotional center. This is not the JAUNE show. It's the RWBY show. Yet here, once again, we have Jaune in the spotlight. Why, after a whole volume of Ruby avoiding making decisions, does Jaune finally make the hard call? Why, after a scene where Penny asked Ruby to kill her, does Jaune do that deed? Why, after a divisive arc where all the grief for Pyrrha went to Jaune, is Jaune now set to shoulder the grief of Penny? At least Jaune had a relationship with Pyrrha, even if Nora and Ren did too. Yet with Penny he seems to be there solely because the writers can't bear to keep him out of that center spot for long. All of Team JNOR make it through to Vacuo... except Jaune. Jaune falls into the abyss too because, if the show goes this route, we apparently can’t have a volume just about Team RWBY, the main characters. The main characters are separated from the rest of the team and it's Jaune, not Oscar and Ozpin with a connection to the lore, not Nora or Ren whose development now hinges on them learning who they are without the other, it's Jaune who follows the title characters into a new dimension. 

The issue is not whether Jaune deserves to grieve over the truly traumatic thing he just did now that he’s done it. He obviously does. The issue is the writers setting up a scenario where Jaune is situated to do that emotional work in the first place. 

I like Jaune as a character. I don't like how the writing uses him as a character. RWBY is built on the idea that these four girls are the heroes of this tale, not the expected blond, blue-eyed, sword wielding guy we’ve seen in so many other stories. So why does that guy get the most important scene of the finale? Yes, Jaune had much less screen time this volume than he did in the past, that’s a good thing given the number of important characters RWBY has to balance, but that hasn't erased the problem of him being given significant moments that should be going to title characters. Does Ruby’s team rescue Oscar and take on Salem? No, Jaune's team does. Does Ruby's team save Penny? No, Jaune's semblance keeps her grounded and then holds the virus off. Not everything is a problem — we've also got good choices like having Ruby defeat the Hound and Ruby's team take on Cinder for the majority of the fight — but that doesn't erase that Penny’s death wasn’t something Jaune should have been a part of. Not unless he was going to heal her. Doing better than they have in the past doesn't mean that RT isn't still slipping when it comes to giving him undeserved focus.

They took one of the most controversial characters, controversial because of how much emotional focus he's gotten in the past, and had him help a fan favorite commit suicide while he cried about it, showing more emotion for a near stranger than our title character showed for her sister. This is a character who, up until two or three episodes ago, had no connection to the victim and still has no reason to thematically be the one committing this act. That is why the fandom goes, “The crew loves Jaune and does everything they can to put him in the center of the action.” Ruby, as main character and Penny’s first friend, is the obvious choice here. Pietro, as Penny's father, would be a good choice too. Hell, Nora is a better option given their moment in the Schnee manor this volume. Or Winter given their moments in Volume 7! Have her escape Ironwood, find Penny, receive the powers, and then finish him off. Literally anyone would be better than Jaune, not because Jaune is a bad character, but because Jaune has no emotional stakes here and putting him in a position where he could heal Penny but doesn’t is massively stupid. No one should be surprised that a lot of the fandom is upset about this. It was one hell of a reach to give him this moment and, since Jaune's problem has always been getting too much screen time and emotional nuance compared to our main cast, it's no wonder this act brought up a lot of bad memories. RT fell back into an old pattern after two volumes of improvement and they did so at the worst possible time. 

The tl;dr is that Penny's third death is a writing travesty, just like her second. I shouldn't be surprised, given that this is the same volume that tortured a kid and the only thing they did with it was have him blindly trust his torturer... yet I find myself surprised nonetheless. Because Penny had such potential as an android Maiden and, as much as I personally hated it, potential as a former android learning to be human too. But why explore any of that when you can kill her off instead? Again.

As a final, far smaller note about this scene, we have the continuing problem of what purpose Cinder's arm is serving. If everyone recalls, its threat comes primarily from the fact that she can "siphon off" power from other Maidens.

She did it to Penny during the Amity battle and now she does it again, a great deal of green energy absorbed into Cinder. So what's left to give to Winter? Why doesn't Cinder become noticeably stronger with each successful theft? Like so much else in RWBY, we're told it exists without actually seeing the impact of that. Winter isn't a weaker Maiden for having lost power and Cinder isn't a stronger Maiden for having snagged it. It's just.. there, hanging out and looking vaguely menacing, I guess.

Outside of this unnatural not-transfer, we get to see how the power normally passes as Penny meets with Winter in some in-between place. It's a soft, heartfelt scene... with the exception that Winter says, “You were always the real Maiden at heart. I was just the machine. Just following orders."

I don't know how any viewer can doubt that RT now believes machinery = evil. Penny's machine body is magicked away so she can be a real-real girl. Yang announces that the arm she worked hard to make a part of herself is just "extra." The man with half a metal body is made this volume's villain and losing his second arm is, by the authors' own admission, a symbol of his lost humanity. Mercury with two metal legs remains a bad guy while Emerald and Hazel are hastily redeemed. Tyrian with his cybernetic tail is the most devoted crazy of the bunch. Maria, blind and in need of assistive lenses, is so forgotten by the story she was left in the tundra nine episode ago and won't be mentioned again until next volume (if then). Pietro, the guy in the wheelchair, is forgotten too, despite it being his daughter who dies on screen.

Now Winter, also bearing an assistive device, says that she's the real "machine" here and tells Penny, now human, that she was always the "real Maiden." I don't know what happened to make RT do a 180 lately, but the disability rep is no longer what it was.

Penny reassures Winter that she'll always be a part of her and then passes on, for good this time.

The rest of the episode feels lackluster, if I'm being honest. Images of Cinder beating Weiss are intercut with Ironwood beating Winter, getting her to a point where her aura breaks. 

But then the powers appear and, as we'd expect, she easily turns the tide. 

Gorgeous animation there. 

But RT once again rewrites earlier scenes by having Ironwood claim that the "destiny" he chose for Winter has finally arrived — isn't that Cinder's MO? — and Winter shoots back that he chose nothing, this was a "gift." Except, it was never about destiny or orders? This was why Weiss' anger in Volume 7 was ridiculous. She acted like Ironwood forced Winter to accept the powers and Winter told her point blank she chose this. Ironwood didn't decide anything, he offered and Winter chose... kind of like how Penny is choosing now. I hate how nearly all of Ironwood's character has been ignored or, during times like this, outright lied about to make him seem super duper evil. He tried to bomb a city! You don't need to make him seem evil anymore, that job is done! Like their sudden change regarding disability, RT now seems to be allergic to nuance. Heaven forbid Ironwood be allowed to have valid points like he did in Volume 3. No, if you've got an antagonist every single thing they've ever said must be twisted into a display of their evilness.

Unless you're Hazel, who Oscar trusts for #reasons. Unless you're Emerald, who the group immediately embraces. Unless you're Cinder, who gets to cry on a rooftop and secures the trust of her allies long enough to betray them again.

But Ironwood? Nah, screw that guy.

Salt aside, the fight is pretty boring. Winter literally just throws up a wall of ice and Ironwood's blast rebounds, taking him out.

Winter flies through the portal and we return to Jaune. His sword is broken by Cinder, so weapons should be quite the problem in Volume 9. 

There's a bit of sword vs. sword Maiden battling — this episode really pulled heavily from both Volume 3 and 5's finales — before Cinder gets smart again and attacks Weiss, currently trying to escape with Jaune. Weiss goes right off the edge and Winter isn't able to reach her in time. That's the entirety of Team RWBY, lost to the magical void.

Kudos to Winter's VA and the writing here though. This feels like an appropriate reaction to losing a sister. Screaming, sobbing, falling to her knees and beating the floor... Ruby, take notes.

A roar sounds through all the portals though, the sort of roar a pissed off witch might give. Jaune convinces Winter they need to leave Cinder behind, but before they can escape Cinder... makes a new wish?

Look, it works on all the major fronts. Cinder has the staff, check. We've basically established that Ambrosius can make an unlimited number of things per era, check. We know the previous thing disappears when a new wish is made, check. My only question is the timing. In all honesty, I'll have to re-watch the scene to be sure, but at the time it felt like the portals began disappearing almost the second Cinder left. Did she really have time to summon Ambrosius, deal with his explanatory nonsense, and get him to make a new wish without any fiddly concerns? Sure, fire is just fire, but it still felt like way too much happening too fast off screen.

Either way, the portals are gone and Winter makes it through in time, but Jaune does not. He falls through the void along with Team RWBY. And Neo.

Neo is the only addition I'm looking forward to here.

We get a few shots of our other characters as Winter arrives, saving the day by taking her grief out on the grimm. So glad something came of Ren breaking his aura again! Maybe they'll be more fighting at the beginning of Volume 9? If we see any of this group outside of 9's finale. My worst fear right now is that we'll spend an entire season away from the main action — remember how I said it would be stupid for Team RWBY to go on a side adventure while Salem is attacking the world? — and when they return there will have been some major time skip. Salem has destroyed most of Remnant, only pockets of survivors remain, it's all dark and dystopian... and oh look, every bit of character development happened off screen. How did Nora discover who she is without Ren? She did it while Team RWBY was gone. That merge we've been teasing for five years? That happened while you were gone too and, btw, Ozpin has ceased to exist. So sad, right? Not that anyone will actually mourn. Just take comfort in the fact that his last line was an "Oh no" about Ambrosius and his last major scene was apologizing for how the group treated him. Emerald's redemption? Off screen. Winter's grief? Off screen. Any and every one of these challenging beats to tackle can be waved away with, "We went through that arc while you were lost in the magical realm. Just get to know our new, improved selves now!"

Please, oh writing gods, don't let that happen.

Though I do worry because my last prediction came true.

But we all knew we’d end up here. My current theory? The portal should still be open at the vault. Winter will fight Ironwood, escape through it, and it will close right before he escapes too. He’ll fall with Atlas and everyone will act as if it’s some beautiful, poetic justice for him to perish with the city. 

Ironwood didn't make a break for the portal — too busy being unconscious — but we got everything else. Winter left him, he falls with Atlas, and this is some poetic justice, I guess. Really, it's just an undignified death. I'd hoped for a sympathetic kill, something that showed the characters still cared about him even if they knew Ironwood had to be stopped. Baring that, I'd hoped for an epic battle that took him out with style. Instead, no one even bothers to kill him. Ironwood is now beneath the entire cast, not even worth finishing off. Winter casually tosses his blast back at him and leaves. Cinder throws out a "that's checkmate" and leaves. I don't think Salem even looks at him. Ironwood (presumably) dies with no one and nothing, just a casualty of the city Team RWBY made fall. And I say "presumably" because the audience isn't even given the satisfaction of being sure he's passed on. Like Hazel, Ironwood's death is this weird, ambiguous moment that, based on the other character reactions, isn’t meant to be ambiguous. Is he dead? Most likely. Is it possible, based on what we've seen, that he'll pop up two volumes later like

Yes and, memes aside, that sucks. I don't want to be wondering for the next couple years if Ironwood survived and if they'll bring him back just to drag his character through the mud again. Move on.

But no, we don't even get that.

I've spoken at great deal about Ironwood both in these recaps and on my blog more generally. Last week, I said I'd covered it all and there was no need to rehash it all again. I stand by that, so let me just conclude this travesty with a final note: if your bad guy's final moment is using the last of his strength to point a gun at the actual villain of this story, and you don't realize the problem of how this image contrasts everything else the story has insisted about his character? … I just don't know what to do with that.

Oh, actually, final-final note: Ironwood’s semblance is officially a Schrodinger's semblance. It is both canonical and noncanonical simultaneously. Wooo. 

Cinder tells Salem she used her wish to "add more flames to the first of Atlas" and we cut to Watts, trapped in a roaring fire, unsuccessfully trying to break his way out. Wow, I hate that too! Next to Tyrian, Watts was our last remaining, entertaining villain. He carried a lot of the last two volumes and, I had hoped, was going to add some bright spots to the coming volumes as well. Apparently not.

Just another waste.

In addition to this casual, second murder of her ally, Cinder successfully convinces Salem that Neo killed Ruby and Ruby used the Lamp's last question, but she's back in her good graces since she snagged the Relics anyway. “You’ve done well, Cinder. Our work here is done" and they leave, blasting off like a less cool Team Rocket as Atlas plummets into Mantle.

Let's spend a second to tally things up then, shall we? What happens if Ruby, instead of throwing a moral fit, says, "You're right and we never should have lied to you, or betrayed you. But we want to help now. You get the Relics and the Maiden to safety in Atlas, if you can, we'll defend the people of Mantle"?

Well, they can still tell the world about Salem and call for help, much more easily now since Ironwood would likely just give them the code rather than them needing to spend an episode stealing it.

The Staff at least may not have ended up in Salem's hands and the group could have actually focused on getting the Lamp back (also solved if they'd been smart and just put it in the vault to begin with).

Mantle would still have been safe because Salem was never interested in Mantle to begin with.

Atlas wouldn't have fallen.

Ironwood wouldn't have died.

Penny wouldn't have died.

Even Vine wouldn't have died!

Our heroes unambiguously made the situation worse. Rather than banding together with their allies to fight the real enemy, Salem, they pushed until they made enemies of Ironwood and the Ace Ops both. Then they asked for help — which a pinch of logic said would never arrive — and twiddled their thumbs waiting for it. When it was clear none would come they...did nothing. They sat around, upset that the people were in danger, but not willing to do anything about it. It's only when one of their own, Penny, is threatened that they kick into high gear, hitting on a solution that they could have posed to Ironwood from the very start if no one liked the fly away plan. Yet instead of taking a few minutes to brainstorm other ideas — doing anything other than denouncing Ironwood to the rest of the group and attacking the Ace Ops — they spent two days sitting around, fixing minor messes they’d helped to create, then rushed through the portal plan, messing up the wish and stranding an entire kingdom in a sandstorm, with only Winter now to protect them from grimm.

Fantastically done, team. 

The villains won, yes, but not because the villains were smart and compelling. Watts' hack on Penny and the heat petered out to nothing and Salem... well, she sat around for the whole volume, expending energy only to torture Oscar and try to (unsuccessfully) stop some escapees. Neo and, miraculously, Cinder did the most damage, but only in the final hour, with this "damage" being that our characters fall into a void that we now know looks remarkably like a paradise! Everything bad that happened was a result of our heroes being stupid and stubborn. That's a compelling story to tell... but RT isn't trying to tell it. Our heroes caused so much damage, yet that damage goes unacknowledged — or worse, ignored into silence like with Ren — and everything else is waved away with the magic wand the series claims isn't there. The cold doesn't kill anyone. Oscar has no problems walking off the torture. Nora hops back out of bed. Ruby one-shots the Hound. The civilians lost to the void must have survived too. The entire kingdom successfully makes it to Vacuo... unless you count the massive army we never saw making use of the portals, but who cares about them, right?

The villains won, there was indeed something resembling consequences, but none of it was emotionally satisfying. Not even when the series tries so hard to insist that emotion is there.

Qrow watches Atlas fall, mouthing Ruby and Yang's names, but it's too little, too late. Where was this care for his nieces when he was obsessed with killing Ironwood? When did they care about him? Was it when Ruby shrugged at his arrest, when neither cared that he was missing, or when they were designing an escape plan that didn't include putting a portal where Qrow could reach? RWBY markets itself around the found family-ness of its cast, but they're done a poor job in recent volumes (not others) of convincing me that most of these characters care for one another. We went from Ruby denouncing all adults, to Ruby pulling an Ozpin with Ironwood, to Ruby watching blandly as her sister falls to her presumed death. This is my hero? This is the simple soul we're supposed to rally behind? Ruby doesn't feel like a character who cares about other people anymore and, given that she leads the charge, neither do most of her friends. Or, when that emotion appears, it's jarring and undeserved. Jaune cries over Penny's death? That's tonally and characteristically backwards.

This volume was the culmination of so many mistakes over the past two years. No, Covid couldn't have made things any easier for the crew — the fact that they got a volume out at all is amazing — but the pandemic isn't to blame for the problems in the story. These seeds have existed since Volume 5, with some (like Jaune) going back even farther. I don't think we're ever going to get that flawed, but emotionally fulfilling RWBY back. The show has dug too deep and unless it somehow manages to create a clean slate — those time travel ideas get more and more alluring! — there's nothing they can do but keep on digging. At this point, I can only hope that the series does wrap up within the next two volumes, rather than dragging RWBY to a Supernatural-esque length.

Our final shot of the episode proper feels fitting for what this volume has been. Atlas and Mantle flood rather than exploding, something that makes a certain amount of sense, sure, but definitely wasn't what I was expecting. And after all these shocking images — Penny dying, the grimm attacking, our main characters disappearing in a puff of gold dust — we end it all with bits of random debris. It's strange and underwhelming. Out of everything you could have done with the options you had, you choose to do this?

Of course, RWBY always has an after-credits scene (RIP Raven's, still amounting to nothing). Here, the sounds of water return to show us a beach. Crescent Rose imbedded in the sand, mirroring its classic pose in the snow.  

There's a tree. It's a very different kind of tree from what we saw in Volume 6, but the height and shape is nevertheless reminiscent of Light's domain.

A tree of life, anyone? After all, the group has fallen into a dimension created by a Relic, the gift of Light himself. It certainly seems as if RWBY is heading towards another encounter with the Gods, though what that will look like and how narratively satisfying it will be remains to be seen.

As for our bingo board, RWBY certainly pulled its weight! Only three squares got gold stars: Watts and Jacques didn't manage another team up because both are dead, Oscar didn't apologize for getting shot because he was too busy being tortured, and Qrow didn't drink likely because he didn't have access to any alcohol across the whole volume. Can't say that's a stellar result. The final image is something to behold though lol.

What a mess.

And on that less than exciting note... we’re done. This has been the volume of desertion, with a large number of fans telling me that they will no longer watch RWBY, but baring something entirely unexpected in my future, I'll be back next volume, for whatever that's worth. It never ceases to amaze me that even one person would give these nonsense recaps the time of day, so in all seriousness: thank you for reading. You rock.

Now go forth and fill the hiatus with great RWBY content!

✌️

#suicide tw #rwby #rwby spoilers #rwby volume 8 #mymetas #rwby recaps #rwby the final word

[class1akids]

It's odd to me to see you willing to write off the Shouto/Izuku friendship as onesided with Izuku being the lacking factor, when, unlike with Izuku and Bakugo, Shouto never asks after either of them after waking up in the hospital. Izuku wakes up in the vestige world and one of his first concerns are his friends and mentors, where Shouto is solely focused on his family. While the Todoroki family drama is more than enough for anyone, not a thought was spared for Izuku in that time (sans flashback

Once again, I said “portrayed one-sided” - it is a criticism of where the writing puts the emphasis, not what the friendship is supposed to be.  It was written more balanced in the past, but I started to have doubts if it will be dropped now that it served its purpose - delivering Deku to the Endeavor internship and to the battlefield to face Shigaraki. At least, to me it felt like there should have been some follow-up and at least a moment in the hospital. I understand why HK wants to keep BKDK apart, to set up their talk / DvK3 - but I don’t really see Shouto being a part of that - so it would have made sense for me to have a TDDK moment in the hospital (and I’m still hoping for a flashback).

As for Shouto not asking - unlike Bakugou, we never see Todoroki waking up - only quite a bit later, already awake - so we don’t actually know what he asked (or tried to ask considering his throat was burnt) when he first came to. 

But more than that, it was totally unneeded, because the narrative made Shouto’s priorities crystal clear in the first place:

1. He’s the first one to notice something is up with Izuku (and his general awareness of Izuku is a continuous plotpoint)

2. Questions his sudden take-off.

3. Actually follows Izuku.

4. “Midoriya hang in there”

5. The scream

6. The butt-catch

7. He worries if they are still alive

8. Specifically asks Iida to take “Midoriya and the others” out of the battle field.

9. Asks Endeavor to protect “Midoriya and the others”.

10. Decides to try to use flashfire against Touya only when Deku was hurt by his brother. 

Even in the middle of his family crisis, Shouto is always aware and worried about Izuku, he’s consistently on Shouto’s mind, even with his father, brother and other friends like Bakugou and Iida on the battlefield. Shouto’s main reason to follow, main concern remains Izuku. 

By contrast, Izuku only starts to spare a thought about Shouto once the plot specifically turns to the Touya reveal, and even then it feels that the friendship is mentioned again so Deku can take a role in that plot, by showing off BW-tongue move and hype up Endeavor, thus getting part-credit in taking down Machia. 

To me the only somewhat genuine friendship moments from Deku’s side were these:

Where he looks at Shouto as an inspiration as he’s hyping himself up to fight...

Where he decides to back up Todoroki (although this is a tactical decision and is framed like one - a calculated choice of well, the others got BJ, so I’ll back up Todoroki, unlike the pure instinct he displays when it comes to Bakugou, but also GT in this arc) and calls him a precious friend:

And when he looks if Todoroki is ok (but again, this scene is more about introducing danger sense):

So while Shouto’s concern and care for Izuku is consistently portrayed from the evacuation zone all the way to the end, including in the middle of his biggest family crisis - even though he has other stakes (notably his father and other friends that could deliver him where he needs to be) -  Izuku clearly spares no thought for Todoroki until the plot gets to a point where his friendship to Todoroki can give him endgame plot relevance. And then it’s dropped again.

I also fully understand why Deku  is thinking of Endevor in the vestige-world as people “near and dear” (though funny that Ryukyu is left off) - but it created to me a weird narrative balance, where it looked like everyone was more concerned with Endeavor than Shouto, including Rei and Izuku (Shouto’s mom and best friend) and like nobody seemed to give a shit how Shouto was doing in the middle of such a bad crisis, except Momo (and this at a time when all possible canon endgame ships got moments) and some classmates Shouto rarely interacts with. 

It left me with a big emotional hole - where I wanted Todoroki and Deku to interact and talk about OFA and Deku’s past lies about it, talk about ditching a team-mate/precious friend mid-fight and maybe check on each other if they are holding it together after everything. Studying for English exam together is cute, but the friendship is measured best at times like this, and we saw nothing. 

As characters, it makes all the sense in the world for me that they would seek each other out, moreover, I do think it’s important to both of their character-growth and lessons learnt from the war. 

I think it didn’t happen because Bakugou is being set up to have that TALK about not doing things alone with Deku (and it would be a pleasant surprise for me if Shouto was part of that discussion somehow, because it makes sense that he would, but also he’s always kept out of the BKDK key moments, so I’m not holding my breath). 

But if he’s not going to be there, I can totally see that all of this will be dropped and unaddressed until the very end, keeping Deku in the OFA-plot and Shouto in the Dabi-plot on two separate tracks; where Deku will not spare another thought for Shouto, while in Shouto’s arc, Deku’s interventions will be highlighted from everyone’s perspective again and again as the most decisive factors, just to make sure, we all credit him for any and all healing that happens in the Todoroki family plot (and not the people actually doing the emotional heavy lifting and hard work of healing).

And this makes me feel the way I do about the TDDK friendship - i.e. that it’s portrayed these days more as a plot-device to get Deku from a to b and link him into the pro-hero stuff whenever needed, plus give him more MC-feats and credits. 

And that leaves a bit of a bitter taste in my mouth, because the narrative tells me that Shouto making friends is a huge part of how he changed, and as a character who grew up more lonely and unloved than anyone in this entire story, save Tomura, I think he would deserve a real friendship. He would deserve someone who cares about him as deeply as Shouto does about him. 

And I don’t think Izuku is that person. His heart is too full of Bakugou and All Might and even Gran Torino, and it doesn’t feel like Shouto has the kind of place in it that I’d like him to experience and that would feel fulfilling. So I honestly wish Shouto had some other friendships in the focus that feel more equal and more reciprocal. 

And I’m not a TDDK-hater. I came into this fandom following TDDK art stuff and was fully prepared to ship it with all my heart. But what I found in canon, just is not all that.

And Shouto is not alone in this. Iida and Ochako are victims of the same phenomenon, where it feels like the person they care about the most doesn’t really have much space for them in his heart and thoughts. And it makes these friendships feel lacking, and kind of sad for these character when it’s still somehow in the center of their arcs.

#bnha meta #bnha #todoroki shouto #midoriya izuku #tododeku friendship #war arc #i've felt this before since the beginning of the war arc #but i think shouto has been iida-zoned and the tddk friendship will not get another lifeline and will just live off of old glory moments #deku at this point has way too many friends so they can't be all given enough oxygen #and i feel like it would have been good to develop other bonds #it would feel less like everyone else is just part of deku's following #but more like people who are loved back #i think if you are a deku-stan it's probably not easy to understand #but when you like a side character you want them to also get genuine love #and friendship #c1a asks #bnha critical #shouto will go to the end of the earth for izuku #izuku will save him when the others cover best jeanist #there is a qualitative difference there that i feel #and maybe he'd go insane for shouto too #but it's not like we were ever shown that #or we were ever shown him open up to shouto the way shouto let himself be seen by izuku #and it's fine #it doesn't have to be izuku #but i'd like shouto to have that kind of friendship #not where he's like at the mid-range of his supposed best-friend priority list #thank you for the ask

[tommybaholland]

Hello! I was wondering if you could write a angst oneshot about the whole Izuku leaving UA incident and how his s/o would take it seeing that letter right after the war ark, and maybe their reaction if he came back?

If you've done this already please just ignore this! (ˊ˘ˋ*)

where are you, deku?

featuring: midoriya

recent manga chapter spoilers in this one! i have to admit that i haven’t been the biggest fan of the current arc thus far but this is one reason why i write. so i included some stuff that i feel were missed opportunities. also, if you read the manga, i’d love to hear any predictions you might have. enjoy! x

sitting in a hospital was never fun. it’s already bad if you’re there to be treated but sitting there, waiting for someone to wake up, not knowing that they will? you’d rather be admitted.

you didn’t know how he would recover from this. there’s no way his body could handle everything that he pushed through to stop the evil from winning. was there even a winner in this war? you’re not even sure how or why it started. there were so many things happening, so many twists and turns and surprises that everyone who survived physically wouldn’t have much luck mentally. 

no matter how you spin it, there was no silver lining. and you were not the only one plagued by the lasting effect. 

todoroki’s supposedly dead brother is alive and a mass murder, mirio has his powers again but doesn’t know that tamaki might be dead, midnight’s death was confirmed days ago and no one could just forget about it..

and it had been three days, but deku had not awoken from his unconscious state. 

you were adamant about being the first one he saw when he woke up. he’d say that you’re stubborn but that was one thing you had in common. it was odd for him to stay unconscious for this long when he had always been the epitome of persistence. 

the sound of all might entering the room jerked you awake from what was probably the tenth time you had dozed off. 

“y/n,” he addressed. “you have done a great job keeping midoriya company but i think it’s time for you to get some rest. todoroki and bakugo have awoken, why don’t you go check on them with your other classmates?”

you didn’t even look over to him, not wanting to see the pitiful expression on his face. 

“why isn’t he waking up, all might? he doesn’t even look like he’s in pain,” you observed, looking down at your unconscious partner. 

“that must be a good thing, though, right?” the former hero replied. 

“yes but,” you paused, unsure of how to say it. “it’s odd. he’s not in a coma-induced state, he just looks like he’s taking a nap.” 

all might knew that midoriya and bakugo had kept the secret of ofa between them. now might be a good time to tell everyone, or at least everyone who should know, what was going to happen to him. midoriya was not unconscious nor asleep but was in a similar state, one that allowed him to talk to the previous holders of one for all. 

until he finishes his conversation with them, an explanation would have to wait.

“you have observed well, y/n. i can assure you that he is not in any pain and will wake up eventually. he’ll want to tell you everything when he does. until then, please go tell the other students what you know for now.”

“what if he wakes up?” you questioned, continuing to face deku with your hands over one of his casted arms.

“i’ll have someone send for you but i’m sure you’ll be around when he finally wakes,” all might reassured. 

you nodded, too tired to protest at this point. you stood from your seat before leaning down to press a parting kiss to his freckled cheek. his skin was warm which prompted a tear you didn’t know was there to fall down your cheek. he was alive but you wanted him to be okay. 

you wiped the tear from your face and sniffled before turning around to finally face all might. he patted your shoulder as you walked by, quickly leaving the room. you decided that you would do as you were told and to go check on your other classmates. however, you didn’t get very far when you ran into bakugo who was storming down the hallway while resisting the restraint of sato and mineta.

“Y/N! WHERE IS HE?”

It almost made you smile to see that bakugo was still his belligerent self, despite being seriously injured. however, that doesn’t mean he should be walking around so soon. you stood in front of the door to deku’s room, prohibiting him from entering. once he finally reached you, he tried to push past you with his hands on your shoulders. 

“you better move out of the way or start talking before i kill both you AND HIM,” he threatened when you wouldn’t move. 

“he’s still unconscious,” you replied solemnly. “but all might’s certain that he will wake up.”

bakugo’s demeanor changed as he observed the melancholy expression on your face. he wasn’t an idiot but you were. it was the least he could do.

“well, i agree with him. of course he’s going to wake up, you idiot.”

you looked up at him, waiting for elaboration from his sudden confidence.

“tch. i thought you loved him or whatever. somehow your annoying ass decided to put up with his dumbass so you of all people would know that he wouldn’t just quit. and if he does, i’ll make sure he’s really dead.”

-

once almost everyone was discharged from the hospital, you were instructed to return to UA. you were told that you would receive updates and further instructions the next morning. however, sleep was far from what you would receive. despite the exhaustion, you were restless beyond belief which made you delirious and you couldn’t tell if the shuffling outside your room was real or not. 

you woke up early, just when the sun was beginning to rise. you decided to get up as there was no point in trying to fall back asleep. you didn’t get even a step outside your room after stepping on a folded piece of paper that had been shoved under the door, waiting for you. 

it was a letter from him. 

it turns out that seemingly everyone got a letter from him. all of them varied in contents but they all conveyed the same message:

he had left the hero course. 

they also explained his power and how it passed down from all might which is the reason why the league of villains and all for one were after him. yours, however, included a little extra message written at the end. 

i love you, y/n. please don’t come looking for me. 

he had probably blamed himself for all the strife he had caused with the war but you thought it was dumb for him to leave. how did he think he was going to do this on his own? there was obviously more to this story than he provided but given that he told everyone in the class, he had to keep it simple. 

it was all making sense to you, shedding some light as to why all might was so sure of deku’s recovery. however, you didn’t get to see him when he woke up like you were told. he played it safe in writing these letters because he knew that you and others in the class would only try to stop him if he left. everyone was asking you about what you knew and you couldn’t tell them squat. you tried calling and texting him but he wouldn’t answer.

it was an odd feeling. you didn’t know whether you should be mad or not. if you couldn’t see your boyfriend yourself, you had to talk to all might. however, mr. aizawa was the only thing standing, or rather now sitting, in your way. 

“by now, you all know that your classmate, midoriya, has left the hero course. this does not mean that the rest of you should follow in his footsteps.”

even though he didn’t tower over everyone anymore from his wheelchair, he was still equally as intimidating. 

“now, UA has agreed to use its campus as an evacuation shelter. your families have already begun the moving process. classes will resume as normal but no one will be allowed to leave the campus under any circumstances. we’ve put a pause on all work study-related activities outside of the school until we know that there are no more possible threats, at least, for now. any questions can be directed to me.”

“will all might be returning?” you asked.

“all might will be taking leave from teaching for now,” answered mr. aizawa. “as i said, you can direct your questions to me.”

“right, sir, but i have questions for him about dek-- i mean, midoriya.” 

“well, you’ll have to wait until he finds an opportunity to return then.” 

“when will that be?”

“whenever he finds an opportunity, y/n. any other questions?”

it seemed like you were at a loss until you remembered something from when you were in the hospital with deku. bakugo’s behavior when you told him what all might said changed rather abruptly and you don’t think it’s because all might is his favorite pro hero. although they grew up together, deku and bakugo were anything but close. however, bakugo’s affirmation that he would recover felt odd and like he knew something that made him sure of it. 

this led you to pursue him as your next lead. 

you found him later in the kitchen making something for himself, as he usually cooked for himself than eating the food sent over by the school. 

“what did you think about his letter?”

“what letter? i didn’t get anything from that damn nerd.”

that was surprising but that logic further pushed the idea that he knew something and therefore didn’t need a letter to explain it to him. 

“so you don’t know anything about this?” you asked as you pulled out the folded-up paper that was left at your door that morning. 

bakugo snatched the paper out of your hand and scanned over its contents quickly. his brows raised by the time he reached the end before he grimaced again. 

“that idiot,” he muttered under his breath. 

“so you didn’t know about it?”

“this is almost the same as what everyone else got,” he observed, ignoring your question. 

“okay. but did you know about it?” you asked again.

“of course i did, you dumbass! so are you gonna ask me a billion questions now that his cowardly ass isn’t here to explain it to you like he should’ve?”

“so there is more to it.”

“he gave you the gist of it. that’s really all you need to know.”

“but what do shigaraki and all for one have to do with this?”

“can’t you read? the letter literally explained that.” 

“like you said, it was really only the gist of it.”

“well, you were right in wanting to talk to all might but i guess you’ll have to wait.”

“no. if you know something, i need to hear about it. also, why do you get to know about all this?”

“because that moron originally told me about it back when we started school here. i didn’t take it seriously at the time until he started getting stronger. right after we moved to the dorms, he and all might told me everything,” he explained.

“i need you to tell me what happened then because he and all might aren’t here right now.”

“look, it’s really not my job to tell you! this really belongs between the two of them. dumb deku just promised that he would be strong enough to try to beat me.”

“at least tell me why he felt he had to leave when we could’ve helped him! i know he likes to act like a selfless idiot but i don’t know if he can do this by himself.”

bakugo sighed. “this is his fight and his fight alone. like icyhot said back at the sports festival, he has all might in his corner. that’s all the help he’s gonna need.”

you nodded in agreement.

“plus, that dumb power of his involves more than what you’ve seen of it,” he added cryptically.

“what does that mean?”

“did you even read the letter? it said that the power was passed down from all might to him, moron.”

 “again, that doesn’t really mean much to me,” you pressed.

“tch. yeah. you probably only paid attention to that gross end part. that stupid nerd,” he muttered. 

“what was that?”

“look, i’m done talking with you. either talk to all might or use your damn head.” 

that wasn’t a complete waste of time but it certainly was a lost cause. despite his arrogance, everything bakugo said was true. he’s not someone who goes around lying about things so you felt that you could trust him when he said that deku would be in good hands with all might. 

you left the kitchen somewhat satisfied but it still bothered you that you didn’t know everything completely. you wondered if there was anyone else who knew about it but the chances were slim, given that bakugo also stated that it was between deku and all might. 

while heading back up to your room, you ran into todoroki. you hadn’t talked to him much since the war. out of anyone, he was probably going through it more than anyone. 

“hey, todoroki. how are you holding up?” you asked, grinning softly. 

his voice was still recovering but it was a lot better than a few days ago. “hello, y/n. my family’s okay for the most part and my father is finally doing what he should.”

you didn’t want to pry but you knew what he meant. 

“did you get a letter?”

“from midoriya? yes. i’m not especially surprised since he and all might have been close since school began. however, i do find it odd that he suddenly has another power. did you notice it?”

you nodded. “it first happened during the training session with class B, right?”

“yes. were you ever curious about it?”

“he was probably more freaked out about it than anyone else so i didn’t focus too much on it,” you explained.

“i asked him about it and i agree, he did seem apprehensive about it.”

there was a beat of silence then which had you pondering over what bakugo had said.

“apparently there’s more to his power than we think and it has something to do with the passing from one user to another,” you reported.

“i’ve been thinking about that, as well,” todoroki replied. “it’s possible that midoriya’s power is evolving to beyond what all might could do with it. it would make sense, given quirk singularity.” 

his theory seemed reliable since he would know about something like singularity. 

“thank you for sharing that with me, todoroki. it think it’s quite possible that you’re right. i’m going to try to talk to all might if you want to confirm it,” you offered.

“thank you, y/n, but i believe the answer will be more clear later on. there’s something i have to focus on for myself right now. i hope you find out more soon.”

you thanked him, wished him well, and made the rest of the way to your room. now, you really couldn’t imagine what todoroki was going through. if anything, he had just as much weight on his shoulders as deku right now. 

then again, you still needed answers as to exactly what he was doing.

later that night, bakugo sat on his bed looking down at a piece of paper. it had four simple words on it. words that both excited and annoyed him immensely. 

i’m catching up, kacchan. 

-

months passed and you hadn’t heard from deku. well, you had but not in the way you wanted. you finally got in touch with all might, who showed up to UA in person. apparently, mr. aizawa had passed down the message that you were wanting to talk but you don’t know how long ago that had been. you appreciated his effort but at this point, it was your boyfriend who you needed to see now. you didn’t want to displace your anger onto him but he could see that distress that you are in. 

“i’m sorry that he couldn’t come himself,” all might apologized.

you sighed. “it’s alright. it seems like he has better things to do now.”

“he just needs to work on yielding one for all,” all might elaborated. 

“is that what it’s called? one for all?”

“he didn’t tell you about it? i thought he wrote everyone in the class a letter?” 

“he did but he didn’t go into too much detail which is why i wanted to talk to you,” you explained, your tone rather aloof. 

“right. of course,” all might replied before clearing his throat to fill in the missing pieces.

it turns out that todoroki’s theory was on the track in that one for all had reached the singularity point and the quirks from its predecessors were beginning to manifest. 

“the fact that he was completely quirkless before one for all makes the singularity point easier for him to transition to and use the other six quirks.”

that was news to you. “he was quirkless?”

“yes.”

it was all making sense now. everything that seemed off about him and his power was because he never had one in the first place. you also could now understand why bakugo was the most hostile with him when it came to training and deku’s improvement with his power. and this was why bakugo was dead set on deku coming out of this alive. 

however, you couldn’t help but feel naive. you felt like you should’ve listened to your intuition more when things weren’t adding up and he was landing himself back in the hospital with broken arms time after time. but you ended up falling in love with him and it wasn’t because of his power. in the same vein, you weren’t about to hate him for it either, like bakugo or even todoroki at the beginning of the school year. he had worked hard to where he is now and the truth was that he had always been that way, quirk or not. 

but how come he felt the need to hide it all, especially from you? bakugo had only recently been clued in about all of it so why not you as well?

“i made him not say anything to anyone, especially since i had started teaching at the school,” all might explained, continuing to be incredibly perceptive. “and bakugo was only roped in because he was catching on to it.”

“yeah. he told me that deku originally told him a while ago,” you recalled. “so what is he going to do about shigaraki and all for one?”

“we’re not entirely sure yet. right now he’s mostly acting as bait to try to lure out the league of villains while taking care of any stray villains from the prison breaks.” 

“so what you’re saying is you don’t have a plan?” you questioned.

“we’re considering all of our options, y/n.”

“who?”

“deku, myself, endeavor, and hawks. best jeanist has also been helping with recon,” he elaborated. 

of course, he’d have the top three heroes and all might on his side. not to mention all the vestiges talking to him in his head. what about the rest of the class though? surely he was going to need more than that. hero society is hanging by a thread that could snap at any moment if the villains strike again first. 

“why didn’t you let me see him after he woke up?” you asked, changing the subject. 

“we wanted him to stay at UA, as that’s where he’d be most protected. unfortunately, every decision has been his own,” he answered.

that was what you were afraid of. 

since that conversation, the city had been partially recovered, villains were being captured, and there weren’t any threats as of yet from the league. UA fully reinstated work study programs and students were allowed out under heavy supervision. 

todoroki kept coming back from his father’s agency with letters from deku to give to you. you read them, of course, but hadn’t replied to a single one. talking to all might was helpful, it really was, but you couldn’t help this nagging feeling inside you. his letters didn’t help much either. of course, you were happy to hear from him and it did give you that tingling feeling of love that you hadn’t felt in months. 

the letters mostly detailed what he was doing and provided updates on his progress since you had talked to all might. however, if he was freely moving about the city, you didn’t understand why he couldn’t just come talk to you. all might had said that all the decisions made were his own and he was doing it in the best interest of you, the school, and his family. the thought of deku saying that he didn’t want to see anyone else get hurt made you shake your head. he’s very persistent and strong-willed but he too often doesn’t accept the help nor listen to the warnings of others, yourself included. 

you missed him but you were also resentful towards him and you hated feeling that way. you wanted to be supportive rather than selfish but it was hard when he could be too self-sacrificing. it’s not that you didn’t have faith in him. you just wanted to prepare for the worst. 

-

“hey, idiot.” 

“what is it, bakugo?”

bakugo and todoroki approached you one day after they came back from their work study. 

“we’re trying to tell you something important so don’t cop an attitude right now,” he glared.

you gave him an unamused look, unfazed by the irony. “so did you need something?”

todoroki spoke up next. “yes. my father would like to recruit you for work study. you don’t currently have one, right?” 

“no. i don’t,” you replied honestly. “why does endeavor want me all of the sudden?” 

“because midoriya—“

“shut up, you half and half moron!” bakugo interrupted. “look, we need help and thought you would want to be included.”

“okay. but why me?” 

“you’re such a dumbass. just come with us!” 

and now you were here at the endeavor agency in your hero costume with an uneasy feeling. maybe it was because you were standing right in front of the number one himself.

“hello, y/n.” 

it was true that he didn’t have any other expression other than a scowl. lately, that scowl seemed worn down and honestly, you couldn’t blame him. 

“bakugo and shoto have told me about you. of course, i first heard about you from deku.” 

your ears perked up at his hero name. you hadn’t heard it in months. 

“since he has left the hero course, we needed another student apprentice at the agency. the reason why we didn’t contact you sooner was that we were overconfident in thinking that we didn’t need another and for that, i personally apologize.”

endeavor bowing to you was a sight you thought you’d see only in your dreams. 

“so what is this really about then?” 

“the league of villains is on the move and he needs some help.” 

you didn’t have time to even think of a response before the familiar mess of green hair came into view. that was really the only familiar thing about him against his dirty and tattered hero costume. not to mention all the upgrades that you had never seen before. 

“hey, y/n,” he greeted with a soft grin.

you felt like your heart had stopped for a solid three seconds. 

“deku…” you breathed out finally. you let the tears well up in your eyes. you didn’t want him to see you cry. you felt a rush of adrenaline pull you towards him and tackle him to the ground. 

from the view, it looked like you were happy to see him. you were anything but thrilled. 

“why— how— w- what are you doing here?” you questioned, leaning over him on the ground. you face felt hot with rage but you couldn’t stop it. the more you tried to suppress your emotions, the more intense they felt. 

“well, i wanted to see you!” he answered, trying to lighten the mood. 

“you wanted to SEE ME!? what about the previous eight months, huh? or when you woke up? you didn’t want to see me then either?”

“y/n, please i didn’t intend to abandon anyone. i only wanted to protect—“

“everyone, right?” you interrupted him. “what about the rest of us? we want to be heroes too! we’ve fought countless battles and went through a whole war with you! when are you going to get it through your dumb head that we want to help you?”

“heh. they sound like me now,” bakugo quietly commented as he and todoroki watched this whole scene. 

“i wouldn’t get excited about that,” replied todoroki.

“i’m sorry if i’m being selfish but this isn’t fair, deku,” you cried, your tears dripping onto his face. 

if he thought about it, deku had improved immensely in the last several months, most likely at a quicker rate than he had at UA. however, that was because there wasn’t as much restraint on the usage of his powers. he got to fight high-level villains without a lot of supervision. he was essentially a vigilante and the top three of the hero society were allowing him to do it. 

“i’m sorry for leaving, y/n,” he began, sitting up as you leaned up off of him to wipe your tears. 

“i wasn’t thinking about everyone’s feelings but i felt that it wasn’t anyone’s decision. you guys would have stopped me no matter what.”

you didn’t make eye contact with him until his next sentence. 

“but that doesn’t mean i should be treated as a special case. you’re right, i shouldn’t waste all the energy and effort everyone has put into to stop something that i’m mostly responsible for. even though i’ve been figuring things out on my own lately,  i have no idea how i’m going to stop all for one or save shigaraki.” 

you suddenly felt stupid as he looked down solemnly. you were stupid for overreacting. at the end of the day, this was his fight. no one else could do this but him. however, hearing that he needed help was what you needed to hear. 

your boyfriend needed help.

“hey,” you called softly, placing a hand over his cheek. he looked up as you with glossy green eyes. 

“you don’t have to do this all by yourself. you have so many friends and heroes wanting to help you. i know you don’t want to lose anyone but i think everyone involved knows the risks.”

you looked back to bakugo and todoroki for reassurance. todoroki nodded in agreement while bakugo simply, “tch. whatever.”

“you’ve got me, too. you’re never gonna lose me, deku. and i won’t let you lose either. i love you too much even if you can be really dumb sometimes.”

“i love you too, babe,” he reciprocated, his face getting closer to yours. “i did really miss you.”

“i know, baby.”

you completed the reconciliation with a sweet kiss, one that made bakugo roll his eyes.

“can you idiots stop wasting my time already?!”

“i agree,” endeavor spoke up. “we should start telling them what we know.”

“right! sorry, sir!” your boyfriend squeaked before scrambling to get you both off the floor. you stifled a laugh. he’s probably seen some stuff over the last few months but his cute, spastic self didn’t change much. 

“let’s get y/n acclimated to the agency first and then we’ll go over everything,” endeavor suggested. 

“oh my gosh, y/n! i can’t wait to show you how huge this place is! c’mon,” deku exclaimed, grabbing your hand and pulling you around the office.

he didn’t want to let go once but if you wanted to because your hands were sweaty, he’d simply reach for it again. his thumb ran over the back of yours when you were just standing next to each other, giving it an occasional squeeze. even when it was his turn to talk, he didn’t release.

“okay so here’s what i’ve done recently and the information i’ve gathered from those encounters..”

you didn’t know what the end result would be and he was none the wiser. he knows how he wants it to end and now he has people he can count on for that.

heyy bnha night! let’s hear about more of your favs..

#mha x reader #bnha x reader #midoriya x reader #midoriya fluff #midoriya angst #midoriya oneshot #request #requested #tommybaholland