I love when the internet just randomly shows me some new funny little guy, and i go "yeah sure, why not, i'll add that to my collection of funny little guys"
140 notes
·
View notes
well then you better go catch it !!!
735 notes
·
View notes
More familial posting. He's like a squeaky toy to me
(also the reference in the first doodle) ↓↓↓
20 notes
·
View notes
THEYRE SO CUTE WTF. Redrawing this screenshot.
3 notes
·
View notes
Autumn in hieron episode 27
7 notes
·
View notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
Crowley: A False Prophet and the Unholy Trinity
HEAR ME OUT, HEAR ME OUT. @overly-niche-twst makes amazing and funny memes, but as you all should know, even the memes aren’t immune from my theories. But the connection of Crowley and the “false prophet” hit me like a train. A false prophet? In a game where the religious symbolism runs rampant? And when digging into research, I was SHOOK at what I learned. I swear this is the worst rabbit hole I’ve ever gone through because of a MEME 😭
In Biblical lore, a prophet is someone who receives a divine message from a supernatural source and must share the message with the rest of humanity. This message is often referred to as a “prophecy.”
I’ve talked about Levan potentially having prophetic powers on here several times, but as a little recap, Lilia seems to hint at Levan’s uncanny foresight. Either he’s just an incredible master strategist, or Levan has powerful magic (perhaps Unique Magic, or just really good at astrology) related to seeing the future. For example, he SOMEHOW knew that Lilia and Malleus would attend NRC 500 years in the future, and taught Lilia and the other Fae a common language with humans in hopes of reuniting the Fae and humans in the future, like at NRC.
What makes me feel certain about this theory is that ravens in Greek mythology were related to Prophecy, because they were believed to be the bird of Apollo, the Greek god of prophecy. And Levan seems to be twisted from Diavolo, Maleficent’s Raven (unconfirmed but seems likely with info so far)
Technically, if the gift of prophecy was Levan’s UNIQUE Magic, it could count as a “supernatural” source, right? And if he taught and guiding the Fae with the information he saw from the future, Levan could technically be considered a prophet.
But what is a false prophet, and why do I believe Crowley is one?
(Disclaimer, I am not religious myself and am using Biblical texts from a purely analytical perspective. If you know better on this topic, want to add something/correct me, please let me know! Sorry for putting so many links here too haha, there’s just too much to talk about in one post!)
A false prophet is someone who falsely claims the gift of prophecy, or is speaking from the supernatural source of evil, typically the Devil. According to Biblical lore, the false prophet will present themselves as benevolent (Crowley “I am so kind” is that you) and weak, but have great power and evil. What I found very interesting was this line from the Bible:
“Beware of false prophets, who come to you in sheep's clothing but inwardly are ravenous wolves.”
I’ve made theories regarding Crowley’s true nature many, many times before. My moots tease me for using this Rook screenshot so many times, but I genuinely believe Rook understands Crowley’s character.
Anyway, the TRUE enemy is one who watches from the periphery with a smile…something that Crowley always does. Always watching, but never seemingly acting. He lets everyone’s guard down by being useless, unreliable, and ridiculous, but he definitely has something up his sleeve. In Biblical lore, the wolf is considered a malevolent predator who feeds on the innocent. Like young and impressionable students, perhaps? I think it’s very interesting that Crowley refers to students as his eggs or chicks, like children that he’s “raising.” But a baby bird is one of the many symbols of innocence, and Yana Toboso herself has cryptically said how the repeated egg theme in TWST is a representation of how “Eggs are a good symbol of things that can never go back to how they were, once they have been broken.”
But what about the False Prophet? Well, I’ve recently made an analysis on how Crowley encourages the Overblots in every single book. As a little recap, he’s the one who suggests the magic duel against Riddle in Book 1, the Hall of Fame to Leona in Book 2, signs a contract with Azul in Book 3, abandons Yuu and also stirs Jamil’s hatred by making Kalim housewarden in Book 4, etc etc. He’s constantly leading these students astray in a very subtle manner. But I think he needs the Overblots to happen so Yuu can save them, so he can get the Overblot Crystals.
Additionally, Lilia mentions how historical narrative have been “twisted” to suit someone’s agenda. And judging from how everyone thinks the Disney Villains were sources of good to look up to, the manipulation from Crowley may be more literal than we think.
And if Crowley is leading these people astray for a greater purpose/higher power, this technically makes him a False Prophet. It goes even deeper when you consider his cryptic words throughout the books, as if he is seeing the future. He knows where the students are when they’re talking about important things, he knows when STYX will break in…and as I mentioned, ravens are connected to the gift of prophecy.
And guess what? The False Prophet, according to Christian lore, is part of the Unholy Trinity. TWST has a slyly repeats the theme of three, and which can noticed in NRC’s logo that may represent the past, present, and future. BUT THATS NOT WHY I WAS FREAKING OUT-
Because what does the Unholy Trinity consist of?
The DRAGON
The ANTICHRIST
And the FALSE PROPHET
In a previous theory examining religious symbolism with Meleanor and the Virgin Mary, I also concluded that Malleus Draconia is a representation of the Antichrist, especially because of the star imagery in TWST. Meleanor even refers to him as an “evil star” that would curse humanity.
But now I’m doubting this- I think I had it all wrong. Not about Meleanor being the Virgin Mary, but about who represents the Antichrist. But let me go over what the implications of the Unholy Trinity means first.
Edit: actually I never claimed Malleus was the antichrist at all in that post LMAO, I confused myself with the different names for Lucifer/Devil/Satan 😭😭😭 so technically I was right all along with claiming that Malleus is Lucifer in that post🤪🤪🤪🤪 I won’t edit out this mistake to avoid confusion in the reblogs
The Antichrist and the False Prophet are referred to as the “first and second beast,” who obey the DRAGON. But the Antichrist, aka the First Beast/Beast of the Sea, is described as “emerging from the abyss”
MALLEUS’ TITLE IS LITERALLY THE RULER OF THE ABYSS. IM GONNA- BABXBSB
Edit: I’d like to add that the Bible describes this Abyss as an unfathomably deep, dark, and boundless place, often compared to the ocean and chaos. And recently in Book 7, Silver almost succumbed to the darkness…where there was no light, no people, nothing except darkness and blot. That is TWST’s version of the Abyss, and Malleus is the ruler of it! This religious symbolism has to be intentional
I think the Antichrist actually GRIM. A supreme representation of evil thats said that appear at the END OF THE WORLD/APOCALYPSE. And if we recall the prologue, we see Grim in a horrible monster form in a shattered Mirror Chamber. An amalgamation from the Overblot Crystals, which is literally the condensed version of the Overblot, a representation of purely negative emotions.
And based on what text describes the First Beast as, he has “seven heads, appearance of a leopard, feet of a bear, and a mouth of a lion. The dragon gave him his power, his throne, and great authority.”
What’s even more interesting is that there’s an “Angel of the Abyss” known as Abaddon. His description intrigued me, as “king of a plague of locusts resembling horses with crowned human faces, women's hair, lions' teeth, wings, iron breast-plates, and a tail with a scorpion's stinger” Since this character is up to interpretation, some religious scholars say this character is the Antichrist. Again, it’s a wild amalgamation of features that sound like Grim.
The Second Beast/Beast of the Earth, aka the False Prophet, is said to rise from the earth (a metaphor for Hell perhaps) and force the world to worship the antichrist. That’s one of the definitions of the false prophet, as one who seeks to lure humanity astray alongside the Devil. Is this some crazy foreshadowing for what Crowley will do in the future?!
And once again using Biblical texts, this second beast “spoke like a dragon,” referring to his arrogance and connection to the Devil. It reminds me of Levan’s title as Ryūgan Duke Levan,” or 竜眼公レヴァーン , aka “Dragon-Eyed”
Anyway. Back to the Dragon, it’s also referred to as the Serpent. Serpents in biblical lore are incredibly important- but are also very symbolic in TWST. I’ve made an post analyzing the serpents in NRC’s logo before, but as a recap, they’re also one of the symbols of rebirth in TWST. I’d like to add that snakes also considered symbols of Wisdom, which is fitting for “Sages Island.” Some religious scholars also consider the lying serpent in the Garden of Eden to be the “first false prophet.”
But the Ancient Serpent specifically represents the “Devil/Satan/the Dragon.”
The reason why I’m doubting Meleanor being the “Dragon” in this Unholy Trinity is because the Dragon attacks the WOMAN OF THE APOCALYPSE, AKA THE VIRGIN MARY 🏃♂️🏃♂️🏃♂️ IS MY MELEANOR THEORY COMING TRUE?!? ( I’m just being delulu but please humor me)
But what’s even more interesting is that again in Revelations, it’s said an Angel with a “key to the Abyss and a chain” locks up the Ancient Serpent for 1000 years. Hm?? Malleus literally said that everyone would sleep for 1000 years in his Overblot. What’s interesting about the Angel is that he has the key to the ABYSS…is this Angel meant to be Silver?!? Silver, who has a glowing ring protecting him from the darkness, and heavily connected to a magical sword??? So he the Angel with the “key” to the Abyss, aka Malleus?
So if Crowley is the false prophet…there’s a high chance he’s behind the Overblots. And remember: the False Prophet will force the world to worship the Antichrist. Is this to foreshadow how Crowley will make the Twisted Wonderland world fall because of Grim?
So let me recap what I think this means:
The Dragon- Malleus
The Antichrist- Grim
The False Prophet- Crowley
The Angel- Silver
The Virgin Mary- Meleanor
And you know what, let’s just throwing in the idea that Yuu is the Lamb that opens the Seven Seals, which marks the beginning of the apocalypse, and the Seven Angels/Trumpets are the Overblotters, WHY NOT. A theory to elaborate on for another day…perhaps it will be a series connecting the biblical apocalypse to TWST?
🏃♂️🏃♂️🏃♂️ANYWAY IF THE UNHOLY TRINITY THING IS INTENTIONAL IM GONNA SPONTANEOUSLY COMBUST
To Joy, I got really carried away with this theory, apologies if it sounds confusing, I did NOT mean it to go this far 😭😭😭 but I swear, that was a muse moment, your meme made ALL my brain cells connect for once and I feel like I’ve unearthed something important 🫡
Of course, let me just say that these parallels are not perfect (e.g Malleus being the Dragon despite Meleanor being the Virgin Mary) and some of these characters may better fit other Biblical figures better 🫡 But since I’m focusing on the Apocalypse part, I think that is idea is working, and I’d really like to delve deeper into research!
202 notes
·
View notes
The Cauldron and its far reaching threads; who is susceptible to the puppet master, and how might it work?
Disclaimer: this is a massive crack theory that I have held off posting since June 2022, but fuck it I guess, let's go! This is not a shipping post.
As usual, I am absolutely NOT suggesting that anyone who is influenced by the Cauldron is inherently evil in any way. This is just a crack theory. If you can't interact respectfully, then please keep scrolling.
Spoilers: ACOTAR series to date, and massive character spoilers for River Song and the Ponds from Doctor Who (if you care about that) in part 2.
Part 1 - Cauldron Made Beings
This first section will be stating some of the obvious, as we know, per Amren in ACOSF, that Cauldron-Made beings are able to be influenced by the Cauldron, though the “how” is not yet clear. @wingedblooms has theorised extensively about the living bond that Elain Archeron may share with the Mother's crockpot, and I suspect that this bond may also tie (terrible pun, sorry) into how the Cauldron can exert control: by pulling the “bond” threads that connect it to its former inhabitants.
Cassian’s breath caught in his throat. “It was a fluke, Amren. Nesta didn’t make it on purpose.” Amren shook her head, hair swaying. “Nothing is a fluke. The Cauldron’s power flows through Nesta, and could use her as a puppet without her knowledge. It wanted those weapons Made, and thus they were Made. It wanted Rhysand to have them and thus the blacksmith brought them to you. - ACOSF, chapter 42
Finding the link would be basically impossible at this point, but I've previously mentioned that I wonder if the Cauldron's dark maker could be Koschei, or another death god/Daglan. To briefly rehash my thoughts: if there is a dark maker, it stands to reason there be a light maker, too… is it the Mother? Could Koschei be the dark mother that the Naga referred to in ACOTAR, as the terms “mother” and “maker” could demonstrate in-universe evolution of the same word? I've also previously theorised that Koschei may have been controlling the Cauldron through the King of Hybern/vice versa, and that is how the Elucien bond came to be, but this is not a shipping post, sorry!
As a quick aside, the above passage also makes me wonder if the Cauldron, or one of its hypothetical makers, wanted the Archeron sisters Made - it's something I've meant to post about, but I think Koschei has had a hand in things since Papa Archeron’s ship was lost at sea, at the very least. They are each a weapon in their own right, as Amren went on to state their powers match Rhys’ own. I know @nikethestatue has had similar thoughts. But I digress.
Look at the use of “bird in a cage” in the following passage, used to describe Nesta, which parallels nicely with Thesan’s use of decorative birds in cages as spies to listen in (thank you so much to @ladynightcourt3 for the first quote).
The amusement only grew, and Helion pushed a finger against his lips in mock warning. “Careful, High Lady. Even the birds report to Thesan here.” I frowned at the birds in cages throughout the room, still silent in Azriel’s shadowy presence. I threw shields around them, Rhys said down the bond. - ACOWAR, chapter 47
“Like calls to like,” Amren countered. “You were Made by the Cauldron. You may track other objects Made by it as well, as Briallyn can. And because you are Made by it, you are immune to the influence and power of the Trove. You might use them, yes, but they cannot be used upon you.” A glance to Elain. “Either of you.” Nesta swallowed. “I can’t.” But to let Elain involve herself, jeopardize her safety— Amren said, “You tracked the Cauldron—” “It nearly killed me. It trapped me like a bird in a cage.” Elain said, “Then I will find it. I might require some time to … reacquaint myself with my powers, but I could start today.” “Absolutely not,” Nesta spat, fingers curling at her sides. “Absolutely not.” - ACOSF, chapter 21
I think Nesta briefly (I hope, though who knows) became a puppet/shell for the Cauldron's puppet master - perhaps a death god such as Koschei, if @fawnandshadows is correct that he bastardised the Cauldron in some way, millennia ago (I think she's onto something) - and that's who we were seeing when she locked herself into her mind while scrying in ACOSF.
“Get her out, Rhys,” Cassian demanded. “Get her out now.” “I can’t,” he said softly, his power a cloak of stars and night around him. “I— The doors to her mind were open the other night. They’re shut now.” “She doesn’t want it seeing her. Or us,” Feyre said, her face tight. “She’s locked it out, but also locked herself in.” Cassian’s stomach twisted. “Nesta,” he said into her ear. “Nesta, open your hand and come back.” Her breathing sharpened. The cold deepened. “Nesta,” he snarled— And the cold halted. It didn’t vanish, but rather … stopped. Nesta’s eyes flicked open. Silver fire burned within. Nothing Fae looked out through them. Rhys shoved Feyre behind him. She shoved her way back to his side. But Nesta’s hand continued to squeeze Cassian’s. He squeezed back, let his Siphons send a bite of power into her skin. She turned her head so slowly it was like watching a puppet move. Her eyes met his. Death watched him. - ACOSF, chapter 31
I think a similar situation - though more high stakes/urgent - could come to play in Elain's book.
Elain is a Seer with mystical powers that are potentially tied to the Void.
She may try to See through mist and shadow, and accidentally make herself known to Koschei or another death god/Daglan?
In ACOSF, Nesta warned her to “stay away from the Cauldron,” and even Azriel suggested there was a darkness to the Dread Trove that “Elain should not be exposed to.” This, of course, makes many of us think that Elain will go after the Cauldron in her own book.
Could Elain mistakenly Look too far and open herself up to the Cauldron's living bond? That being said, it could simultaneously be using at least Jurian and Amren as well, and we have no idea if Made Fae who haven't been inside the Cauldron, such as Feyre and Miryam, are equally susceptible.
Part 2 - Not Made, yet possibly susceptible
I have been wondering for a while if the Cauldron can somehow form bonds, or weave threads, between itself and anyone exposed to it - or a part of it, when it was separated and hidden in different locations - for extended periods of time, or perhaps crucial ages, like somebody's formative years?
His mouth tightened, and he swallowed once before he said, “Hybern was looking for the Cauldron back then—for the pieces of its feet. One was hidden at the temple in Sangravah, its power used to fuel its priestesses’ gifts for millennia. - ACOSF, chapter 14
What if Gwyn - or anyone else - who grew up in Sangravah, a temple that housed one leg of the Cauldron, internalised some of the magic (sort of along the lines of River Song having regenerative abilities because Amy Pond fell/was pregnant while travelling on the TARDIS, and everything that happened after she was born - being taken away)?
All the High Priestesses wore the billowing, artfully twisted and layered robes—though they certainly were far from matronly. Ianthe’s slim waist was on display with a fine belt of sky-blue, limpid stones, each perfectly oval and held in shining silver. And atop her hood sat a matching circlet—a delicate band of silver, with a large stone at its center. A panel of cloth had been folded up beneath the circlet, a built-in swath meant to be pulled over the brow and eyes when she needed to pray, beseech the Cauldron and Mother, or just think. Ianthe had shown me once what the panel looked like when down: only her nose and full, sensuous mouth visible. The Voice of the Cauldron. I’d found the image unsettling—that merely covering the upper part of her face had somehow turned the bright, cunning female into an effigy, into something Other. - ACOMAF, chapter 2
@wingedblooms has suggested that priestesses could be influenced in general because they worship the triple goddess/divine trio, which follows along with what Feyre hinted at when thinking about Ianthe, all the way back in ACOMAF; that they opened themselves up to the divine during their services (in a similar way to how I imagine Elain's Sight may function). That being said, it's hard to say whether the priestesses at Cesere, Sangravah and Itica are more susceptible than their colleagues from other temples due to their prolonged proximity to the Cauldron’s feet, but I suspect it might be the case.
Could they have a deeper connection, or a bond of sorts?
One that remains even when they aren't communing with the Mother or the Cauldron?
One that may be accessed by the Cauldron or its Maker, for such nefarious purposes as letting in enemies to a library sanctuary?
Gwyn is likely already a lightsinger - please see @silverlinedeyes and @merymoonbeam for some brilliant posts that cover the basics of the theory and then some here, here, here, here and here - but if not, or maybe in addition to that, what if she was "Made-adjacent," and so also able to be used as a "puppet" by the Cauldron/the being controlling it, and thus any threads it may share with others? If accurate, this would work for anyone who was born, grew up, and/or lived for a long time in Sangravah, Cesere or Itica. To clarify, I don't think that these priestesses could call to or search for the the Cauldron, as they are likely not true “kin” - as, say, the Archeron sisters are to other Made items - but I could always be wrong about that. Or is this what lightsingers truly are?
Alternatively, what if every Singer (shadowsinger*, lightsinger, or any other type) was capable of the silent song, or had Made/Starborn powers in a way, and/or could be used as a "puppet" by the Cauldron or its master/maker? It would explain how Azriel's shadows could be used by someone else, maybe Koschei, thanks to the hypothetical living bond between the Cauldron and Made beings? So Nesta, Azriel (whose shadows are potentially Made, if not himself), Elain, Feyre, Amren, Miryam, Jurian, Gwyn and a whole lot of priestesses besides...
Too crazy? Probably, but that's why theorising is fun!
TOG SPOILERS BELOW
* Another theory I know I share with others, but at least @ladynightcourt3 and @psychologynerd, is that Azriel's shadows could be Valg. What if Valg have a living bond back to their respectful Valg King? If @fawnandshadows is correct that Koschei/death gods twisted the Cauldron, could this be how? Valg magic?
80 notes
·
View notes
Thank you so much for acknowledging that Martlet deserves to be the Ink character of the UTY verse. Could you share your ideas you had for her? I'd love to hear them!
HEHE OF COURSE!! i am not immune to silly characters with scarfs shrugs
pluto and i were bouncing ideas back in forth for a while so i’ll summarize our overall thoughts and some extra stuff ive thought of (probably while writing this)
so the initial idea came up based on my post about martlet Remembering Resets like sans does and the idea of oh what if she got to explore the multiverse too (maybe the determination injection made her see that oh goodness there is a Lot Of AUs just. there.) then pluto mentioned possible ink and error martlet and i got Ideas… but my first attempt to draw ink martlet ended with fully realized spiral avatar martlet oops! but i finished the design yesterday lol
as for character! ink martlet has taken it upon herself to be the guard of the multiverse, flying through the space between the aus and making sure everything is going well. she’s pretty similar to base uty martlet, save for probably some backstory stuff (that i haven’t thought of yet. el oh el)
there’s no actual plot line… yet >:) we threw around some ideas (vigilante-sheriff starlo and multiverse exploring feisty five and a ceroba searching for a universe where her family doesn’t end up. gestures to uty) but there’s no designs (maybe once i learn how to draw star…)
btw for character design she’s based on eastern bluebirds (though i initially just looked up “blue and brown bird”) with ink’s general style! now that i think about it since i was just kinda doing colors for the actual paint she’d probably have ink the same color as the human souls. maybe throw in a determination serum one just for fun hehe. also adding from my Brain blast during math today she’d wear her hair half up to look like a paintbrush (doodle of it down below)
20 notes
·
View notes
☾ Yuuri Atsuisamui ☾
⋆。゚☁︎。⋆。 ゚☾ ゚。⋆
⋆。゚☁︎。⋆。 ゚☾ ゚。⋆
Personality + Facts:
As mentioned afore, she’s very spacey, then sometimes energetic, generally when she consumes large amounts of caffeine. She’s become immune to small amounts. She loves swinging her feet while sitting and can be a bit childlike at times (which is funny to watch because she has quite the mature appearance.) for example, she is easily surprised, but it’s not super apparent, because her eyes almost always look sleepy. She’s very calm, and is reminiscent of ice that’s so cold it’s hot and vice versa. (Her surname ‘Atsuisamui’ literally means ‘hot cold’.) She’s kindhearted, but also very chilled out. She loves birds, especially nocturnal ones, and is somewhat based off of nightingales. She is strangely cool with the idea of robbing an elderly person. She is in love with the rain and you can always find her smiling away when there are dark clouds. Most of the time she’s very cheerful. She often acts clueless, but she’s extremely knowledgeable. She is a huge fan of literature, especially Shakespeare. She absolutely loves jazz, as well as some standards.
Side note:
If someone does order her around, she can get quite ticked off. It’s kind of weird to see since she’s so calm normally.
Full body:
⋆。゚☁︎。⋆。 ゚☾ ゚。⋆
Relationship Chart here
⋆。゚☁︎。⋆。 ゚☾ ゚。⋆
I can’t afford to get… too close to anyone— No, I don’t deserve to.
⋆。゚☁︎。⋆。 ゚☾ ゚。⋆
Notes + Some expressions below cut
(I am definitely going to update this but this is how it'll be for now— I have to develop her character a lot more, and I’ll probably edit the art and change the layout, so…)
21 notes
·
View notes
idk if ive posted enough about pikmin to have provided enough knowledge to absorb secondhand, but i'm curious what you know about pikmin!
OH PIKMIN I am confident in my ability to say at least FOUR correct things about Pikmin >:)
Okay here goes:
Pikmin are little plant guys that run around and perform Tasks for you (carrying items and fighting enemies) when you instruct them. They can die tragically. You can get more Pikmin by growing them (???) from an onion (???) of different colors. You can also get wild ones, maybe.
They come in different colors! All the colors have different attributes. There is: Red = fire (immune to fire) Blue = water (can't drown) Yellow = electric (electrocute enemies?? or maybe they're just resistant to electricity) Purple = strong? (big. I think they're stronger than other Pikmin and don't die as much) White = ??? (???? they're small and have red eyes, I don't know what they do) Light blue = Ice (??? immune to cold? They're new) Black = Rock (No idea) and Green = glow (can go out at night)
The main character is Olimar, a fearless space traveler who goes around collecting Valuable Treasures from across the universe, such as bottle caps, tin cans, and horrible baby doll heads. He has two beloved children and is a good father, and a good man <3
His first mate is Louie who sucks. He is treacherous and eats the Pikmin (???? or maybe that's just a meme)
There's also a talking spaceship that has a name but I can't remember it
Pikmin have natural enemies including Snagrets (bird thing), bombs (are the bombs alive? Who knows), Those Bulb Ladybug Things (they're not called Bulbasaur it's like... Bulbear? Bugbear? I dunno, you know what I mean though) Waterwraith (weird ghost thing with a roller), UHHH that spider, that spider again but this time it's Disco (??? I think it's called Man-At-Legs), Mama Bulb Thing, and... fire.
In Pikmin 4 there are 2 dogs also; Moss and Oatchi. Oatchi is best boy :) Moss is best girl also but she's evil I think
There's also a bunch more scientists in 4 but I know none of their names
I think that's about it! I hope at least 4 of that was correct :D
8 notes
·
View notes
why do you hate hazbin hotel
I do want to quickly state that I am FINE with people watching it, unless they like one VERY specific character. It’s one of the few things that I honestly think its better to pirate.
A lot of my moots and friends like it, and that’s fine I’m fine.
Another thing this isn’t a full thread, nor am I going to find too much evidence but I’ll link what I can! Also I don’t know how much of this has been addressed/ debunked. I will try to keep it factual and what I know up to be correct. No one is immune to false information.
I don’t care for the content it’s self but a lot of the characters are hurtful stereotypes (ex:angel being a hurtful gay stereotype, the flapper character being a Jewish stereotype)
https://x.com/_kkickz/status/1751476340937638010?s=46
Even if Viz says that a character isn’t Jewish it is very clear what she’s SUPPOSED TO BE!
She had/has a story bored artist who had a rape fetish working on the dancing scenes of the song poison, which is about Valentino’s abuse to angel and how he wants to get out. It is ok if this is how you cope however that should be kept to yourself. It is very VERY triggering for a lot of survivors, and teaches others that it is acceptable. I’m not comfortable looking at the evidence to this however there are plenty of screenshots. I cannot believe in good faith that she is taking this seriously if someone who is that open about liking it is at all working on such a thing.
Her Nazi oc (this thread also goes into other things)
Another part is its fandom.
Both of these characters are canonically rapists
Staols (the bird) only allows Blitzo to have the book if they have sex every month (which isn’t how consent works) and Valentino (the moth) has scenes where he is abusive (sexual, physical, and verbal) to angel dust. Both of these characters are beloved by the fandom.
Especially Valentino, who is treated as a hot, sexy, and quirky character. He a the bad guy, yet both Viz and the fandom love him. It’s fowl. I hate it.
This was made extremely quickly but if there’s anything you’d like to add/I got wrong do feel free to reblog or comment. There is a LOT of misinformation going around about the show and its creators.
3 notes
·
View notes
None of you are immune to Randomized Quirkswap Propaganda!
The basic gist is exactly what it says on the tin- I randomize Quirks and change the story around it! I had fun doing this with Danganronpa Talents, so I thought it’d be fun to do BNHA quirks!
Ojiro is the main character now, and he gets his quirk from Mirko, the Eighth Holder of One For All! I am making full use of the fact Ojiro is canonically the oldest 1A student. I am forcefully injecting angst and saying he’s the oldest boy in his family, which means I need OCs (unfortunately)
Hagakure MIGHT be the rival character (but much nicer), which is why I drew her. Fun fact, Hagakure’s never shown her right eye.
Todoroki got Uraraka’s quirk, but to keep his story intact I’m saying that his right side increases gravity while his left decreases it.
Tsuyu loves frogs and bugs but is scared of birds. Koda is still afraid of bugs but because he can’t talk to them anymore (he got Black Hole off 13) it’s less of a thing.
I based Kirishima off his disguise from Season 3 (And his disguise off his regular appearance)
I am stalling hardcore drawing my MCSM comic which is leading me to odd places but I am having fun
102 notes
·
View notes
Bird's Rants: About being Authentic
Lately, I've been anxious about sharing my experiences as a nonbinary disabled queer person. Partly because I don't fit people's preconceived notions of what that looks like.
i keep being told to be authentic, to own my identity, but I already "own" my identity (I don't particularly like the language of that as I do not own but I am my identity, but I get told it far too often). However, this imperative to "be authentic" fails to take in the risks and the fact that spaces for people like me to be authentic rarely exist.
A lot of what I write is either queer women stories or nonbinary queer people stories, where there is romance or at least close intimate friendships within the larger plot lines. Writing these can be scary sometimes, especially if I include trans people as characters, because of the biases (sometimes unconscious, sometimes not) that people have against these types of characters.
In our society, there's this idea that the character is only this one identity and thus the story is unrelatable (oh how many times I hear that, ugh), but that is a falsehood that deems the writings of people like me as less than a non-trans and non-queer person (who may even write LGBTQIA characters).
I have to navigate this landmine of a labyrinth daily to determine where I can be authentic, where can I post my works, where can I interact with readers, and if I dare to share aspects of my complex identity because I'm not just a disabled, nonbinary AFAB, queer individual, but so much more than that too.
Even within our LGBTQIA communities, we still struggle with being truly accepting and supportive complex identities, especially identities that intersect with race and ethnicity.
It is possible to create an accessible space for people to truly be their authentic selves, but part of doing that requires us to acknowledge where we actually are currently. It requires us to be willing to be open to being wrong sometimes, to holding ourselves accountable if we cause harm, to be willing to listen, to be willing to learn, to be willing to grow and do better.
It's never easy, but it is doable. It's also a lifelong journey, but it's one we can, indeed, walk together. Part of that is sharing and reading and experiencing with one another our creative works to help us understand, learn, and be better.
I think about this a lot, honestly.
So on Trans Day of Remembrance this 20th of November, I curled up in my bed and spent the day crying to get these complex emotions out of my system.
Living in this current era where there's so much transphobic laws appearing in the USA states (where I live) but also in many other countries? How the deaths of trans people continue to go up? How death threats leveled against us continue to go up? How harm to us continues to increase? How accessing care is getting more and more difficult to the point of being nearly impossible in some locations?
It's utterly terrifying to be trans.
And for me, a person who straddles multiple gender categories? Where if I am wearing my mask, I get carded as a woman, but if I take off the mask, then I get angry diatribes about 'what are you' or vicious barbs and assumptions about my gender. Where people waffle between ma'am and sir. Due to the pandemic, I don't take off my mask in public due to my poor immune system and need to keep myself safe.
But this puts me in danger in other ways because if I'm perceived as a disabled queer woman, I find I can't truly predict if an encounter will be somewhat safe or if it will cause me harm.
Even saying something as simple as "no" or "I can't" or "please don't" could end up with me being harmed, because of our antagonistic our society is toward people perceived as women, gender-noncomforming, and those whose race or (dis)ability complicates those perceptions. (It is very alarming how our society masculinizes against their will Black women, which is related to how society taught us to perceive race).
So it's a damned if I do and damned if I don't. My friends of varying races struggle with this complexity as well -- whether it is safer in a given space to be authentic or not.
Non-binary people are regularly erased from society. When I first came out nonbinary ten years ago, I couldn't get jobs if I dared to put my pronouns on my resume, but the moment I took it off, I'd get offers (this was before I became so ill that I could not hold down a full time job) -- sometimes even from the same companies that rejected me prior. (That was an utterly bizarre experience to have, and many nonbinary people have discovered similar things.)
I got treated less poorly if I didn't share who I was. If I stayed invisible, and yet it hurt and left me in despair, where I felt like I could never be my full authentic self.
People say, "Be authentic!"
Yet they don't think about how doing so could literally get people like me killed. Where we could lose our livelihoods. That space to be authentic rarely exists in our society, and sometimes it doesn't even exist within our queer spaces or within our justice spaces.
Give us space to be authentic. Work with us to build that authentic space in an accessible way.
Fight against the laws and societal norms that hurt us, kill us, strip us of healthcare access and access to what we need to thrive.
Ways to work with us to build that authentic space requires talking with us and listening to our needs. It means being accessible too, because accessibility is crucial to building any space, so that the majority of people will be able to engage and participate.
There's a lot of intersection of identities here in this fight, and no, it's not easy, but then fighting for justice? For our right to exist as our authentic selves without fear of death or harm? That will always be hard.
Robert Jones Jr., once wrote: "We can disagree and still love each other unless your disagreement is rooted in my oppression and denial of my humanity and right to exist."
Love cannot be realized or built into our society if we deny one another's humanity and right to exist. One cannot be authentic if the space to allow for that is not built.
So let us build it together. So that all people can feel safer about being their authentic selves.
That's my message for people who consider themselves allies of us.
P.S. Normalize pronouns. We all have them. We cannot communicate without them as they are an essential component to how grammar works and how we construct sentences. Normalize sharing them regardless of whether you are trans or not.
It's so weird when cisgender people yell things like, "I don't have pronouns!"
I always want to point out, "But you used "I" and that's a pronoun, and in order for me to talk to you, I had to use the pronoun of "you." When you spoke of your friend, you use "he" or "she" which are both pronouns. For that person over there that you don't know, you used singular "they" which is also a pronoun. Without these, we (another pronoun) would have a harder time communicating."
It's such a weird hill to die on.
P.P.S. Boost trainings, knowledge, stories, art, and other creative works by trans folks, please, especially trans folks of color and/or disabled trans folks (since even in trans-friendly spaces the intersection of disability and/or race can still create that dynamic of dismissal of their lived experiences, stories, art, knowledge, etc regardless of whether its a conscious or unconscious dismissal).
If you find yourself dismissing a trans person's knowledge, art, stories, and trainings, but then you suddenly believe the same information if it comes from the mouth of a cis (non-trans person)? That is evidence that you view us as less-than. Interrogate that please.
P.P.P.S Feel free to add in (respectfully) other ways to build up a space where we can exist in safer ways as our authentic selves. I'm sure I'll think of more eventually too, but I'm very tired tonight and utterly terrified to even write the above.
But hell, I only live once, and am trying not to let fear dictate my actions.
I just hope folks will still enjoy my fictional writings despite knowing I'm a disabled, nonbinary, queer person. (See prior point about how biases -- often unconscious -- can cause people to dismiss experiences, art, writing, knowledge from folks like me because of that unconscious view of us as less than.)
When I ask people why they don't try to read a trans writer, it often boils down to an assumption that all we write about is trans stuff as if we are one-dimensional with no ability to have complex plots. Or they assume it will be boring or unrelateable, but until they try to read it, such assumptions aren't reliable. And no, we do not write only about trans issues - our plots and characters are as complex as any other writer. It's very depressing honestly. It's why I always ask people to be willing to try new things.
Be brave. Take the risk. Listen and read the words of people like me.
Open your horizons and be vulnerable.
Be willing to acknowledge that no one knows everything, we are all ignorant in something, and that's okay. We learn, we seek to understand, we grow, we do better.
So be open to growth and doing better.
Thanks for reading. Have a great day.
5 notes
·
View notes
Episode seven timeeee
I’m still mad MK got booted so early
Okay yeah I like the new Chris. The voice fits. Is it the iconic original? No, but it’s really good.
The intro still sucks tho
Zee spitting his soda all over chase >>>
Priya is such a character I love her
Wayne and Raj are so sweet I love them I would die for them
This moment would be a lot more enjoyable if it quit BUFFERING SO MUCH
“The shark??? Did he make out with the shark too?? No, he just doesn’t want to tell me about the kiss… DOES HE THINK I WONT SUPPORT HIM??? I GOTTA SHOW HIM HOW SUPPORTIVE I AM WITHOUT BEING WEIRD ABOUT IT!!” wayne my beloved
the merger in ep7???? that’s just wild, that makes the accomplishment of making it to the merge… less of an accomplishment.
“So only ONE of you can win immunity.” “That’s fine. There’s only one of me 💅”
I think I’m going to like Julia as the new Heather.
“Like you, Ripper, this challenge is very simple.” “AWESOME” he’s so dumb but not in the endearing way Wayne and raj are idiots.
okay maybe ripper does have some comedic potential
WHAT WAS THAT CLOSEUP ON THE BIRDS LEGS 💀
when I was a kid I told my mom I wanted a pet bird and she told me about a guy in Florida who had a pet cassowary that attacked him and killed him and it was really gross and gory. Idk if it’s true but that did not stifle my desire for weird pets
i feel bad for zee that he has the hiccups this ep :( he doesn’t deserve that
“Just because no one’s ever called me smart doesn’t mean I am.”
Julia i love you Julia i love you Julia i love you Julia i love you Julia i love you Julia i love you Julia i love you Julia i love you Julia I lo
I love bowie guys
“Hey not so bright guy that no one wants” perfect description of chase
WHAT WAS THAT GROWL THIJG CHASE DID WTF
Wayne is so sweet you guys 🥺🥺
“You’re my only equal” “jk he’s like three levels below me”
RAJ BLUSHING IS SO CUTE OMGGGG
Emma just walking away to give Bowie and Raj alone time was so real of her
“sorry if I made you uncomfortable or anything-“ “stop, i really liked kissing your face” why did he phrase it like that and why was it so funny
THEIR SECOND KISS GDHSJAJAJA THEYRE SO CUTE
Julia’s scheming is so funny because Chase is so dumb that he actually thinks calling out Emma’s supposed backne is going to get her back
I LOVE HOW EXCITED EMMA IS FOR BOWIE AND RAJ
i feel like Emma and Wayne could bond over it too. Besties perhaps
I love her white girl dancing I gotta go find that poll
i couldn’t find it if someone finds it please rb this w the link tahnksss
Emma reminiscing about her and chase… i don’t like it. Girl run!!
Emma and chase were on different teams?? Wdym she always votes for him? She hasn’t had a chance to? It’s just- you’d really think you’d work harder to get it right
td characters with a normal amount of fingers is weird bro
Rajie runnnn
Millie hun she said to BOLT
MILLIE YOU DO NOT DESERVE PRIYA, FIRST YOU LIE ABOUT VOTING WITH HER, THEN ISE HER TO STAY IN, THEN LET HER SAVE YOUR LITERAL LIFE ONLY TO BASICALLY SAY YOU WOULDNT DO THE SAME FOR HER
that took an interesting turn WHY IS ZEE RIZZING UP A BIRD AND WHY IS IT WORKING
okay hold on the baby bird is so cute 🥺
PRIYA DESERVES SO MUCH BETTER
you know i bet the hockey bros would be somewhat more compelling if I knew anything about hockey
WAYNE AND RAJ ARE SO WHOLESOME I LOVE THEM THEYRE SO BABYGIRL
Zee is so funny “I’m not ready for a family :/”
chase i hate you i hate you I ha
bro you had better not give her the half you dropped. you had better not try to give her that i swe
jerkface
Emma why did you kiss him he’s so crusty musty dusty
Bowie only showing concern for Raj when both Raj and Wayne are really messed up
i hope Wayne and Raj stay in the game I love them sm
I also like how this season Chef actually is the one explaining each character’s possible reasons for getting eliminated. Chris and Chef share the work a lot better now and tahts good.
The way everyone goes “WHAT” and did the head turn- that was perfect
NOOOOOOOOPOOOOOOOOOOOOOOOOOIOOOOOOOO
NOT THE HOCKEY BROS
NOT WAYNER AND RAJIE
NOOOO
IM SO UPSET
“My dad used to drop me and my three brothers all the time! And two of us are fine!” honey I don’t think you’re one of those two…
I wish they’d bring the ship back :(
I liked the ep until chemma and then wayner and rajie left :( i loved them sm
10 notes
·
View notes
i feel like living with eddie is a combo of "dm's bathroom voices time" (https://captainsupernoodle.tumblr.com/post/688400548925505536/justalittlebluetiefling-bathroom-voices-time) and living with a cat - it's not for the faint of heart, but steve (and possibly robin and the kids, depending on the living situation) is eventually completely immune to being haunted. strange creaks, weird voices, footsteps in the night, bizarre stains, cold spots, things moving without anyone remembering them? it's all just eddie, dude. either he's prepping stuff for a campaign or practicing his npc voices or he's off on one of his research binges and either way he does stuff like put his keys in the fridge and wander away from the bathroom while he's brushing his teeth, leaving the faucet running. haunted wailing? he's just experimenting with his keyboard. steve threatens to disown dustin when he introduces eddie to wikipedia. he hasn't seen his husband in three days.
you just…you…this…mate…I am two seconds from throwing my phone at the wall. CAN YOU IMAGINE????? Oh my GOD
Like one day steve phones the house from work and Eddie answers but as a character and Steve has to spend 15 minutes of his only break of the day trying to figure out how he can ‘trick’ this character into letting him talk to Eddie
HAUNTED WAILING KEYBOARD!!! Listen I fully believe Eddie bought sound effect cassettes/vinyls and just plays them on loop and it’s just tracks of: howling wind, wind in a forest, rain on a cement roof, bird call of the English blue tit (25 minutes), shoes on gravel, shoes on gravel loud. And he plays them CONSTANTLY. Sometimes steve wakes up in the middle of the night to see Eddie hunched over his guitar, sound effects playing, while he’s trying to construct the perfect tavern song for a pub in a desert owned by triplets who are all called Jug. Steve just rolls over and goes back to sleep.
Wikipedia Eddie is a terrifying force, there’s certain pages he constantly has open ready to correct any wrong updates people try to add (one of these pages is Dolly Parton)
39 notes
·
View notes