pencil-peach

[pencil-peach]

Her skin sits weird on her face

#aigis #persona 3

[pencil-peach]

Wishing you a very have a nice day. Or night. Whatever makes the most sense if/when you see this. I’ve been a follower for years but I am nervous so weeeee anon time

Oh this is so sweet! Thank you for sticking around all this time! I hope you're doing well yourself, and I hope I could bring you some little enjoyment every now and then!

#i was so surprised when i got this ask #thank you very much #this really made me feel better #i wish you the best in whatever path your life is taking!

[pencil-peach]

mitsukari outfit swap

#yukamitsu #persona 3 reload

[pencil-peach]

Thinking about Persona 4 Arena Ultimax

Specifically the Persona 3 side of it.

I think it's interesting (and kinda funny) how a lot of the P3 content in this game is built upon the many CD Dramas that released in Japan following Persona 3/FES' releases, specifically the New Moon/Full Moon and Daylight/Moonlight Duologies.

As what's most likely the largest example, Labrys, one of the two major characters introduced in the game, was actually named in the Moonlight CD, which was released back in 2007 (Arena was released in 2012, for reference)

"The 7th Generation, Aigis, was created from all the data we'd obtained from all prior designs up to the 5th Generation, Labrys." (Moonlight)

Aigis' and Labrys' motivation of finding their mother is also building upon the story of Moonlight, where Aigis is able to speak with the girl whose personality was one of the bases used for the Anti-Shadow Weapon development project, and who refers to herself as her mother (but looks more like her younger sister).

"That's right... in human terms, I guess I'm kinda like your mother or something? A-ah, but based on our outward appearances, I guess I look more like your younger sister?" (Moonlight)

(For context, she is forced to forget this meeting at the end of the CD, but resolves to meet with the girl in real life. She isn't named, but we're told she has black hair.)

I think Mitsuru is the most interesting, as her appearance in the game is almost wholly influenced by the story of the New Moon/Full Moon Drama CDs, which are a side story covering her and the broader Kirijo Group's situation immediately following Takeharu's death, released in 2009.

Mitsuru's story opens up with her going public about the bloody past of the Kirijo Group and the existence of the Dark Hour and Shadows. This is following up on her resolution near the end of Full Moon, where she states plainly that this is the path she's going to take.

Ichiro Takadera: "Well then, do you intend to make a public announcement regardless of what follows? About the Shadows and so on?"

Mitsuru: "That is my path in life. I cannot stray from it." (Full Moon)

Kikuno Saikawa, Mitsuru's right hand maid and one of the shadow operatives, also made her debut in New/Full Moon. The two of them met when they were children, and Kikuno vowed to protect Mitsuru after she'd saved her from her despair as a child.

Kikuno: "Six years ago, when I learned my stay at the hospital wasn't because of illness but because I was sold over by my parents, you were the one who saved me from my despair. On that day, I swore I'd devote my life to following this person." (Full Moon)

Ultimax was the first time she was given a design, but she would later appear in the Persona 3 Movie: Winter of Rebirth. Her characterization in Ultimax is pretty faithful to her depiction in the CD.

(A fun fact is that Kikuno was also mentioned in the "Seaside Vacation Before Death's Scythe" Drama CD, which was released in 2013 as a promotion for the then upcoming first Persona 3 Movie, Spring of Birth.)

One of the Kirijo artifacts mentioned in Mitsuru's prologue is a ring that gives its wearer immunity to the effects of the Dark Hour. This too is an object introduced in New/Full Moon.

"Also, there is no need to worry, as everyone who are not in possession of special powers, including me, will wear this ring. While it's on you are able to experience the Dark Hour and even when you take it off your memories of it will remain." (New Moon)

Something that doesn't come up in Ultimax is that if you smash the jewel in the center of the ring, you'll lose all your memories of the Dark Hour. It's an interesting little thing! I mean it's. Useless now cause the Dark Hour is gone but it's pretty cool...

Mitsuru's main internal conflict is her inability to ask others for help for fear of burdening or endangering them. This is something that comes up in Persona 3, but in the Drama CDs this aspect of her character is very deeply explored. It's her main emotional arc and the source of her conflict with Yukari in both the New/Full Moon CDs and Persona 3 Character Drama Vol. 4, which focuses on their relationship.

Yukari: Is your faith in us that weak?

Mitsuru: To be frank, I can't bear it anymore. I don't want others to die for my sake!

Y: And you're gonna sacrifice yourself because of that? Why do you take on so much by yourself? Is that really okay with you? Don't you want to see your friends and family again?! And to survive?! Why can't you just be honest?!

M: Of course I want to! But...that is...what should I say? It's always like that...whenever I get soft or burden others... They might end up dying again. [...] Aragaki, and my Father... What am I supposed to tell you after all that happened? Even if I'm afraid and wish to be saved, what do I say?! What should I say?! (Full Moon)

Yukari even brings up that they've had this talk before. It could be referring to their heart to heart in Kyoto, but I think it could also be read as their conflicts in the CDs too.

When Ken asks Kikuno where she learned to fly a helicopter, she states that she learned it after being involved in an assault operation on a high school dormitory, an incident which Ken says he remembers. (Say it with me now!) This is most likely referencing the climax in Full Moon, where the Kirijo Group led by Takadera attempt to raid Iwatodai Dorm and forcibly apprehend SEES, so as to avoid the possibility of Ikutsuki's plot and the Group's sins from becoming public.

There's definitely more stuff, but I just wanted to point out the things I noticed/particularly liked with Mitsuru's story.

I think Junpei suffers the most from having a lot of his characterization be taken from the CDs. A lot of people were (and still are) confused about P4AU Junpei's seemingly sudden hard pivot to Baseball, as in Persona 3 proper, it's not a very large aspect of his character.

But in the CDs, Junpei being Into Baseball is MUCH more prominent. As in he refers to everyday situations in baseball terms sometimes.

In Persona 3 Character Drama Vol 2., (released in 2008 and centered around Junpei and Chidori) Junpei dreams about taking Chidori out on a date, and eventually settles on asking her to go to a baseball game with him. (She accepts, if you were curious).

He talks with Chidori about baseball so much that she got into it herself and started watching baseball in the hospital.

At the end of Moonlight, the SEES gang talk about what they want to do after they defeat Nyx, and Junpei says he wants to go to a baseball game. They even kind of tacitly explain why he didn't talk about it all that much ingame by saying he'd fallen out of interest in it but that he "feels like it's returned in full force!"

The thing about P4AU's heavy references to the CDs though, especially in Junpei's case, is that they were never officially translated or released outside of Japan. To this day the only way for non-Japanese speaking audiences to experience the CDs is to listen to them with (usually slightly incomplete) fansubs online.

While I kind of appreciate the novelty of that, it's definitely caused some confusion when it comes to characterization. In P3 Reload, for instance, Junpei makes a lot more references to baseball in his dialogue. And for a lot of people, it feels like the purpose of that is to retroactively make Junpei's appearance in P4AU make more sense.

And while that's not incorrect, it misses the fact that Junpei was already established to like baseball in supplementary material before Arena came out. It's more like making his character consistent with the same material that P4AU used when writing Junpei.

But it's not like you can even blame people for thinking that because a lot of people are normal and don't listen to 16 year old fan translated Drama CDs uploaded to youtube. It's just interesting to me I suppose. I wonder how much characterization we miss due to lack of access to supplementary material.

Anyway you should listen to the CDs though they're really good. New Moon/Full Moon especially.

Moonlight is also very good, it's a pseudo-prelude to The Answer, and the character writing is top notch.

But that's all I had to say, really. Just thought it'd be fun to talk about.

Translation Credits: imaginary_numbers (Moonlight) pipeds (New Moon) pipeds (Full Moon)

#if you're a yukamitsu warrior #watch new moon/full moon #character drama cd vol 4 #and moonlight #but the rest are also just really good. the characters feel like their authentic selves #afraid to put this in a persona tag cause i dont want people to yell at me over some perceived inadequacy #they're also very well acted too #like god damn

[pencil-peach]

Mitsukari Pt Deux

#persona 3 reload #yukamitsu

[pencil-peach]

Mitsukari

#persona 3 reload #mitsuru kirijo #yukari takeba

[pencil-peach]

English translated version of Special Interview: Hiroshi Kobayashi (Director) ✕ Kana Ichinose (voice of Suletta Mercury) ✕ Lynn (voice of Miorine Rembran), from the Mobile Suit Gundam: The Witch from Mercury Commemorative Book

View as a text document here.

(these images are pages 048-051 from the WIP Commemorative Book scanlation)

#Oh my god they clarified the permet crystal with eri inside thank GOD #I noticed it SOO long ago and i never saw ANYBODY else mention it (i was planning on mentioning it in the Onscreen Text 24 for that reason) #I was like #Is the Crystal really small?? How does it fit inside Hots-san? Is it physical? Ephemeral??? #knowing that eri isn’t physically stuck inside Hots-san makes me feel better. I’m confident they’ll make her a real body someday! #Miorine carrying the crystal inside her suitcase is funny though. Taking my sister (a big rock with her biometric data encoded) to work #Thank you so much! I’m glad even the director wished there were some more character interactions too

[pencil-peach]

G Witch Onscreen Text: Episode 23

Welcome back to Part 24 of my Episode by Episode analysis of G Witch and its onscreen text! We're on Episode 23: Unrelenting Tenderness.

<< If it's too much tenderness, you can return to The Woven Path. Or you can go to the Masterpost.

It's the Penultimate.

Before the opening sequence, we see this scene where Chuchu has to pilot the Demi Barding without the assistance of Permet Links. It's really difficult, and it makes sense if you think about it. Permet excels at evenly distributing and communicating information, such as, in this case, all of the functions of a mobile suit. Without that link, you basically have to pilot it taking all of the systems that the link previously handled for you into account. (Stabilization/Equilibrium are the most important ones that come to mind)

Of course, Chuchu quickly adapts, because she's just that good at it.

For these final 2 episodes, the OP changes once more, in that the mobile suit montage now depicts the attack on Quiet Zero, featuring Demi Barding, Calibarn, Aerial, the Gundnodes, and the Schwarzette. The final scene zooming in on Suletta's face has also slightly changed to show Permet Scars running along it, as she's now piloting Calibarn and not Aerial. (I've always liked how Demi Barding is shown engaging in combat in the montage considering that that. Doesn't happen.)

After we come back from the intro, we open on the Jeturk brothers' conflict.

Lauda demands to know why Guel never told him about what happened to their father, and he believes it's because Guel thinks he's unreliable. Lauda has always supported him and believed in him through all of their strife these past few months, but it seems to him now that Guel doesn't feel the same. He didn't tell him about their father, he abandoned him at the school, by all intents and purposes, he's shutting him out of his life.

But Guel insists that wasn't his intention. He truly cares about Lauda. He didn't tell him about their father because he wanted to protect him from the harsh reality that he had to face. It's like what Miorine did to Suletta. Leaving them behind and bearing the burdens themselves in the hopes that they can lead a normal life.

But in the end, all Guel was doing was hurting him, leaving him alone with his grief. Lauda needed his brother to be there for him and he simply wasn't.

You'll notice that in this scene, Guel is piloting his Dilanza instead of the Darilbalde. If you remember, during the duel with Shaddiq it exploded, presumably beyond repair. I brought it up before in Episode 17's analysis, but the Darilbalde can be seen as a representation of the brother's relationship throughout the series.

In Episode 4, after the duel, the brothers have a talk in front of the heavily damaged Darilbalde, a sign of their relationship becoming strained due to the influence of their father. (Top)

In Episode 17, the brothers talk in front of the Darilbalde again, newly repaired: A sign of their renewed bond. Guel has let go of his pride, and Lauda's support of his brother is still unwavering. (Middle)

But in Episode 20, when Lauda learns the truth of Guel having killed their father, the Darilbalde explodes, utterly destroyed, showing that the truth has left their relationship (as it once stood) irrevocably fractured. (Bottom)

Delling Rembran making use of the power of frustrating bureaucracy to buy time for the others. Thanks bozo. You ever think about how Delling never spoke to Suletta even once in the entire series.

When Suletta and Eri are arguing, I think a lot about how the examples she uses for why she can't forget about Eri and their mother are specifically about being able to comfort her when she's sad.

If you look back throughout the series, we never really see Prospera be sad or afraid around Suletta. She always maintains a calm, confident, cheery exterior around her. I think after Eri showed her the memory of Prospera crying over her body, and everything that happened at Vanadis, she came to the conclusion that her mother is doing all of this because she's deeply, deeply sad, and she wants to support her.

I think this sequence gives us a good look into Eri as well. The things Suletta describes are all physical. When she hears them, Eri looks down, deeply upset, because these are all things she wants to do too, but she can't, not as she is now. Quiet Zero seems to be the only way for Eri to be able to physically be with her mother again after decades of being trapped in an unfeeling machine. It makes sense why she wants the plan to succeed so badly.

Not to mention Prospera's face when she hears that. Just utter disdain. I wonder what her eyes look like under the mask in this scene.

When Eri prepares to destroy the capsule containing the team infiltrating Quiet Zero (Left), the framing is similar to when Eri first took someone's life in the Prologue (Right). But whereas before, she was a child who simply didn't know any better, this time there is murderous intent.

But before Eri can execute her intention, something interferes, causing the Data Storm and the Gundnodes inside it to destabilize for long enough to give the team time to escape. When this happens, Eri interrogates the suspect, asking to know why they're interfering, explaining that the Data Storm can give them everything they want. We learn later that this interloper, and the person Eri was talking to, is 4lan, who's Artificial Nervous System data was incorporated into Quiet Zero at some point.

I think a lot about these two, and the framing of both of these scenes. How Eri knows it's 4lan doing it, and how she tries to convince him otherwise, saying that the data storm can make both of their dreams into reality. I think about how 4lan died before knowing anything about Eri, but understands her situation when Suletta meets him again.

Maybe this is just wishful thinking, but I like to imagine that Eri and 4lan talked within Quiet Zero, and, both having had their lives cut short, Eri promised him that he could have a new life with her and Prospera in Quiet Zero's data storm once the plan succeeded. I think, if things were different, they could've been good friends.

After this, the Assembly League speaks to the head of the of the League Fleet stationed outside Quiet Zero, asking her to make use of the Laser Power Interplanetary Transmission stationed in Lagrange one to take out Quiet Zero (and, consequently, the Benerit Front). To this, the commander responds that making use of that laser would take out the entirety of where both are stationed, that being Lagrange 4.

They never really explain what a "Lagrange Point" is in the show, but the novelization actually explains it. Here's its definition:

The term refers to the gravitational equilibrium points between two celestial bodies — such as the Earth and the Moon. There are five points from L1 to L5, and because the energy required to maintain a fixed position in these areas is reduced, many fronts are concentrated there. Asticassia School of Technology is located at L4.

In simpler terms, a Lagrange Point is a point in space between/around two large celestial bodies where the gravitational pull of both forces causes smaller objects within them to stay put/(in the case of an orbiting body) follow along its orbital path.

In the case of G Witch, the Lagrange Points in question are the ones created between the Earth and the Moon. Here's a diagram of them.

(Correction: Thank you to @gomez-alonzo-addams for the correction! I mistakenly thought the Lagrange Points were those of the Sun-Earth System, but they're actually those of the Earth-Moon System, which are a recurring element of many Gundam Series starting from the original.)

The Fronts are artificial living spaces built in space, constructed into Asteroids. Since it takes less energy to maintain a fixed position around Lagrange Points, Fronts and other large living spaces are commonly built within them.

For convenience sake, I went ahead and organized many of the shows locations into their Lagrange Points. This isn't an exhaustive list, and I might have missed some, in which case please let me know and I'll correct them! It kind of stinks that we don't know which Lagrange Point Folkvangr was stationed at :(

(Edit: Added Quiet Zero's Construction Point to Lagrange 2. Thanks again to @gomez-alonzo-addams for the info!)

Funny how the story is actually relatively contained in a small area, that being Lagrange 4.

Anyway, I really like how even O.Elan is kind of disquieted about Peil and the League Council's utter depravity here. He may love money and have a loose moral code but these guys are on a whole other level.

It's not necessary to document all this text, but according to the display, the infiltration team is headed for "Core Block C" to shut down QZ.

Cutting back to the Jeturk Brothers, their final clash is much the same as Guel's final clash with Vim. A full frontal assault with sword weapons. Both clashes' climactic moment even end with one stabbing the cockpit of the other.

Before, Guel won out against his father because he was afraid to die, but against his brother, he deactivates his sword and takes the full brunt of Lauda's attack, unafraid to die if it means his brother will stop piloting the Schwarzette.

It seems like history will repeat itself once again, but luckily Felsi was there to save the day! Everybody say Thank you, Felsi.

When Miorine and Bel access the Quiet Zero's main console and attempt to input the shutdown code, they input 4 codes:

Miorine inputs "quod erat demonstrandum" (top left) first, a latin phrase meaning "what was to be shown," or "which was to be demonstrated." It's usually shortened to the acronym Q.E.D, and placed at the end of mathematical proofs or philosophical arguments to indicate that the paper is complete.

After that is rejected, Bel inputs "Quod Erat Demonstrandum," (top right) which is. Exactly what Miorine just typed but capitalized. It is obviously also rejected.

After that, Prospera appears, and when Bel begs her to stop, Prospera explains why she can't:

"Eri is the child blessed by Vanadis' ideals, yet there isn't a place for her in this world. So I'll have to make one. A place where Eri can be happy."

At this, the next code Miorine inputs that gets rejected is "quod erat faciendum," (bottom left) a latin phrase traditionally placed at the end of geometric constructions, meaning "which had to be done."

Frustrated, Miorine demands to know if Prospera cares about Suletta at all, to which she responds:

"I do love her, but now she has friends like you."

Seemingly in response, the terminal rejects the final code we see Miorine input, that being "quod est absurdum" (bottom right), meaning "which is absurd."

Isn't that nuts? These codes only appear onscreen for mere frames and they still put in the effort to make them responses to Prospera's arguments. Or maybe, seeing as how they're meant to be placed at the end of arguments, perhaps they're meant to represent Prospera's final thoughts on the things she's saying. Either way, isn't it amazing that they put in the effort anyway?

When Miorine gets through to the Administrator Environment, the available tabs are:

Metasystem Administration

Startup Control

Permissions Management

Energy Management

Notrette

Internal Environment Control

Crew Management

Physical Defense Management

Outer Wall Defenses

Quarantine Related

Intrusion Defenses

Digital Defense Management

Defensive Quantum Computing Status

Hardware Availability Management

Navigation Control

Enemy Search Management

Course Prediction

Drive System Management

Course Prediction Avoidance

If this post wasn't already thirty miles long perhaps we could spend more time here, but alas! I think it's cute that Notrette's icon is a tomato. The fact that her code is in Quiet Zero makes you wonder how far along they were on the project when she died. I guess we'll never know. Thank you anyway, Notrette.

The things a mother will do for her child. I think it's really powerful how in this moment, Prospera is willing to kill the love of Suletta's life for Eri's happiness, while at the same time, even from beyond the grave, Notrette was willing to give up on her lifelong ambition for Miorine's.

After QZ is shut down, the error on the main display (left) says:

Warning Security malfunction - Complete system shutdown imminent

Data storm space dissipated - Data storm space is contracting - Data storm destabilized across all domains

On the right, the Quiet Zero Monitoring Console simply says "All functions disabled" when its systems are fully infiltrated and shut down.

I love Prospera's expression here. The sheer vitriol in her eyes. The daughter of the man who stole her family from her, and the same girl who's stealing the last chance at happiness from her daughter is lecturing to her about family. I'd make that face too, to be honest with you.

I love the final look Eri gives Suletta as she blocks the laser's blast. She's proud of her.

Eri...

May All Blessings Find Their Way to You, I'm Wishing It >> Masterpost

#Errors have been corrected! #Thank you for the corrections alonzo #I hope I properly credited you #I should definitely watch the other Gundams...there's probably so much I'm missing...

[pencil-peach]

Oh I see! Damn, That's my mistake, I should've done more research in that regard! My apologies about that

Thank you for letting me know! I'll update that section with that information!

G Witch Onscreen Text: Episode 23

Welcome back to Part 24 of my Episode by Episode analysis of G Witch and its onscreen text! We're on Episode 23: Unrelenting Tenderness.

<< If it's too much tenderness, you can return to The Woven Path. Or you can go to the Masterpost.

It's the Penultimate.

Before the opening sequence, we see this scene where Chuchu has to pilot the Demi Barding without the assistance of Permet Links. It's really difficult, and it makes sense if you think about it. Permet excels at evenly distributing and communicating information, such as, in this case, all of the functions of a mobile suit. Without that link, you basically have to pilot it taking all of the systems that the link previously handled for you into account. (Stabilization/Equilibrium are the most important ones that come to mind)

Of course, Chuchu quickly adapts, because she's just that good at it.

For these final 2 episodes, the OP changes once more, in that the mobile suit montage now depicts the attack on Quiet Zero, featuring Demi Barding, Calibarn, Aerial, the Gundnodes, and the Schwarzette. The final scene zooming in on Suletta's face has also slightly changed to show Permet Scars running along it, as she's now piloting Calibarn and not Aerial. (I've always liked how Demi Barding is shown engaging in combat in the montage considering that that. Doesn't happen.)

After we come back from the intro, we open on the Jeturk brothers' conflict.

Lauda demands to know why Guel never told him about what happened to their father, and he believes it's because Guel thinks he's unreliable. Lauda has always supported him and believed in him through all of their strife these past few months, but it seems to him now that Guel doesn't feel the same. He didn't tell him about their father, he abandoned him at the school, by all intents and purposes, he's shutting him out of his life.

But Guel insists that wasn't his intention. He truly cares about Lauda. He didn't tell him about their father because he wanted to protect him from the harsh reality that he had to face. It's like what Miorine did to Suletta. Leaving them behind and bearing the burdens themselves in the hopes that they can lead a normal life.

But in the end, all Guel was doing was hurting him, leaving him alone with his grief. Lauda needed his brother to be there for him and he simply wasn't.

You'll notice that in this scene, Guel is piloting his Dilanza instead of the Darilbalde. If you remember, during the duel with Shaddiq it exploded, presumably beyond repair. I brought it up before in Episode 17's analysis, but the Darilbalde can be seen as a representation of the brother's relationship throughout the series.

In Episode 4, after the duel, the brothers have a talk in front of the heavily damaged Darilbalde, a sign of their relationship becoming strained due to the influence of their father. (Top)

In Episode 17, the brothers talk in front of the Darilbalde again, newly repaired: A sign of their renewed bond. Guel has let go of his pride, and Lauda's support of his brother is still unwavering. (Middle)

But in Episode 20, when Lauda learns the truth of Guel having killed their father, the Darilbalde explodes, utterly destroyed, showing that the truth has left their relationship (as it once stood) irrevocably fractured. (Bottom)

Delling Rembran making use of the power of frustrating bureaucracy to buy time for the others. Thanks bozo. You ever think about how Delling never spoke to Suletta even once in the entire series.

When Suletta and Eri are arguing, I think a lot about how the examples she uses for why she can't forget about Eri and their mother are specifically about being able to comfort her when she's sad.

If you look back throughout the series, we never really see Prospera be sad or afraid around Suletta. She always maintains a calm, confident, cheery exterior around her. I think after Eri showed her the memory of Prospera crying over her body, and everything that happened at Vanadis, she came to the conclusion that her mother is doing all of this because she's deeply, deeply sad, and she wants to support her.

I think this sequence gives us a good look into Eri as well. The things Suletta describes are all physical. When she hears them, Eri looks down, deeply upset, because these are all things she wants to do too, but she can't, not as she is now. Quiet Zero seems to be the only way for Eri to be able to physically be with her mother again after decades of being trapped in an unfeeling machine. It makes sense why she wants the plan to succeed so badly.

Not to mention Prospera's face when she hears that. Just utter disdain. I wonder what her eyes look like under the mask in this scene.

When Eri prepares to destroy the capsule containing the team infiltrating Quiet Zero (Left), the framing is similar to when Eri first took someone's life in the Prologue (Right). But whereas before, she was a child who simply didn't know any better, this time there is murderous intent.

But before Eri can execute her intention, something interferes, causing the Data Storm and the Gundnodes inside it to destabilize for long enough to give the team time to escape. When this happens, Eri interrogates the suspect, asking to know why they're interfering, explaining that the Data Storm can give them everything they want. We learn later that this interloper, and the person Eri was talking to, is 4lan, who's Artificial Nervous System data was incorporated into Quiet Zero at some point.

I think a lot about these two, and the framing of both of these scenes. How Eri knows it's 4lan doing it, and how she tries to convince him otherwise, saying that the data storm can make both of their dreams into reality. I think about how 4lan died before knowing anything about Eri, but understands her situation when Suletta meets him again.

Maybe this is just wishful thinking, but I like to imagine that Eri and 4lan talked within Quiet Zero, and, both having had their lives cut short, Eri promised him that he could have a new life with her and Prospera in Quiet Zero's data storm once the plan succeeded. I think, if things were different, they could've been good friends.

After this, the Assembly League speaks to the head of the of the League Fleet stationed outside Quiet Zero, asking her to make use of the Laser Power Interplanetary Transmission stationed in Lagrange one to take out Quiet Zero (and, consequently, the Benerit Front). To this, the commander responds that making use of that laser would take out the entirety of where both are stationed, that being Lagrange 4.

They never really explain what a "Lagrange Point" is in the show, but the novelization actually explains it. Here's its definition:

The term refers to the gravitational equilibrium points between two celestial bodies — such as the Earth and the Moon. There are five points from L1 to L5, and because the energy required to maintain a fixed position in these areas is reduced, many fronts are concentrated there. Asticassia School of Technology is located at L4.

In simpler terms, a Lagrange Point is a point in space between/around two large celestial bodies where the gravitational pull of both forces causes smaller objects within them to stay put/(in the case of an orbiting body) follow along its orbital path.

In the case of G Witch, the Lagrange Points in question are the ones created between the Sun and Earth. Here's a diagram of them.

The Fronts are artificial living spaces built in space, constructed into Asteroids. Since it takes less energy to maintain a fixed position around Lagrange Points, Fronts and other large living spaces are commonly built within them.

For convenience sake, I went ahead and organized many of the shows locations into their Lagrange Points. This isn't an exhaustive list, and I might have missed some, in which case please let me know and I'll correct them! It kind of stinks that we don't know which Lagrange Point Folkvangr was stationed at :(

Funny how the story is actually relatively contained in a small area, that being Lagrange 4.

Anyway, I really like how even O.Elan is kind of disquieted about Peil and the League Council's utter depravity here. He may love money and have a loose moral code but these guys are on a whole other level.

It's not necessary to document all this text, but according to the display, the infiltration team is headed for "Core Block C" to shut down QZ.

Cutting back to the Jeturk Brothers, their final clash is much the same as Guel's final clash with Vim. A full frontal assault with sword weapons. Both clashes' climactic moment even end with one stabbing the cockpit of the other.

Before, Guel won out against his father because he was afraid to die, but against his brother, he deactivates his sword and takes the full brunt of Lauda's attack, unafraid to die if it means his brother will stop piloting the Schwarzette.

It seems like history will repeat itself once again, but luckily Felsi was there to save the day! Everybody say Thank you, Felsi.

When Miorine and Bel access the Quiet Zero's main console and attempt to input the shutdown code, they input 4 codes:

Miorine inputs "quod erat demonstrandum" (top left) first, a latin phrase meaning "what was to be shown," or "which was to be demonstrated." It's usually shortened to the acronym Q.E.D, and placed at the end of mathematical proofs or philosophical arguments to indicate that the paper is complete.

After that is rejected, Bel inputs "Quod Erat Demonstrandum," (top right) which is. Exactly what Miorine just typed but capitalized. It is obviously also rejected.

After that, Prospera appears, and when Bel begs her to stop, Prospera explains why she can't:

"Eri is the child blessed by Vanadis' ideals, yet there isn't a place for her in this world. So I'll have to make one. A place where Eri can be happy."

At this, the next code Miorine inputs that gets rejected is "quod erat faciendum," (bottom left) a latin phrase traditionally placed at the end of geometric constructions, meaning "which had to be done."

Frustrated, Miorine demands to know if Prospera cares about Suletta at all, to which she responds:

"I do love her, but now she has friends like you."

Seemingly in response, the terminal rejects the final code we see Miorine input, that being "quod est absurdum" (bottom right), meaning "which is absurd."

Isn't that nuts? These codes only appear onscreen for mere frames and they still put in the effort to make them responses to Prospera's arguments. Or maybe, seeing as how they're meant to be placed at the end of arguments, perhaps they're meant to represent Prospera's final thoughts on the things she's saying. Either way, isn't it amazing that they put in the effort anyway?

When Miorine gets through to the Administrator Environment, the available tabs are:

Metasystem Administration

Startup Control

Permissions Management

Energy Management

Notrette

Internal Environment Control

Crew Management

Physical Defense Management

Outer Wall Defenses

Quarantine Related

Intrusion Defenses

Digital Defense Management

Defensive Quantum Computing Status

Hardware Availability Management

Navigation Control

Enemy Search Management

Course Prediction

Drive System Management

Course Prediction Avoidance

If this post wasn't already thirty miles long perhaps we could spend more time here, but alas! I think it's cute that Notrette's icon is a tomato. The fact that her code is in Quiet Zero makes you wonder how far along they were on the project when she died. I guess we'll never know. Thank you anyway, Notrette.

The things a mother will do for her child. I think it's really powerful how in this moment, Prospera is willing to kill the love of Suletta's life for Eri's happiness, while at the same time, even from beyond the grave, Notrette was willing to give up on her lifelong ambition for Miorine's.

After QZ is shut down, the error on the main display (left) says:

Warning Security malfunction - Complete system shutdown imminent

Data storm space dissipated - Data storm space is contracting - Data storm destabilized across all domains

On the right, the Quiet Zero Monitoring Console simply says "All functions disabled" when its systems are fully infiltrated and shut down.

I love Prospera's expression here. The sheer vitriol in her eyes. The daughter of the man who stole her family from her, and the same girl who's stealing the last chance at happiness from her daughter is lecturing to her about family. I'd make that face too, to be honest with you.

I love the final look Eri gives Suletta as she blocks the laser's blast. She's proud of her.

Eri...

May All Blessings Find Their Way to You, I'm Wishing It >> Masterpost

[pencil-peach]

G Witch Onscreen Text: Episode 23

Welcome back to Part 24 of my Episode by Episode analysis of G Witch and its onscreen text! We're on Episode 23: Unrelenting Tenderness.

<< If it's too much tenderness, you can return to The Woven Path. Or you can go to the Masterpost.

It's the Penultimate.

Before the opening sequence, we see this scene where Chuchu has to pilot the Demi Barding without the assistance of Permet Links. It's really difficult, and it makes sense if you think about it. Permet excels at evenly distributing and communicating information, such as, in this case, all of the functions of a mobile suit. Without that link, you basically have to pilot it taking all of the systems that the link previously handled for you into account. (Stabilization/Equilibrium are the most important ones that come to mind)

Of course, Chuchu quickly adapts, because she's just that good at it.

For these final 2 episodes, the OP changes once more, in that the mobile suit montage now depicts the attack on Quiet Zero, featuring Demi Barding, Calibarn, Aerial, the Gundnodes, and the Schwarzette. The final scene zooming in on Suletta's face has also slightly changed to show Permet Scars running along it, as she's now piloting Calibarn and not Aerial. (I've always liked how Demi Barding is shown engaging in combat in the montage considering that that. Doesn't happen.)

After we come back from the intro, we open on the Jeturk brothers' conflict.

Lauda demands to know why Guel never told him about what happened to their father, and he believes it's because Guel thinks he's unreliable. Lauda has always supported him and believed in him through all of their strife these past few months, but it seems to him now that Guel doesn't feel the same. He didn't tell him about their father, he abandoned him at the school, by all intents and purposes, he's shutting him out of his life.

But Guel insists that wasn't his intention. He truly cares about Lauda. He didn't tell him about their father because he wanted to protect him from the harsh reality that he had to face. It's like what Miorine did to Suletta. Leaving them behind and bearing the burdens themselves in the hopes that they can lead a normal life.

But in the end, all Guel was doing was hurting him, leaving him alone with his grief. Lauda needed his brother to be there for him and he simply wasn't.

You'll notice that in this scene, Guel is piloting his Dilanza instead of the Darilbalde. If you remember, during the duel with Shaddiq it exploded, presumably beyond repair. I brought it up before in Episode 17's analysis, but the Darilbalde can be seen as a representation of the brother's relationship throughout the series.

In Episode 4, after the duel, the brothers have a talk in front of the heavily damaged Darilbalde, a sign of their relationship becoming strained due to the influence of their father. (Top)

In Episode 17, the brothers talk in front of the Darilbalde again, newly repaired: A sign of their renewed bond. Guel has let go of his pride, and Lauda's support of his brother is still unwavering. (Middle)

But in Episode 20, when Lauda learns the truth of Guel having killed their father, the Darilbalde explodes, utterly destroyed, showing that the truth has left their relationship (as it once stood) irrevocably fractured. (Bottom)

Delling Rembran making use of the power of frustrating bureaucracy to buy time for the others. Thanks bozo. You ever think about how Delling never spoke to Suletta even once in the entire series.

When Suletta and Eri are arguing, I think a lot about how the examples she uses for why she can't forget about Eri and their mother are specifically about being able to comfort her when she's sad.

If you look back throughout the series, we never really see Prospera be sad or afraid around Suletta. She always maintains a calm, confident, cheery exterior around her. I think after Eri showed her the memory of Prospera crying over her body, and everything that happened at Vanadis, she came to the conclusion that her mother is doing all of this because she's deeply, deeply sad, and she wants to support her.

I think this sequence gives us a good look into Eri as well. The things Suletta describes are all physical. When she hears them, Eri looks down, deeply upset, because these are all things she wants to do too, but she can't, not as she is now. Quiet Zero seems to be the only way for Eri to be able to physically be with her mother again after decades of being trapped in an unfeeling machine. It makes sense why she wants the plan to succeed so badly.

Not to mention Prospera's face when she hears that. Just utter disdain. I wonder what her eyes look like under the mask in this scene.

When Eri prepares to destroy the capsule containing the team infiltrating Quiet Zero (Left), the framing is similar to when Eri first took someone's life in the Prologue (Right). But whereas before, she was a child who simply didn't know any better, this time there is murderous intent.

But before Eri can execute her intention, something interferes, causing the Data Storm and the Gundnodes inside it to destabilize for long enough to give the team time to escape. When this happens, Eri interrogates the suspect, asking to know why they're interfering, explaining that the Data Storm can give them everything they want. We learn later that this interloper, and the person Eri was talking to, is 4lan, who's Artificial Nervous System data was incorporated into Quiet Zero at some point.

I think a lot about these two, and the framing of both of these scenes. How Eri knows it's 4lan doing it, and how she tries to convince him otherwise, saying that the data storm can make both of their dreams into reality. I think about how 4lan died before knowing anything about Eri, but understands her situation when Suletta meets him again.

Maybe this is just wishful thinking, but I like to imagine that Eri and 4lan talked within Quiet Zero, and, both having had their lives cut short, Eri promised him that he could have a new life with her and Prospera in Quiet Zero's data storm once the plan succeeded. I think, if things were different, they could've been good friends.

After this, the Assembly League speaks to the head of the of the League Fleet stationed outside Quiet Zero, asking her to make use of the Laser Power Interplanetary Transmission stationed in Lagrange one to take out Quiet Zero (and, consequently, the Benerit Front). To this, the commander responds that making use of that laser would take out the entirety of where both are stationed, that being Lagrange 4.

They never really explain what a "Lagrange Point" is in the show, but the novelization actually explains it. Here's its definition:

The term refers to the gravitational equilibrium points between two celestial bodies — such as the Earth and the Moon. There are five points from L1 to L5, and because the energy required to maintain a fixed position in these areas is reduced, many fronts are concentrated there. Asticassia School of Technology is located at L4.

In simpler terms, a Lagrange Point is a point in space between/around two large celestial bodies where the gravitational pull of both forces causes smaller objects within them to stay put/(in the case of an orbiting body) follow along its orbital path.

In the case of G Witch, the Lagrange Points in question are the ones created between the Earth and the Moon. Here's a diagram of them.

(Correction: Thank you to @gomez-alonzo-addams for the correction! I mistakenly thought the Lagrange Points were those of the Sun-Earth System, but they're actually those of the Earth-Moon System, which are a recurring element of many Gundam Series starting from the original.)

The Fronts are artificial living spaces built in space, constructed into Asteroids. Since it takes less energy to maintain a fixed position around Lagrange Points, Fronts and other large living spaces are commonly built within them.

For convenience sake, I went ahead and organized many of the shows locations into their Lagrange Points. This isn't an exhaustive list, and I might have missed some, in which case please let me know and I'll correct them! It kind of stinks that we don't know which Lagrange Point Folkvangr was stationed at :(

(Edit: Added Quiet Zero's Construction Point to Lagrange 2. Thanks again to @gomez-alonzo-addams for the info!)

Funny how the story is actually relatively contained in a small area, that being Lagrange 4.

Anyway, I really like how even O.Elan is kind of disquieted about Peil and the League Council's utter depravity here. He may love money and have a loose moral code but these guys are on a whole other level.

It's not necessary to document all this text, but according to the display, the infiltration team is headed for "Core Block C" to shut down QZ.

Cutting back to the Jeturk Brothers, their final clash is much the same as Guel's final clash with Vim. A full frontal assault with sword weapons. Both clashes' climactic moment even end with one stabbing the cockpit of the other.

Before, Guel won out against his father because he was afraid to die, but against his brother, he deactivates his sword and takes the full brunt of Lauda's attack, unafraid to die if it means his brother will stop piloting the Schwarzette.

It seems like history will repeat itself once again, but luckily Felsi was there to save the day! Everybody say Thank you, Felsi.

When Miorine and Bel access the Quiet Zero's main console and attempt to input the shutdown code, they input 4 codes:

Miorine inputs "quod erat demonstrandum" (top left) first, a latin phrase meaning "what was to be shown," or "which was to be demonstrated." It's usually shortened to the acronym Q.E.D, and placed at the end of mathematical proofs or philosophical arguments to indicate that the paper is complete.

After that is rejected, Bel inputs "Quod Erat Demonstrandum," (top right) which is. Exactly what Miorine just typed but capitalized. It is obviously also rejected.

After that, Prospera appears, and when Bel begs her to stop, Prospera explains why she can't:

"Eri is the child blessed by Vanadis' ideals, yet there isn't a place for her in this world. So I'll have to make one. A place where Eri can be happy."

At this, the next code Miorine inputs that gets rejected is "quod erat faciendum," (bottom left) a latin phrase traditionally placed at the end of geometric constructions, meaning "which had to be done."

Frustrated, Miorine demands to know if Prospera cares about Suletta at all, to which she responds:

"I do love her, but now she has friends like you."

Seemingly in response, the terminal rejects the final code we see Miorine input, that being "quod est absurdum" (bottom right), meaning "which is absurd."

Isn't that nuts? These codes only appear onscreen for mere frames and they still put in the effort to make them responses to Prospera's arguments. Or maybe, seeing as how they're meant to be placed at the end of arguments, perhaps they're meant to represent Prospera's final thoughts on the things she's saying. Either way, isn't it amazing that they put in the effort anyway?

When Miorine gets through to the Administrator Environment, the available tabs are:

Metasystem Administration

Startup Control

Permissions Management

Energy Management

Notrette

Internal Environment Control

Crew Management

Physical Defense Management

Outer Wall Defenses

Quarantine Related

Intrusion Defenses

Digital Defense Management

Defensive Quantum Computing Status

Hardware Availability Management

Navigation Control

Enemy Search Management

Course Prediction

Drive System Management

Course Prediction Avoidance

If this post wasn't already thirty miles long perhaps we could spend more time here, but alas! I think it's cute that Notrette's icon is a tomato. The fact that her code is in Quiet Zero makes you wonder how far along they were on the project when she died. I guess we'll never know. Thank you anyway, Notrette.

The things a mother will do for her child. I think it's really powerful how in this moment, Prospera is willing to kill the love of Suletta's life for Eri's happiness, while at the same time, even from beyond the grave, Notrette was willing to give up on her lifelong ambition for Miorine's.

After QZ is shut down, the error on the main display (left) says:

Warning Security malfunction - Complete system shutdown imminent

Data storm space dissipated - Data storm space is contracting - Data storm destabilized across all domains

On the right, the Quiet Zero Monitoring Console simply says "All functions disabled" when its systems are fully infiltrated and shut down.

I love Prospera's expression here. The sheer vitriol in her eyes. The daughter of the man who stole her family from her, and the same girl who's stealing the last chance at happiness from her daughter is lecturing to her about family. I'd make that face too, to be honest with you.

I love the final look Eri gives Suletta as she blocks the laser's blast. She's proud of her.

Eri...

May All Blessings Find Their Way to You, I'm Wishing It >> Masterpost

#g witch #gundam the witch from mercury

[pencil-peach]

English subtitled clip of the Character Commentary for the “Mobile Suit Gundam: The Witch from Mercury” finale

Part 3 of ?

Featuring Lilique and Chuchu as MCs. Suletta, Miorine, and Guel welcome new guest(s) Elan(s).

(bonus content from the Season2 Vol.4 Blu-ray)

#They are putting guel through the meat grinder 😭 #Thank you so much for doing this #i hope you know it’s truly appreciated #please…slice of life spinoff series for this show….i beg…. #I love how 5lan is such a dramatic bitch that normal Elan has to be the straightman #Why are you moaning. Stop it. #I also like how both 4lan and O.Elan refer to Suletta with her full name #And lilique setting up a conversation between 4lan and Suletta is really sweet! Ever the romantic that one #Uwaaa I eagerly await the next part ! Thank you so much again

[pencil-peach]

G Witch Onscreen Text: Episode 22

Welcome back to Part 23 of my Episode by Episode analysis of G Witch and its onscreen text. We're on Episode 22: The Woven Path.

<< If you forgot, Episode 21 will remind you of What You Can Do Now Or you can go to the Masterpost.

It's the dawn of a New World.

After Quiet Zero decimates the League's second attack, we get this brief display of it's current system report.

TEXT: (Lefthand side) - Link Strength with Aerial currently

(Middle) System Report -Permet Inversion Reactor STATUS:

Permet fluctuation reduced to [???]

Topological heat exchange catalyst replenished

Permet inversion reactor output decreased to 61%

Permet field stabilization in progress

(Righthand side) - Link Strength with Gundnodes currently

Lots of Permet based terms here that we might never fully understand...like what is "Permet inversion..?" Ahhh...I wanna know...

I wonder what the story is of the other staff members operating Quiet Zero are. Were they Shin Sei employees? I personally believe they were surviving members of Vanadis who were off base when the incident occurred like Bel, and who sympathized with Prospera's aims.

It's sweet of Guel to check up on Miorine, but I think even he knows he can't do anything for her now. She needs her wife....

The news report Rouji presents is from PNB, and the headline is:

Massive data storm, large number of GUND-type MS detected around mysterious Quiet Zero - Assembly League fleet devastated, evacuation warnings issued over wide area. - Suspicions that mastermind may be Benerit Group insider or [renegade?] "witch."

It seems that nobody is aware of who's really behind Quiet Zero, and a "witch" being behind it is merely speculative. That would explain why Shaddiq was able to take the blame for the crime in the Epilogue.

The bench where Suletta and 5lan have their talk (Left) is the same bench where El4n was supposed to meet her for their second date (Right).

We also learn in this scene that Suletta's wish list was actually just a bunch of stuff her mom suggested for her to do, and she just decided to go along with it for some reason. Even the things she "wanted" to do weren't wholly things she decided to do for herself.

Another thing that's interesting is that in this scene, wind is blowing. Asticassia is a closed environment, so there's no natural wind. It has to be produced by a strong force. In this scene, the wind begins blowing when Suletta affirms that she wants to stop Prospera and Eri, so I like to imagine that the strength of Suletta's will is what's causing the wind to blow.

I've already made a post discussing Guel and Suletta's final duel at length, but in brief, I think it's clear that at this point, Guel's duel with Suletta isn't about Miorine at all. I think it's about proving to himself whether he was truly a match for Suletta.

Guel and Suletta are rivals, in that they have the most onscreen duels with each other, and Guel's main motivation throughout the series is catching up with her.

But despite that, not a single one of their duels was ever fought evenly. One of them always had an unfair advantage, or there was some kind of outside interference on the outcome. And so, especially after the outcome of their last duel, Guel still isn't truly sure if he's caught up with her strength yet. And so this duel is the only one fought on perfectly even ground. No outside help, no interference. Just a pure one on one fight, to truly prove which of them is stronger.

And if you want to know why they chose fencing of all things, it's a reference to Char Aznable and Ray Amuro's fencing duel from the original Mobile Suit Gundam (Left).

On the whole, I can understand why some people might not like this duel (it's very out of left field) but personally, I like it, and I think it's an important conclusion to their rivalry, which was established in the first episode. I think it's just another victim of the absolute lack of time the series had to properly wrap up all its threads.

Suletta and Miorine's second heart to heart share some parallels/inversions to their first, so I will chronicle them here. (The first one is that their first heart to heart was in Episode 11, and their second is in Episode 22. Hehehoo !)

Firstly, the most obvious inversion is which of the girls is in pain. In Episode 11, it was Suletta, and now, it's Miorine.

Both girls believe, for one reason or another, that they've made a terrible mistake, and have receded into themselves as a result. Suletta believed that she was mistaken about her place in her friends lives, and should never have come to the school. Miorine blames herself for the tragedies at Quinharbor and Quiet Zero, and believes all of the choices she's made up till then were wrong.

In both cases, the other girl shares something personal about herself, and tells her that it's only because they met each other that that they don't have to keep running anymore.

At the end of their first heart to heart, Miorine refused to let Suletta see her cry, but at the end of their second, Miorine reveals herself to her fully messy and vulnerable, a sign of her complete trust in Suletta.

Their first heart to heart began with Suletta opening the door for Miorine, while their second ended with Miorine opening it for Suletta.

In the end, it's not violence that allows Suletta to rescue Miorine. It's love.

And while there (STILL!!!) unfortunately isn't an official release of EITHER track, the BGM that's playing during Episode 22's heart to heart is a soft piano cover of Season 2's opening, "Slash." This is a parallel to Episode 12's scene where Prospera manipulates Suletta, in which a soft piano cover of Season 1's opening, "Shukufuku" plays.

When Miorine and Suletta reunite with the rest of Earth House, the door they're standing in front of is numbered "7007." At the beginning of last episode, Felsi calls Guel about Petra from a similar looking hallway, and if you look closely, you can also see a door behind them with the plate number "7007." It's the same hallway, and I like to imagine the Earth House kids were there to see Petra, who might even be in that room.

Sometimes your father is a horrible terrible no good deadbeat sack of shit and you'll never forgive him.

And sometimes, he's still your dad.

Here's a quick visual reminder of the units at Plant Quetta that Prospera needs for Quiet Zero to operate at maximum capacity (Left). I wonder if these were internal or external units...probably internal.

It seems that Quiet Zero was being developed in (at least) 2 separate locations, and in their haste, Prospera and Godoy weren't able to retrieve the units before launching it proper. Hohn hohn hohn...

It makes you wonder though, what would Quiet Zero look like at full capacity? Probably woulda been scary.

Rolls up my sleeves

(Left, Top to Bottom) Quiet Zero - Current status summary

MOBILITY - After restart, movement velocity of enemy basepoint is predicted to increase - Velocity of each enemy MS also predicted to increase by average of 37% - Evasive Maneuvers of main unit will be complex

DEFENSIVE FUNCTIONS - Strong air defense barrier confirmed around Quiet Zero main unit, making it difficult to approach - Defense barrier strength 67942049 - Very difficult to invade domain while mutual defenses of basepoint and MS are linked

(Right, Top to Bottom)

WIDE-AREA DATA STORM CONTROL FUNCTIONS - Expands data storm domain and stabilizes it over a wide area - Domain is predicted to expand further in future

DATA STORM DOMAIN - 60%

PERMET DISPERSAL SYSTEMS - Permet dispersal index exceeds 200 - Permet density x 27.1 - Density increase is accelerating

REINFORCED LINKAGE BETWEEN QUIET ZERO MAIN UNIT AND GUNDNODES - Increases interconnectedness of overall enemy - Each MS appears to become a sub basepoint - Basepoint and all Gundnodes are linked - Link multiplexing confirmed, jamming impossible

A quick look into an analysis of Quiet Zero's systems. There's not much to say other than this really is an apocalyptic device. Interesting to note though is that even without the necessary units, Quiet Zero's capabilities are naturally increasing, presumably because Eri is slowly getting better at operating it.

In case you were curious, here's the description of the Demi Barding's Baori Pack, which allows it to operate without Permet Links

(Baori Pack) - Can be configured with various optional equipment evolved from the 'Daedalus' multi-tool system, an exclusive expendable stand-alone pack equipped with flight unit functions. - Can also be separated from the main unit...

The 'Daedalus' multi tool system...interessante...

In this scene, Guel expresses his concerns for Suletta's wellbeing to Miorine, only to be met with a confident gaze from her, an expression of her belief in and respect of Suletta's choice (Left). It's similar to the scene from Episode 9, where, in response to Shaddiq's concern, Suletta responds with a confident gaze of her own, affirming her belief in Miorine (Right).

When Miorine confronts Shaddiq, she asks him to believe in her, to which he breaks out into laughter. Maybe he's finally realized where he went wrong. Shaddiq cared a lot about Miorine, but despite it all, he never once trusted her. Not with her own company, not with her choice in Suletta, not with the future, not even with her autonomy.

If he had looked beyond his own ideals, if he had reached out and truly trusted her, saw her as an equal rather than something that needed to be protected, then maybe things would have turned out differently.

I won't bore you with transcribing the text from Suletta's flashback about uncovering the hidden message for Miorine from Notrette, but when Rouji decodes it, HARO uses the "Ytk-7791 Format" sequence to decode it.

Also, I'm a little obsessed with how Suletta is with Secelia and Rouji in this flashback. It occurred at some point within the ~10 days between Ep 20 - 21, and I wish we got an entire episode about it because I would love to know what lead up to this specific pairing...not to mention the dynamic....ARGH WHY DIDNT THIS SHOW GET MORE EPISODES FUCK !!!

Anyway, the interesting thing about the hidden message is that the Code actually follows a consistent pattern, so if you know the conversion rules, you can create your own messages. I'm sure it's already been done, but I went ahead and made a table deducing the conversions

I used the codes we see on the tablet and on the Quiet Zero terminal to intuit the letters we don't see.

The code is split between lowercase and uppercase versions of letters, starting with lowercase a as AAA.

If an acid sequence has a single asterisk (*), that means we don't specifically see that letter in the show, but was confidently intuited using the surrounding letters that we do now.

In the case of the punctuation, there was no real way to intuit the order, so those have two asterisks (**), indicating that I simply made my best guesses for placement.

'CGG' functions as a blank space between words.

So, for example, if you wanted to write, "I love you, Suletta." The code would be:

GTCCGGAGTATGCCCACACGGCGAATGCCACTACGGTCTCCAAGTCATCATAAACGT

In terms of numbers, we see on Rouji's monitor that the Number Table is separate from the Alphabet table, starting at 0 with AAA. (We know this because the screen shows both the Number Table and Prime Number Table, and by comparing the two, we see that AAG has to be 2.)

I think one day I'll try and code a tool that lets you convert messages to the code and vice versa, if you ever feel like letting your betrothed know you love them through. Nucleic Acid Sequences.

You don't need me to tell you how the scene with Suletta in Calibarn is a parallel to Elnora in Lfirth from the Prologue, but you might not have caught just how many of the shots are directly referenced.

But in the Prologue, Cardo Nabo refused to let Elnora make the choice to hurt herself for everyone else's wellbeing by raising the Permet Score, whereas Miorine, despite feeling that same concern, allows Sulleta to make that choice. (The moment when Suletta clears score five and Miorine bursts into tears...she was so worried...she was so afraid.......AGHHH)

Calibarn's entrance into Quiet Zero's data storm is a reference to Full Armor Unicorn's entrance in Mobile Suit Gundam Unicorn.

Sibling fights....

It seems the end is nigh. Is love strong enough to overcome all adversity?? Who knows...

To find out, Click here to go to Episode 23 >> Or maybe the Masterpost could remind you.

#g witch #gundam the witch from mercury

[pencil-peach]

Bisan is calling for another global strike!

I saw some posts just outlining Jan 21st, and wanted to clarify that Bisan has called for a full seven days of action.

What a global strike would look like is:

calling in sick to work

purchasing bare essentials ahead of the week so you can observe the general boycott of goods / buying as little as you genuinely can

putting in a concerted effort to elevate Palestinian voices and make it clear that this strike is in support of a permanent ceasefire!

For those who will have to purchase necessary goods during this time, please observe the brands that the BDS movement is asking us to boycott!

♢♢♢

Right now is also a good time to mention some better uses for your money during this week.

Available e-sims in Gaza are running low!!

Mirna El Helbawi and her team are working round the clock to continue to connect Palestinians as Israel does its best to cut them off from the rest of the world.

You can learn how to purchase and send e-sims here, and below you’ll find a list of what is currently needed (the areas in brackets indicate what region you should select to buy e-sims in).

--

CareforGaza is an organisation that does verifiably good work, distributing supplies directly to Palestinian families.

They have a Gofundme set up at the moment, but because of Gofundme’s poor track record regarding refusing to transfer funds to Palestinians, I’d recommend continuing to donate directly to their PayPal here.

Good luck to all of you. Don't turn away from Palestine!

[pencil-peach]

PolarBearGirl

#peachart #furry

[pencil-peach]

Cool Suit

#suletta mercury #miorine rembran #sulemio #g witch

[pencil-peach]

G Witch Onscreen Text: Episode 21

Welcome to part 22 of my attempt to transcribe and discuss all the onscreen text in G Witch, as well as discuss and analyze the series episode by episode. We've come to Episode 21: What We Can Do Now

<< To relive The End of Hope, click here to return to Episode 20 Or, you can return to the Masterpost

We'll figure it out together.

In the opening, we see Guston make a call, asking for something to be moved to the Benerit Group head office front. We learn later that this "something" is the Gundam Calibarn, which was confiscated by the Space Assembly League during the Vanadis Incident. (We'll discuss Calibarn in a bit, when it's being mentioned later.)

The first establishing shot we get of Asticassia's campus in this episode (Left) is the same as the establishing shot we got of it in Episode 1 (Right), that being a panning shot moving up right along its curve. Seeing the comparison side by side really puts into perspective the sheer magnitude of Norea's rampage.

This brief conversation between Suletta and Secelia before the OP is really sweet. At first glance, it's a bit difficult to parse what exactly about Suletta has changed. It's not a major change of her character that's occurred. She's always been kind, and Season 1 Suletta most certainly would have also done her best to help with the recovery. But the change comes in WHY she's doing it. When Secelia asks, her response is simply, "Because I can move around." Beforehand, she lived her whole life by her mother's motto: "If you run, you gain one. Move forward, gain two."

And she repeats that motto over and over, applying it to as many situations as possible. But when Secelia asks her now, she doesn't say it. She says something else. A motto that she's come up with for herself. Not one given to her.

This screen pops up when Kenanji is presenting the info on Thorn to Rajan. There's no new information here, it's the same information Prospera pulls up before she destroys the Lfrith Models.

The Pilot is listed as UNKNOWN, however, meaning that Prospera and Godoy managed to discover that information while Dominicus and Cathedra could not. (Although, maybe they couldn't find anything about the Pilot because they uh, eviscerated her into nothing. Looks at Kenanji.)

TEXT: All Front News Network DELLING REMBRAN'S DAUGHTER, MIORINE REMBRAN, IS THE NEW PRESIDENT OF THE BENERIT GROUP - MIORINE REMBRAN quickly suppressed two insurrections on Earth and in space.

It seems Miorine is now President of the Benerit Group. Elan was right, putting down the protestors on Earth won over the Spacian votes of the Benerit Group, securing her the election.

Since the election results have been declared, we could, with some confidence, place Episode 21 as being at least 10 days after episode 19-20, as the Earthian Negotiator tells Miorine that they'll "suspend all protests activities for 10 days...until the results of [her] election are clear." (I'll make a timeline of the show at some point lol)

Delling Rembran's rise to power was sparked by an indiscriminate slaughter of Earthians for the sake of his ideals. The Benerit Group was built upon and perpetuates itself through a cycle of sin and violence. Where Miorine went wrong was believing she could set the group in a new direction from within that cycle.

During the conversation with the Earthian Negotiators, she asks if they would trust her if she became the group's president. When asked if that's her intention, she responds, "I understand now that it's what I really need." But in accepting that what she needs is the Benerit Group's power, even if it's for altruistic means, she has no choice but to inherit the horrific violence by which the group attained and maintains that power.

Episode 19 is, in a way, a reflection of the Prologue.

Prior to the event that solidified their rise to power, both Rembrans were in attendance of a meeting determining the direction of the future. Both Rembrans' claims are dismissed by the attendants, but both persist in intervening, firmly believing that their ideals are for the betterment of humanity.

Miorine (About removing Earthians from space): "That's a demand I flatly reject...I don't claim to understand how enraged you Earthians feel...but even so, I seek dialogue." Delling: "So that humanity can remain in peace, we must wield the hammer of witches."

But whereas Delling sought a violent solution to achieve his ambition, Miorine is dedicated to a nonviolent solution. Delling is going down a dark path, whereas Miorine's plan for the future is a brighter one. (Notice the coloring of the two meeting rooms. The MS Dev Council's meeting room is dark blue, where as the Earthian Negotiation room is a light yellow. The colors are an inversion of the other.)

Despite Miorine trying to correct her father's mistakes though, both scenarios end the same way:

With the deaths of innocent people. With Vanadis, Delling began a cycle. A cycle of violence and death. And from that cycle he built the Benerit Group. And even after he himself has been removed, that cycle continues to spin. Miorine tried to inherit the cycle and correct it, believing that what needed to be changed was the direction it spun in, but it's not something you can fix. It is immutable. Delling's actions led directly to Prospera's desire for vengeance, which led to the incident at Quinharbor. It will continue to spin until it is broken.

Shaddiq and Miorine both had the right ideals, and they both tried to reach them in their own ways.

Shaddiq correctly understood that the system itself was unjust, and that it needed to be broken, but he tried to break it by making use of the same violence that instituted it in the first place.

Miorine also understood that the system was unjust, but believed that it simply needed to be set in a new direction, and tried to attain power within the system to change it from the inside.

Shaddiq chose violent methods, Miorine chose nonviolent methods, but both attempts simply led to more violence.

Some other minor things about their conversation is that there are some allusions to their last major conversation in Episode 9. Miorine calls him a fool in both conversations, and says the same thing both times, that being "ばかね" (Bakane) Both scenes also have a shot focusing on Miorine's eyes, looking downward.

During the scene where Suletta and Chuchu are handing out tomatoes, they're handing them out to their respective bullies. Suletta gives some to the girls who picked on her in Episode 1 (With the exception of the blonde girl, who's parents unenrolled her from the school shortly after the Rumble Ring attack)

And Chuchu gives some to the two girls who coated her and Suletta's mobile suits with the masking spray in Episode 4.

Suletta being full of love aside, I like how the Earth House students aren't very hostile when talking about Miorine. They still consider her a friend. Do you think Suletta wasn't eating any of the tomatoes she'd harvested after Miorine left.

When Guston approaches Suletta, he holds up his ID Badge: TEXT: SPACE ASSEMBLY LEAGUE INVESTIGATION DIVISION GUSTON PARCHE ID number: 0329-047-E-033

There's a couple of paragraphs underneath it but unfortunately it's so small as to be illegible.

TEXT (Right) THE SPACE ASSEMBLY LEAGUE HAS DECIDED TO FORCIBLY INTERVENE AGAINST THE BENERIT GROUP. AT THE SAME TIME, IT IS PARTNERING WITH THE PEIL COMPANY. THIS IS BEING SEEN AS AN ATTEMPT TO MINIMIZE THE DISRUPTION CAUSED BY ITS INTERVENTION.

Moving back to Miorine and the Benerit Gang, we see they're watching a livestream of the Space Assembly League, in which the Peil Company has jumped ship and sided with the League, calling for the forced intervention of the Group.

What's most interesting about their testimony is that they mention Quiet Zero by name. (Left) The Peil Witches have a habit of knowing more than they should,

such as in Episode 7 where it's revealed they know about the Schwarzette (Left), and in Episode 12 where they email 5lan detailed information about the Plant Quetta attack mere minutes after it ended, even mentioning the Dawn of Fold by name. (Right)

In Episode 5, Godoy tells Prospera, "Peil Technologies is making its move," to which Prospera responds, "It's sooner than we expected." The Peil Witches are professional moles, to the point that even Prospera was keeping an active eye on them specifically in order to work around their schemes.

It's easy to assume that Peil might have found out about Quiet Zero after the GUND-ARM merger with Shin-Sei, but I think it's just as likely that they've known about it for far longer than that, but didn't view it as any sort of tangible threat so they didn't act on it.

I've actually seen a lot of people be confused as to why Suletta suddenly knows everything about her and Eri's past and Prospera's plan, so just to clarify, it happened during her and Eri's conversation at the end of Episode 18, specifically when Eri blasts her with Permet. (During the sequence a series of images from the Prologue flash before the final memory plays, representing Eri showing her everything.)

That means that Suletta had known about everything during the entire period of time between Episode 19-21, but just didn't tell anybody about it. Which, yknow, makes sense, it's a bit of a difficult thing to just bring up randomly.

Here we get our first official introduction to Calibarn. We learn here that it was confiscated during the Vanadis Incident by the Space Assembly League, who'd seemingly been keeping it hidden away since then.

So, I don't think Guston literally means they confiscated it DURING the actual event at Vanadis, as the League weren't personally involved in the attack. It was Delling and a small platoon of Dominicus (which was operating under the MS Dev Council at the time) acting alone. And, more importantly, Folkvangr was bombed immediately after the massacre ended. If Calibarn was there, it would have been destroyed.

Calibarn's HG Gunpla Kit sheds some light in this regard thanks to its description in the manual:

"The Vanadis Institute developed countless prototype units in addition to Lfrith before the establishment of GUND FORMAT technology. Of these units, the Calibarn took the most strikingly different direction from that of Lfrith. Unlike the Lfrith, which could be operated with minimal impact on the human body within a certain permet score, Calibarn prioritized mobile suit performance to seek the utmost limits of GUND-ARM capabilities and adopted extreme measures that did not guarantee the pilot's life protection at all. After losing to Lfrith in the development competition, it is said that all records of the Calibarn were destroyed, and it was made off limits and sealed away. Although it aimed to become the mainstream of GUND-ARMs, the Calibarn could very well have been considered the most cursed of all Gundams from the public sentiments."

So, after it was decided to pursue the Lfrith model for Gundam development, the Calibarn's development documentation was destroyed and it was sealed off somewhere, presumably some Ochs Earth development site, and shortly after Vanadis, when the company was being forcibly dissolved and investigated, the Space Assembly League uncovered the Calibarn and confiscated it for themselves, without telling the outside world what it had found.

You might ask why Vanadis just sealed it off instead of destroying it, but remember, in Episode 7, Miorine estimates that disposing of the Pharact and the Development Team that made it would incur a loss of 120 billion. Mobile Suits (especially Gundams) are expensive to produce and expensive to destroy. It was probably just financially easier to hide it somewhere and pretend it didn't exist.

It's also probably why the League sat on it too. Without the development documents, they couldn't really reproduce it, and even if they could, the Calibarn is basically a giant human meat grinder. It's essentially inoperable by any normal person, and wasn't truly designed to be operated in the first place.

Anyway, just some interesting Calibarn things.

As Suletta resolves to pilot the Calibarn, she says "Even if I don't gain anything, I have to do what I can."

When she says this, she picks up a bright red tomato (Left). This is a followup to her and Miorine's argument back in Episode 16, in which Suletta is being reflected in an unripe, rotting tomato, symbolizing her lack of a personal identity outside of her Mother's influence. (Right)

Now, she's matured as an individual, and become fully actualized, living for her own sake and the sake of those she cares about.

A look at the League Ship's System UI When Quiet Zero is detected, the alert message reads: ALERT Unregistered PMET codes detected

Quiet Zero's introduction is truly harrowing. An entire FLEET was melted through like paper. There is no world where this thing is anything other than a apocalyptic superweapon. Eat your heart out Delling Rembran.

Anyway, the song that plays during this scene is "Quiet Zero" from the OST.

Another big personal favorite of mine, give it a listen!

Between Chuchu, Miorine, and Petra, Suletta just has a habit of befriending (and marrying) Meangirls. Good for her honestly. But it's really sweet just how protective Chuchu has become over Suletta. I like to imagine they spent a lot of time together in Season 2.

Common 5lan W.

It's easy to get annoyed at Lauda here, (which is because he is being annoying,) but if you think about it you can understand his rationale, as flawed as it is. Before, he blamed Suletta for everything in his life going wrong, but after Guel came back and defeated her, things...didn't go back to normal like he thought they would. Guel hasn't told him about what happened to him on Earth, he didn't tell him what happened to their Father, he hasn't even been telling him about what the hell is going on in his life in general, anymore. So from his perspective he just abandoned him.

After nearly losing Petra too, he can only rationalize it by blaming the common denominator: Miorine. He's wrong, and not seeing the bigger picture, but he CAN'T see the bigger picture because his Brother isn't telling him anything about it. He's confused and angry and lashing out. Normal little brother behavior. But I think if we can forgive Prospera's triple digit body count we can forgive Lauda for being kind of annoying.

And with that, the pieces are finally moving into place. The end is near.

>> Click here to go to Episode 22 Or go to the Masterpost.

#g witch #gundam the witch from mercury

[pencil-peach]

I coooould draw gwitch undertale. I could do that.

#I can make anything i want