#I'm sure it's just a private blog or whatever

[irbcallmefynn]

Okay this is a very hard post for me to make but i feel like i have to make it. I can't be quiet about this any more. I can't keep saying it where nobody will see it because i need people to see it. If the friends of anyone mentioned in this post want to send it their way, feel free. This is not a call-out post. This is an apology, and an ask for explanation.

I want to preface what I'm about to say with: I'm not mad at anyone mentioned in this post. I don't think anybody in The Creachures is. We all miss you and wish things could've worked out. I'm sorry if what I say comes off as hostile or aggressive, I'm not great at wording this sort of thing, and it's coming from a place of much emotion.

@hexedbug @juneibyou @xxthunderthedragon @bobisnotaperson @razzytism

You five have caused me a lot of stress and anxiety in not telling me what i did to hurt you. You haven't given me the opportunity to improve upon myself or correct these transgressions, or even apologize to you. I'm sure you're all at least somewhat aware of how I handle feelings like this, and I understand you not wanting to pander to me or hurt yourself by putting up with me and my Rejection Sensitive Dysphoria. But you all let me down very harshly, and I've been unable to move past what happened because of it. You've made being on Tumblr miserable, to the point you're making me consider quitting Tumblr, because being on here and seeing you constantly and feeling that sense of hatred hurts, especially when you're being closer to my friends than they are with me. I've been told you don't hate me, but it's hard to believe and accept that when, in my head, you've all decided to block me for unknown reasons, and denied me the ability to apologize.

Hexed. I understand you find what I post about weird. And I understand I was interacting with people who "dragged the server down". You're the one I understand the reasoning of the most. Not following me back because you don't like my posts is fine, though you could've just blocked tags/post content about that stuff. If I was tagging things improperly you should've told me so I could correct it, instead of letting it sit inside you until you couldn't handle it. I get I was encouraging people to vent in Tau Heximus 2, something you didn't want. But again, you should have said something, or done something. I contributed to making your server a place you didn't enjoy. I feel like you wanted both a strictly positive place, and a place where people can be honest and close, two things that don't mesh. I chose the one that I enjoyed more, a close, honest community. I'm sorry I went against your wishes.

June. When you left the server, you said that "Bug Squad" were real ones, and that you still liked us. You then went on to call us and our friends Delusional for starting a new server after the old server's death. That hurt immensely. I understand you were in an emotional place, but using a word like that is not acceptable. You also went to my girlfriend's private vent blog to target it directly. You're the only one I ever blocked, because you were being actively hateful, and betrayed my trust directly. I have since unblocked you, though, because I'm not mad at you, not anymore. You were trying to cope with what happened, and I get it. I just wish you handled things more gracefully and politely. I'm sorry for whatever I did to hurt you, besides joining a new server. Just, please, work on your emotional control some, so outbursts like this don't happen again.

Thunder. You're the one I miss the most. I felt so close to you. You almost felt like a brother to me. But the way you've been avoiding bringing up what I did to hurt you makes me feel like you either don't want me to know what i did, or don't know what I did yourself. I just wish you'd be more open to talking, so we can work things out. I'm so sorry for hurting you.

Bobbu. I thought we were still friends when you invited me to join Art and Slimes. I turned it down because I don't think I could handle a server of that size, and had already joined the new server. While we maybe weren't as close as some of the others, I still considered you a friend. I'm sorry for whatever I did.

Raz. I am so, so sorry for everything that happened. TH2 was the only place that you had found comfort and support in to such a degree, and I've been worried about how you've been without that support. I feel like you used to trust me a lot, enough to confide in me about some of your issues. I wish I knew what I did to betray that trust.

There's three others I wish to bring up that haven't hurt me as bad, but I still wish to say something to.

Mars, I'm glad we're still friends. But it feels like you're less a part of Bug Squad than you are Hexed and June's friend group. I'm always worried about the state of our friendship, since you interact with them so much more than Me, Rico, and Tetra. I just feel excluded and neglected, is all. I'm sorry.

Yaza, I don't know how to feel about you. You're clearly more of June and Hexed's friend than mine. Clearly you don't like the new server because we kept bringing this stuff up in the early days, and I'm so sorry for that. I just wish we could still be friends. Because right now it doesn't feel like you want to be my friend.

Eblu. I don't know what to think of you. You're a good guy, really. But when you say you're my friend and then turn around a few days later and say "if you're friends with [close friend of mine] don't interact with me" I have issues with that. Deciding that everyone who's friends with someone is now bad because they made a mistake is not okay. Yes, it was bad that it happened. Yes, that friend should've been more careful. You are valid for being upset by what you saw. But you don't have to declare everyone who likes that person undesirable. You took it too far.

There are two things I did that I feel I need to apologize for that I actually know of.

When Tau Heximus 2 was dying, I had said that killing the server would kill me. That was disgusting of me. I should not have said that. It was emotionally manipulative of me. I was scared, and confused, I had never experienced something like that before, the loss of somewhere that felt like home, it really felt like I was going to die, and I spoke with my heart instead of my head. If this is what I did to hurt you, I am deeply sorry for saying something so uncomfortable. I'm doing my best to keep my emotional responses under control. And I hope that should anything like that happen again, I won't have such a dramatic response.

I would also like to apologize for being so difficult to help. Whenever I'm offered advice on how to improve or fix something, I have a habit of coming up with excuses, or just flat out rejecting it. I don't mean to come off as ungrateful or opposed to your help. Stressful situations cause me to mentally shut down in a way where anything to help that takes even a slight amount of effort becomes an insurmountable task. I'm trying my best to be more receptive of help, even if it's just agreeing that it would help. I just wish I had the means and energy to actually act on the advice. I am so sorry for anyone who I've hurt by denying your help. Offering me advice does help me mentally, because it lets me know people care, but I feel terrible that I hurt people by not being able to accept and act on the help.

This isn't a call-out post. This is me asking for clarification on what I did wrong, apologizing for what I know I did, and wishing to clear things up.

Thank you for reading.

#long post #i'm sorry.

[bougiebutchbitch]

I don't know who it is who keeps reblogging my stuff to a blog neither I nor anyone I know can see, or if it's just weird Tumblr ghost notifications - but it sure makes me nervous!

#I'm sure it's just a private blog or whatever #they like a lot of my stuff too #but it really wigs me out that I can't see them at all :c #I'm sure you're not a creepy person keeping tabs on me secretly but that is what my brain always jumps to #it makes me really squiffy and I know it's not fair of me to ask Not To Reblog My Stuff To Private Blogs #but just - AHHHHH my mind is a paranoid place sometimes and it Does Not Like This. #again I know that I'm being ridiculous and nothing malicious is meant. it's just. my. brain. sfdgjlsdfg #this is nothing against you personally. more about how I just get weirdly nervous about stupid stuff #it shouldn't give me the jeebies. and yet.

[daincrediblegg]

no you know what I'm going to scream about the stuff I talked about in the tags of this post publicly

I'm tired of the well-meaning "don't feel bad if your work only gets 20 notes your genius is what counts and do it for you!" bullshit. I've had a good handful of friends who have straight up DEACTIVATED in recent months because their work was not getting reblogged AT ALL. No, it wasn't from lack of not being well-liked, no it wasn't from lack of trying to make sure it was getting out there to the people they knew would engage with it. It was because no matter how much they were praised privately for their work, when push came to shove, absolutely NOBODY reblogged it and gave it the audience that it was due, and I'm tired of people shoving the "unsung genius" narrative as an excuse for it. Nothing excuses that. And the boop event really proved that.

because I know given the opportunity, indiscriminately pressing a button (sometimes 10 thousand times, as I did) is not beyond this website's capability. y'all loved doing that. and look at what it wrought. nothing but love and affection and happiness. just from a couple of quick clicks of a little paw button. sure. nobody knew who you booped but the other person (which is how likes used to work on this website, btw). there was an element of anonymity to it. but that is kind of the core of this website that no other social media platform still has: the ability to be anonymous. and hyper-curating a blog on here like you might on twitter or instagram to project an image is simply not viable. and hey. you wanna know a secret: literally nobody cares what you post or whether it goes with the "theme" of your blog or not. yeah. I know. CRAZY concept in this day and age. but literally. I myself have reblogged things that have had nothing to do with whatever I am currently fixated by and you know what happened to my follower count? not a damn thing. in fact, I actively try to reblog things specifically BECAUSE it's my friends who made them (even though I'm not always good at KEEPING UP WITH HOW MUCH THEY POST @prismatica-the-strange will NEVER GO UNRECOGNIZED by me).

And you know what fucking sucks? I have to deal with this too. surprise right? you ever wonder why I reblog fics or art I post like 20 times the day that I post them? do you ever wonder why I ask about tag lists and beg for asks all the time? IT'S BECAUSE EVEN I GET LIKE. 5 LIKES ON THE THINGS I POST. AND THE REST OF THE REBLOGS ARE MINE SO I CAN MAKE SURE THAT PEOPLE WHO WANT TO SEE WHAT I MAKE GET TO SEE IT. and I say that knowing that I'm certainly not an unpopular blog, or an unpopular writer. I know that people love the stories that I create. Hell, half of the people that I've talked to about lady terror have told me that they consider her to be canon (AND EVEN SOME!! THOUGHT SHE WAS!!! WITHOUT EVEN HAVING WATCHED THE SHOW! WHICH IS STILL SO SO WILD TO ME!!!) But especially in the last 4 years (which really dates this phenomenon), my posts, no matter how well received they've been amongst people I've talked to about them directly, I still go into the notes and at least half (often more than half) are MY reblogs to make sure people saw what I posted. and it happens every single time, and I can't tell you how much it crushes me considering that it used to be that I would be able to post it only once, and people would reblog it sometimes even HUNDREDS of times.

It's not about popularity. it never has been. it's not about anxiety. or shifting website cultures. even if you lurk, the simple fact is, that if you want people to keep making what you love. you have to reblog. your theme won't suffer because you reblogged a fanfiction that you really admire. your posting won't be ruined because you reblogged some fanart from someone in a different fandom. really. I promise. and if people do unfollow you for that? who needs em. followers come and go but you should NEVER have to cater to them. on this website it has ALWAYS been the other way around. lean into it. make it yours. put stuff you ACTUALLY WANT to be seen and that you love and appreciate on your blog. no matter how old it is, how new it is, no matter how niche or off-theme it is.

so please. if you really want to show your appreciation for someone's work? you reblog. it's really as easy as that. check the tags. add some when you reblog if you like. but please for the love of god reblog. it's as easy as booping and even more rewarding for the people who you reblog from. if you want to let someone know that their work is genius and appreciate it? show it. reblog. then DM them if you're too nervous to say what you want to say but not in a public forum. but for christ's sake. REBLOG.

#fanfiction #fanart #reblogging #boop

[hareofhrair]

I wanted to put this one the previous post but it was long and this is a tangent but- In regards to the hypothetical "If House was my doctor I'd just tell him everything. Rip to all his other patients but I'm different."

The whole point of the show is that you wouldn't. Like a major theme of the show is about how the various shames and stigmas and habitual dishonesties that plague our societies both metaphorically and literally kill us. "Everybody lies" isn't just a cynical catchphrase, it's the shows thesis. Because of how we operate as a society, everyone feels compelled to suppress and hide things and that inevitably leads to suffering.

And there are plenty of episodes where this is obvious, ie "I cheated on my partner and gave them an STD." But there's also much more of "This little girl went through early puberty and because of the way our society stigmatizes women's bodies her single father never discussed puberty with her and she was so afraid and ashamed of her new pubic hair that she tried to shave it without telling anyone and mutilated herself, leading everyone to think she'd been abused and throwing off the whole case until House figured out her hormones were going crazy because she'd been exposed to her father's low T medicine, which he hid because of how our society regards masculinity, which he started taking because he began dating a younger woman (because of shame stemming from our society's unrealistic expectations wrt sex in relationships) which he was hiding from his kids, because of shame regarding our societies toxic views on monogamy."

A particular episode stands out as a really good example. S06E15 "Private Lives," which aired in 2010 but was fairly prescient about where social media was heading. The patient was a blogger who documented literally every moment of every day for her followers. She made it very clear she left *nothing* out, from her and her boyfriend's sex life to, eventually, asking for feedback from her followers on whether to get her heart valve replaced with one from a pig or a "vegan" plastic one. She handed the whole blog over to House as soon as he took the case and the team poured through the whole thing. Surely this is proof you're wrong about everybody lying, the team says to House. She's give us her whole life and you still can't find out what's wrong! Spoiler, it turned out the crucial symptom that allowed House to put it all together? Was the one thing she *didn't* include in the blog- Her bowel movements. Shame and stigma around talking about *poop* nearly killed this woman. It was also a detail that should have been picked up immediately by a normal doctor, who would have asked about her bowel movements as part of the standard checklist of diagnostic questions. But this woman was so confident that she'd laid out every relevant detail of her life in her blog, she wouldn't answer those questions, obfuscating what she was actually ashamed of underneath a pile of curated, rationalized, narritivized junk she could pretend was proof of a lack of shame and not simply a skill at creative writing.

When I say "I'd just tell House everything" is ridiculous, I don't just mean "well, because of the way the show works, you HAVE to be hiding SOMETHING." I mean literally, you- because you are a human being- are ashamed of *something.* And because you are a human being, the more info you try to give House the more deeply you will bury whatever it is you're actually ashamed of. And, because of the way the show works, that *will* end up being the key to what's making you sick.

#house md #hate crimes md

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

#hellsitegenetics #faq #intro post #flowers #plants #requests #birds of paradise #asks #remember to keep checking back!

[ao3commentoftheday]

I've always found it hard to find the right words for comments, but I used to try and put down something on all the fics I liked but after seeing what some of my writer friends, who are fairy popular in their fandoms, say privately in the groupchat about some of the comments they get, I can't bring myself to leave any comments at all any more.

I know it's a form or unloading where they can salt without hurting anyone and I generally think that's a good thing, saltmates are needed so you can talk about all the crappy annoying things in fandom in a private space and not spread shit on tumblr or ao3 etc.

But It's so so disheartening to me as a comment shy reader because it's never good enough. If it's just emoji hearts or someone saying "second kudos" it's too short and worthless. If it's epicly long well-written, funny, sweet, and clever love bombing, then it's too much and annoying.

I just don't understand, I don't write myself, I draw, badly, and I never get the kind of praise they sometimes get, but I would LOVE to have some of those things said about my work.

I love my friends a lot and I'm a firm believer in saltmates, but it makes me a little crazy and very paranoid to see the difference between what they say in private and what they actually answer to the comments in public on their fics.

I've read a lot here on tumblr about how fic writers love ALL comments etc etc and a lot of tips and tricks for people who have problems leaving comments, but I dont trust that now and I never comment anymore because I do not want a writer of a fic I love to think such things about me, even if it's just in their minds in private.

Do I have extra salty friends or is this a common thing among writers that no one wants to admits out loud?

From my experience, as a writer in fandom on and off for 20-ish years and as the mod of a comment-positive fandom ask blog, your friends are extra salty.

Have I heard people get frustrated with "I liked this!" comments? Sure. But for every one of those, I hear at least 10 people who are giddy and bouncing and just over the moon that someone liked their fic. I've never heard anyone complain about "epicly long well-written, funny, sweet, and clever love bombing." Most fic writers I know would probably pass out from happiness if they received one of those.

I don't know your friends, of course, but it sounds like someone in the group got a little toxic at some point and the rest of them went along, for whatever reason. Maybe burnout was a factor. Maybe they had a specific thing they wanted to get from their comments section that they weren't able to receive. Whatever the cause, the effect on you is bad.

I know you didn't ask for what to do about this, but I'm going to lay it out for you anyway:

stay in the group chat and feel worse and worse about every comment you've ever left on a fic

say something to your friends and ask that they have those conversations when you're not around (your choice if you include the part about it being because they make you feel bad)

leave the group chat and maybe also lose those friends

None of those options are great, but your current situation already sucks so it might be time to try something new.

I'm so so sorry that they made you feel like your comments weren't enough, anon. You don't deserve that. No one does. I hope if those authors see this ask that they pause and reflect and realize the audience they were speaking in front of.

I agree that people need a place to be salty, and I appreciate them doing it in a private space - but it wasn't private enough. ❤️

#asks and answers #long post

[russellsppttemplates]

It's like we won't even be there (Lewis Hamilton)

Mercedes has three power couples

Note: english is not my first language. After a long time, I'm finally posting this request.

Thank you so much to everyone who likes and reblogs, your feedback is appreciated 🤍 and I'm taking requests so if you have any ideas or concepts you want to share, feel free to do so as I'll try to get to them the best I can!

my masterlist

Tw: mentions gender inequality, misogynistic ideals

Tag list: @myloverjk-blog

"Everyone on social media has an inkling that you're bringing someone to the race. Is it your belle, Mr. Hamilton?", you teased your boyfriend as he got ready for bed.

You had arrived in Abu Dhabi a few hours earlier, caught a cab to the hotel where your boyfriend had been resting before media day.

"Is that so?", he wondered, "I haven't told anyone outside the team. And even them, I told them you would be joining as my guest, only a few people actually know about us", he assured.

"I don't mind it, we'll have to be public at some time. Three years dating outside of the public eye, plus another year of what the kids call soft launching, whatever happens this weekend, happens", you tranquilized him.

This had been an ongoing conversation for you for as long as you've dated. His lifestyle came with many implications, particularly not always being home and public eye. You also spent a lot of time focused on your job, building the company now associated to your name to the people in the finance business, so the latter question was the biggest one. While you were successful, it hardly impacted your life when it came to the public eye or social media. You had your accounts, sure, but they were private and they never got in the way of your job.

"I just don't want people to lash out on you", he replied, sitting next to you on the bed, his fingers tracing shapes in your hand, "I've seen how brutal they can be, I've felt how brutal they can be, and I don't want that for you. They'll gossip because that's how things work, but I don't want them breaking the respect line.", Lewis stated.

"Lew, I understand and appreciate your concern, but I'll be fine. I have you, our families, our friends, I'm going to be just fine. I don't know how they'll react, so I'll work with whatever happens", you smiled, snuggling into him as he caressed your face.

.

"Good morning, Y/N! How have you been? I haven't seen you in so long!", Carmen said as she hugged you once you arrived in the hospitality, Lewis kissing your cheek briefly before he headed for his meeting.

"Hello, gorgeous girl! I've been good, and you?", you greeted her with a kiss on each cheek after saying goodbye to Lewis.

"Same old, busy but managed to come and support G this weekend. You, however, seem to finally let it out", she smirked, walking with you to the coffee station and serving yourselves, sitting in the balcony as you overlooked the track.

"There's no point in keeping it a secret, I guess. We did it for a while, and this past year we both realised that we want to be able to go out and not be worried someone will see us and whatever consequences it could bring. We're adults who hope other adults will behave like such", you smiled.

"A hard thing to do sometimes, for them at least", you heard a female voice coming closer to you, "I don't believe we've met before, but Toto said you were hanging out here", the blonde woman said.

Suzie Wolff had been someone you looked up to since you were little, so this was a proper fangirl moment, "sit, sit! This is Y/N!", Carmen introduced after giving her a brief introduction.

"I keep missing you whenever you join us for the races!", she said, "the pandemic didn't help, and lately I've been so busy with the F1 Academy that I've hardly been to races myself", she reasoned, beginning the start of a conversation that was only interrupted for lunchtime.

"Press usually have a field day with powerful women related to this sport. You should be able to get away with it because you don't work for racing, but they love going on and on about how we got to where we are because of who we date", Suzie shook her head.

"Absolutely, because George is very interested in Family Offices and he got me my job", Carmen rolled her eyes, "you try and give that guy math stuff and you see how it turns out! Besides, not many people actually knew who he was, they're not very into motorsport, only a couple of them!", she teased.

"Agreed! The only way I was able to have my own company was because I name dropped Lewis, who I didn't know at the time. He doesn't know his numbers all that well. It's so easy for them to point fingers, but it's really just because they hate to see a powerful woman get the job done", you offered, seeing your partners arrive to the table along Laura.

"Social media is going crazy about you, Y/N!", Laura, one of the team's social media managers said while you had lunch, "there's people who spent the whole morning trying to find out who you were and they were faling to find your accounts. Apparently, they were looking in model agencies and such until someone pointed out you studied at the same university as them, and it's pointed them in the right direction I'd say?", she shrugged her shoulders, showing you her phone as she scrolled through media, "they're still trying to find out more, but they only have a few articles from your company and a picture of you when you graduated that is on the university's Wall of Fame!", she made you giggle, fondly looking at the wall of pictures you saw everyday on your way to lectures.

"Are you on the Wall of Fame and didn't tell us, Y/N?", Carmen exclaimed at the new information, "it's barely anything, I'm still there probably because someone forgot to remove the picture", you blushed, suddenly feeling like the table's attention was on you.

"Why would they take out the picture of the most beautiful woman with the most achievements?", Lewis charmed, holding your hand in his as he smiled.

.

"Are you guys ready for the race? If all goes well, we can get back to the points!", Suzie cheered as she handed you and Carmen your bottles of water.

"Lew has been beating himself up a lot lately, hopefully everything works in their favour", you held your hands together after setting the water bottle on the counter.

It was very touch and go, but the boys ended up with good results given the position they started in.

"Congrats, my love!", you said in Lewis' ear as he squeezed your torso over the barrier, delighting the sight of everyone who was watching and seeing the happy couple, "couldn't have done it without you, gorgeous girl", he yelled back, stealing a kiss before running to the mechanics.

"I'm just going to check where Suzie is and then we can go for dinner, guys", Toto stated, squeezing George's and Lewis' shoulders before checking is phone to see if his wife had seen the text he sent about said dinner.

"The F1 Academy paddock is closed, you can see it from here that nobody is there", George pointed out as his boss frowned.

"I would help you, but I have to go and look for Carmen, too", George scratched his cheek as they walked along the corridor, seeing Lewis open his driver's room door and slumping his shoulders slightly, "Y/N is not here either".

"Where have the Mercedes missus gone...?", Toto muttered.

It didn't take then long to hear the mix of your three giggles coming from the lounging area, the three of you sat in the smaller sofas around a coffee table, hot drinks in your hands as you discussed something avidly but in a relaxing way still.

"Are the three of you willing to have dinner with the three of us? We'll still let you speak between yourselves, okay? It's like we won't even be there!", Toto joked.

#lewis hamilton imagine #lewis hamilton x reader #lewis hamilton fanfic #lewis hamilton fluff #f1 x reader #f1 imagine #f1 fanfic

[jqnsfw]

Seeing S/O in Lingerie Reaction

From a request in my main blog, this has no smut but VERY SUGGESTIVE so... yeah ¯\_(ツ)_/¯

Sebastian Moran, William James Moriarty, Sherlock Holmes, and Louis James Moriarty

Tag/s: Historically inaccurate lingerie

Sebastian Moran

The man whistled as soon as you entered his field of vision.

He looked like a kid in a candy store.

Straight up GRINNING from ear to ear.

If you're showing him a variety, he'll inspect every single one of them.

It's almost alarming how focused he looks.

Little do you know, he's thinking about how to use whatever lace or strings your outfit has to his advantage in the bedroom.

The minute you're within his reach, Sebastian pulls you to his lap to get a closer look.

He takes his time to take in your figure while his hands roam through your body.

Even as you walk away, his eyes never leave your figure.

Like you were one of his targets on missions.

He would definitely tease you, wanting you to get riled up as much as he is.

What's more annoying is he wants you to say that you want to do it before he continues.

He's torn between taking it off or just doing the deed with it still on you.

Whatever position you're in, he definitely has a good view of you.

A mirror might be involved.

"I'm back-" Sebastian abruptly stopped as your eyes met in the mirror, wide in shock.

His eyes traveled down to your new short silk nightgown and stockings, going up and down before smiling.

"You could have just said so," he chuckled, removing his coat as he walked up to you.

You quickly grabbed whatever was closest to you, in this case, a hairbrush, and pointed it at him as you kept a distance.

"Oh no, you don't! Last time, I chased the target through the city with a limp!" you muttered, keeping your distance as your eyes never left him.

"Do you have a mission tomorrow?" Sebastian innocently asked, making you pause.

"...No...?"

"Then that settles it," he smiled, quickly hugging your waist.

"SEBASTIAN!"

"Don't worry, I'll be gentle. Wouldn't want your pretty outfit to rip, now do we?"

William James Moriarty

When you asked him to come with you to go underwear shopping, he was shocked, to say the least.

But he quickly recovered and agreed.

You definitely have his attention now.

While his eyes kept following you while he drank his tea, his smile was different than it usually was.

It was more... devious, so to speak.

While he keeps his composure, a lot has happened in his mind.

While you were picking some things, William acted like a perfect gentleman.

Holds the clothes you picked, heartfelt compliments to boost your confidence, over all the best boyfriend you could ask for.

Almost too good to be true. And it was.

He might have thought of a few scenarios on how the two of you could get away with it in the store.

It helped that it was a pretty private dressing room, considering the store was made just for the nobles, where it was just you and him.

Even the workers were far from earshot, attending to the other customers at the front.

But he didn't continue since he saw you enjoying your little date and didn't want to ruin your good mood.

It didn't help that you would ask him for help to put some of them on, though... Or take them off.

Besides, he has the whole night planned just for the two of you, and he's making sure no one would bother you two.

You hummed happily as you swung the bags in your arms, satisfied with your purchases.

"I'm surprised you agreed to go shopping with me, Will!" you mused as you turned to William, "Didn't you have a meeting later with everyone? Wouldn't you be late?"

William gave you a smile as he grabbed your hand, "The meeting was moved since some of the professors were out sick,"

"Is that so..." you trailed off, shrugging off his response.

William quietly chuckled, remembering the surprised expressions his comrades had when he said the meeting was canceled and assigned a new mission to everyone.

The manor was now empty until morning.

"Well, whatever! I can't wait to try these at home," you beamed, looking down at your new haul.

"Indeed," William agreed, a dangerous glint in his eyes.

Sherlock Holmes

He never saw the appeal of the lingerie until he saw it on you.

Now, lace is his favorite thing on your body.

The first time he saw you in lingerie, it was like he shut down.

He didn't say a word, but his eyes were glued to you as he reached his hand out to you.

When you walked up to him, he eyed every inch of your body, engraving the image of you in his mind.

To him, you looked ethereal.

Like beauty personified.

When he did speak, it was soft and breathless, as if you rendered him speechless.

And when you did it, the sight of you in lingerie and covered in hickeys he left is now his favorite thing.

He gets more possessive whenever he sees you in lingerie.

And surprisingly more gentle and slow, wanting to enjoy every second of it.

Now, every time you buy a new set, he likes having a private fashion show.

When you bring him to a lingerie store, he is not embarrassed at all.

Hell, he'd even pick out a few things for you.

You can tell his compliments are genuine with how serious his expression is.

"Sherlock?" you called out, slowly walking up to him.

His eyes were completely wide as he looked at you.

"Sherl?" you called out again, but no response as he continued to stare at you.

You bit your lip as you covered yourself, feeling self-conscious wearing nothing but a bustier with matching underwear.

"Don't,"

"Huh?" Sherlock quickly grabbed your hands, pulling them down to your side.

"Don't hide it. You look beautiful," Sherlock breathed out, mesmerized by your outfit as his eyes slowly looked up at you.

You felt your face flush as you looked away, unable to meet his gaze.

"You're staring too much,"

"I disagree,"

Louis James Moriarty

You almost gave the man a heart attack.

He was not expecting to see you in lace and sheer one night after a long day of house chores.

Was it an unwelcomed surprise? No. Definitely not.

That night, he was just hoping to have some downtime with you after working the whole day.

So when he saw you by your dresser half-dressed putting on stockings, it was like the man turned into stone.

Minutes later, Louis came back and saw you in your robe, relieved to see he was okay.

His face became completely red when he remembered what happened and apologized for walking in on you.

Even though you forgave Louis, he's still scolding himself for liking what he saw.

What's more, his eyes would gaze over your robe when it would slip.

Explaining why he slammed his head on the table was interesting, to say the least.

So when you told Louis it was okay for him to look, he was still shy. But you would catch him stealing glances your way.

He tries to compliment you, say anything coherent for that matter. But he just mutters something while looking at the ground.

However, the moment he got more confident, his hands would not let you go.

Suddenly, he's fluent in dirty talk and knows just what to say to get you in the mood.

And he makes sure you know just how beautiful and alluring you looked that night.

"I truly apologize..." Louis muttered, a cold towel over his head as you chuckled, tying the robe tightly around your waist.

"Don't be. I'm just surprised," you reassured as you removed the towel, making Louis meet your eyes.

You weren't sure, but you swear you saw his eyes tracing your robe down to your chest.

His face turned completely red instantly, making him turn away.

You breathed out a smile as you hugged him tightly, kissing the top of his head.

"I'm really not mad, Louis!" you giggled, swaying side-by-side.

"Besides, that was for your eyes only, you know?" you grinned, making the man freeze as steam came out of his face as you snickered.

"Please don't tease me..."

#yuukoku no moriarty x reader #moriarty the patriot x reader #yuukoku no moriarty smut #moriarty the patriot smut #sebastian moran #sebastian x reader #ynm sebastian #william james moriarty #william moriarty #william moriarty x reader #sherlock holmes #sherlock x reader #ynm sherlock #louis james moriarty #louis moriarty #louis moriarty x reader

[savannahsdeath]

Hey girl I'm obsessed with your writing!! I have a lil request. Could you do reader x dom abby. Abby is the readers brothers best friend you can do whatever you like with the story just make sure there's lots of smut 😻

BBF!ABBY ANDERSON X READER

mdni please<3

warnings: 18+!! dom!abby, sub!reader, smut, abby is taunting reader and sliiiightly being mean

writers note: first abby fic on my blog guysss !! also i love the 'just make sure theres lots of smut' like yall are sooo desperate but SO AM I🗣️🗣️

abby, as your brother's best friend, acted a lot like him. and we all know how brothers act - they tease, taunt, mock and laugh at their little sisters. she wasn't so cruel with it, more playful, but it still annoyed you. maybe, in person, she wasn't that bad? you never had a chance to talk to her privately, until that one night.

you were getting ready for a small house party your classmate invited you for. you dressed in the shortest skirt and the tightest top you found. you planned to go there late, when everyone's already drunk out of their minds - it's funny to see them like that. maybe something like midnight, or even later.

when everyone already fell asleep you sat at the kitchen table, having a typical night's snack. you were eating slowly and peacefully until abby came in, taking a glass of water and slowly sipping from it while leaning against the counter. she studied your little outfit and smirked.

"well, well, well..." abby spoke to you, still inspecting your attire." someone's all dressed up."

you sat in silence, feeling yourself heat up under her gaze.

"what's the occasion?" she continued to maintain her wry grin. "some special man got you all dressed up?"

"well... i did have... something planned tonight." you spoke, your voice trembled a little as you tried to remain confident. "i was headed to a gathering of friends."

abby raised a single eyebrow, her smile grew wider as she let out a little chuckle. "you sure are heading out a little late, aren't you?"

"i don't see what business it is of yours anyway." you answered with some hesitation, not sure what other reason you could give her.

abby chuckled. "someone's a little defensive." she took one finger and lightly tapped your chin, making you look straight in her eyes. "i bet you're planning to meet some special boy."

you could feel your face flare up from the heat, and you decided against agreeing to everything. "maybe, and so what?"

the truth is, you didn't even think about... ugh, boys. you just thought she'll leave you alone once you satisfy her with your reply.

"no, you're not." she laughed. "i mean, maybe you planned to, but you're not going anywhere."

you scoffed. "it's not your house, you're just my brother's guest. you won't lock me up or anything."

"that's right, i won't." she said with mock-concern. "but you won't go there, unless you want your family to know..."

your heart dropped but you let out a nervous chuckle, hoping it'll cover you.

"you wouldn't. don't lie, i know you wouldn't." you shook your head, the fear unluckily evident in your voice.

abby's smirk faded to a more serious expression, her voice becoming colder as she leaned in closer.

"i'm sure they'd want to know what their precious little daughter is up to." she spoke to you, her tone dripping with menace and a promise of a punishment. "but if you're smart, you'll just stay right here. won't you?"

you couldn't bear the thought of your parents knowing, there was no way you would tell them what you were planning.

"fine, i'll stay. happy?" you tried to sound tough, but the hint of a whisper in your voice showed you were not so confident about agreeing to abby's terms.

she smiled once more as finished her drink and turned around to set the empty glass down. "good girl."

you sat there, in the kitchen, letting out a long breath that you didn't even know you had been holding.

then, abby turned back to you with her trademark teasing grin.

"now, what are we going to do at this wee hours? it would be a shame to waste your lovely outfit..." abby admitted with a smirk and a light shrug.

she then began to walk towards you, her face filled with playful mischief as she reached out and cupped your cheek. she raised your face up, a little closer to hers, as her thumb stroked your bottom lip. without standing up, you leaned in, your lips barely brushing against abby's as you tried to resist the urge to do more. she took the initiative, leaning down to press her lips against yours in the most passionate and firm way possible.

you ended up with your legs spread wide open, sitting on the edge of the chair. if anyone woke up now, they'd see abby kneeling in front of you with her head buried deep into your core.

"you gotta stay quiet, m'kay?" she murmured, hearing your breath beginning to get more and more shaky by every second.

she was right. no one came to check on you before, when you were just talking - it wasn't suspicious. however, the case would be different if it wasn't words escaping your mouth. you didn't miss the party so your parents don't find out about you sneaking around, just for them to see what you're doing now. in fact, they'd probably prefer you to just drink with your friends, than let your brother's friend's big hands hold your legs while she leaves dark marks on your inner thighs.

your breath became short, and the shaking had only gotten worse as you tried your best to hold back your louder, more audible reactions from the pleasure. your legs started to feel numb from both her grip and being forced to not move. as abby injected two of her fingers knuckles-deep into you, they uncontrollably closed.

"ohh, no, no." she laughed. "open up for me."

with her help, you managed to part your thighs to their previous position.

your walls clenched, adjusting to her length. you tugged on her braid, your nails digging into the gaps between each binding, ruining her hairstyle and making it messy.

"c'mon..." she twisted her fingers and started to work her magic. "it's bearable. you're kinda... overdramatic." she raised her eyebrow and chuckled.

you started thinking about some witty comeback, but you couldn't risk opening your mouth. not when you knew how many stashed moans hide in the back of your throat.

her thumb circled your clit, adding to the sensations. it wasn't necessary and you swore she just makes things harder for you purposely.

you shook your head, silently communicating to the voices inside your head you won't give in. but you did, moaning out a little 'abby...'

"sh, sh, shhh." she clicked her tongue in a mockingly disappointed gesture. "i don't know about your parents, but if i heard something like that in the middle of the night, i'd know what's happening right away. we don't want that, do we?"

the bratty side of you scoffed before you could think about obeying her. that made her laugh even more. you felt a pang of jealousy at the fact she doesn't have to purse her lips, knowing only not-suspicious sounds leave her mouth. unfair.

"i'm sorry, what was that?" she smirked, her moves painfully slowing down. "i'm just trying to help you here. you either behave or..."

you cut her off, not wanting to hear any of her threats and taunting again. "sorry, m'sorry."

she nodded, going back to her task.

you struggled, really struggled, to stay quiet. at first it wasn't even that hard, but who would last with abby for longer than fifteen minutes? let's just say... not you.

#abby anderson #abby anderson x reader #abby anderson x you #abby anderson x female reader #abby anderson x y/n #abby x you #abby x reader #abby x y/n #abby x fem!reader #reqs open #wlw smut #abby the last of us #bbf!abby #bbf!abby anderson #bbf!abby anderson x reader #bbf!abby x reader

[yelenasdiary]

The Archer

Pairing: Kate Bishop X Fem Reader.

Summary: Kate asks you to be her first.

Smut | Fluff | Top!Reader | Bottom!Kate | Fingering | Loss of Virginity | Praise Kink | Breast Play | 1.3K | 18+! Minors DNI! 

AC: Reposting this, it was originally posted on my smut only blog that no longer exists.

"Are you okay?" You asked the brunette has she pulled away from your kiss. "Y-yeah, sorry" she smiled softly as her eyes dropped, gently you cupped her face and made her look at you, "What is it?" You asked as you looked into her eyes. Kate sighed slightly as she twirled her fingers together in her lap. "Why do you like me? I mean…. you could have any other girl in college" her eyes drop once again and your brows frown with concern. 

"Katie" you kissed her forehead, "I don't want any other girl. I like you because you're fun, you're caring and so sweet. You do whatever you want, and you don't care for what others think and I can't skip over the fact you are so beautiful" 

Kate looked up at you once again with worried eyes, her fingers still twirling with each other as she took in the meaning of your words, "You really mean that?" She asked. "Of course! Baby, what's going on? Why the sudden need to pull away?" Your thumb gently strokes her cheek. There was a moment of silence as you waited for Kate to speak, you could see her mind running a million miles per minute, but you knew better than to push her or rush anything. 

"It's just…the others talk so much about their private life and…sometimes it gets me thinking about ours" she starts. "We…we don't do anything but make out and cuddle because of me, and I sometimes think that I bore you" the girl adds with a sigh in her tone. 

"Katie, baby, no! I don't care about that stuff, I told you when we first started dating that we'll only do whatever you feel comfortable with. I love our cuddles and make out sessions, I do. You do not bore me, you never could" you assure her as you pull her into your arms. "Don't worry so much about what others are doing, just focus on what we have" you add. Kate made herself comfortable and wrapped her arms tightly around you as she nuzzled herself into your neck leaving the two of you in silence once again. You rubbed her back and enjoyed the tender moment before she stirred a little and looked up at you.

"I think I'm ready" she said in an almost whispered, "I mean, I am ready" she began to sit up, "I want you to be my first, I trust you and I…I love you" she looked at you once again. You smiled softly, "okay" you said softly before pulling her back into your arms, "I love you too Kate" you whispered as you held her. 

After a few moments you felt Kate start to kiss your neck up to your left ear, "I'm ready now baby" she whispered before she pulled back to look at you once again. She looked at you with hunger, the same hunger she'd seen Wanda look at Vision with, the same hunger when Nat looked at Maria. Slowly you moved towards her and kissed her softly as you lent her back down on her bed before kissing her check and down to her neck. 

"Are you sure? We can stop at any moment, okay? Just say stop and we'll stop" you said between kisses on her neck as your hand moved up to behind her bra and unclasped it. "Please just shut up" Kate giggled softly as you helped her pull her shirt over her head and throw it to the floor. She took her bra off and threw it to the side as you admired her naked chest, "Is…is everything okay?" She asked in a worried tone as you smiled softly. 

"You're perfect" you whispered as you kissed between her breasts, one hand slowly moving up her body to gently toy with her nipple. "Oh" she moaned slightly, "you like that huh?" You looked up at her with a smirk as she nodded. Your lips wrapped around her free nipple as your hand pinched her other, her back arched slightly as she moaned quietly not to alarm anybody outside her dorm. After a few moments you switched and gave her other nipple the same attention before kissing down her body to her waistline.

"Can I take these off?" You looked up at her, Kate nodded in reply as she watched you unbutton her jeans and pull them off her to expose the purple panties she wore underneath, "Purple really is your colour" you kissed her lips softly. Your fingers gently ran over her clothed core, "mm, baby, you're soaked!" You smiled against her lips as she moaned at the feeling of your touch, "t-take them off…please" she whimpered. You didn't have to ask twice before you had her panties on the floor beside her bed. 

"It's going to hurt just for a moment" you explained, "but I promise, I'm going to make you feel so good" you added as Kate began to slowly spread her legs for you. The sight of her was enough to make you lose your mind the way she was ready and there for the taking. "I trust you" Kate reminded you with a soft smile, "you're such a good girl" you replied before crashing your lips onto hers again. 

She moaned as your fingers moved through her soaked folds, her clit was swollen and begging to be touched but you'd safe that for later you told yourself. Your lips moved back to her neck so as you used her slick to lube your fingers, "Are you ready?" You looked up at her. "P-please" she whimpered. Slowly you moved two fingers into her entrance, her breath hitched, and her eyes shut. "It's okay baby, you're doing so well for me" you kissed her neck and back up to her lips as your fingers moved in deeper, "tell me when you're ready for me to move them" you whispered as her body started to adjust. 

Kate opened her eyes and looked deeply into yours as she nodded, "You're doing so well Katie girl, my pretty girl" you smiled softly before kissing her once again. Your fingers moving in and out of her slowly giving her extra time to adjust to the new feeling. She was tight as you felt her walls clench around your fingers. She whimpered and moaned when you started to pick up the pace. "M-more…P-please" her right hand on your shoulder pulling you into her as she bucked her hips. 

"You're so beautiful" you spoke as you fingered her faster, adding tight circles around her clit when her moans got louder. 

"B-baby! I'm….I'm gonna –" 

You could tell by the way she was clenching harder around your fingers that she was close, "it's okay darling, you can let go. Be a good girl, cum for me" you whispered into her ear as she arched her back with a moan. Her nails dug into your back as you continued fucking her with your fingers, curling them, getting her close and closer to her release. 

"Y/n!" She moaned a few times before finally; a louder moan of your name and she came on your fingers. 

"You're okay baby, I've got you" your fingers moved slower to help ride out her high she gripped onto you tightly, "you did so well baby, so good" you added. 

After a few moments, she started to come down from her orgasm and you slowly removed your fingers, bringing them up to your lips and licking them clean. "You taste so sweet" you smile softly before you lay beside her and pull her into your arms as she faced you. Kate smiled softly, her tired eyes looking into yours once again, "That was….wow" she chuckled as you kissed her forehead, "Do you feel over?" you asked her just assure yourself that you didn't hurt her, "I feel amazing, tired, but amazing" she smiled before kissing you softly, "thank you" she whispered before nuzzling into your neck once more. 

"Oh Katie, you're so sweet, I can't wait to introduce you to new things" You wrapped your arms around her and rubbed her back until she felt asleep in your arms, her naked skin against your body made you never want to forget this moment.

Taglist: @red1culous | @bentleywolf29 | @kiwiana145  | @lissaaaa145 | @high--power | @parkerdaramitzzzz | @mmmmokdok |  @wackymcstupid | @kiwiana145  | @valiantmugcowboyscissors | @shin-conan-kun | @nattyolw | @ripofflizzie | @goofy-goonie | @makegoodchoices | @musicinourlips | @apollo2907 | @marvelfan98 | @wandaroman0ff | @dumb-fawkin-bitch | @lovelyy-moonlight | @santana1437 | @fluffyblanketgecko | @inluvwithfictionalwomen | @jaymieflorissssssss | @tita001 | @youralphawolf72 | @natashamaximoff69 | @a-dorkier-book-keeper | @hehehehannahthings | @blue-serendipityy | @secrettoallofyou | @romantic-slaps-on-the-asss | @marvel-fan-2021 | @mmmmokdok | @riveramorylunar | @ripofflizzie | @scarsw1fe | @toldthatdevil | @itsmv3 | @katiemay-025 | 

If you don't want to be on the taglist for smut fics, please let me know 💖

#kate bishop #Kate bishop x reader #Kate bishop smut #fanfiction #marvel #hawkeye

[unofficial-underfell]

Hey guys, I've been thinking about making this post for a long time and I think its finally time I do so. After realizing that some of my last work was done over a year ago, I don't think I can really ignore it anymore. While I haven't quite thrown in the towel on this quite yet, it's pretty evident to me and I'm sure to everyone who still follows this blog that my fervor for the project has drastically decreased. And has been kind of dead for a while. The comic has not been a priority to me, or posting online much at all actually. I did some soul searching and found that I'd started relying on outside approval for my art instead of doing art for the sake of wanting to tell a story and express myself throughout my work. I have limited energy and depression and sometimes it feels like i get such little progress done even though it takes all of my energy. While I'm trying to go to the gym more and build better habits my energy levels and mood still have a lot to be desired, and I'd rather use the limited energy I have to work on something I'm more passionate about.

I've been trying to grow my skills and absorb more stories and I've moved around a lot and started to listen to what I really felt, and I found that a lot of the art I want to focus on deals with heavier and more mature topics. I do love this story, and all of the characters and I feel like I could make a really clever subversion of what is expected from an Underfell comic. But I feel like in these uncertain times with the world and with all of the stuff going on right now, I'd like to use my energy to work on stories that hit closer to the things that I feel are important. So that's why I've not been posting much.

I'm working on a book, and I've actually got quite a lot of progress done on it, but because of all the horror stories online about people stealing author's original works, I'm kind of holding off on publishing any chapters before I can copyright the first draft of the novel. So my online activity will still be pretty scarce for a bit, though I'll still post occasionally on my @cosmicpixel01 account. I'll try better to not be so radio silent though lol. Even if that means I'll post something boring about my dog or books I'm reading just so everyone knows I'm still alive.

I don't want to call it quits on the story. But I also feel like you guys have been kept waiting to see what happens for a really long time, and that makes me feel so guilty. I will try to finish up the pages I have in the works, and I'm probably going to switch to a different format that is some drawings, some writing to finish the story. I'm sorry that I wasn't able to finish it the way I intended for you guys, even with all of the support and kind words and even the fanart that I've kept in a folder on my desktop. I am letting a lot of you down, but I feel like the radio silence is probably more irresponsible than just going out and saying something. And I'm sorry I've kept you all waiting for a not-so-happy update on the blog.

I hope that some of you will continue to follow me for some of my other exploits and see whatever other things I have going on, but I understand that you all followed me for Undertale so I don't want you to feel any sort of guilt if you decide not to. I'm just happy you all supported me for so long.

I'll try to work on this blog again soon, and if anyone has any questions, my asks are open, though I'll probably keep the asks private. Until then I hope everyone stays safe out there. And from the bottom of my heart, thank you.

-Avery

#not pages #unofficial-underfell #this was so hard to write i dont want to be a quitter but I'm tired #avery speaks

[dearsnow]

hi may i request some aemond headcanons? anything is fine i'm just craving some feel-good sweet ones about him and reader : )

AEMOND RELATIONSHIP HEADCANONS

- headcanons for how he is in a relationship (aemond targaryen x gn!reader, fluffy :D)

a/n - anyone who knows my blog from the quarry knows that i have so many headcanons 😭 i love making them up, it’s so fun. anyways, tysm for requesting! i’ll get to everyone else’s soon :)

- he likes being touched and held softly in private. he really lets his guard down around you when he gets comfortable, and it’s always cute to see him slump into your lap when you get a moment alone.

- when you ask to brush or braid his hair, he always lets you. it’s a very intimate thing for him, so he always feels closer to you when your fingers are weaving through his locks. he gets teased a bit by his brother, sure, but seeing the sparkle in your eye as you show him his hair in the mirror is a gift in itself.

- he takes you on rides with Vhagar quite often. The old dragon has taken to liking you, and he feels an odd sense of pride when you wrap your arms around his midsection during flight.

- he’s very good at keeping his promises, whatever they may be.

- love is not a thing he ever expected himself to have, but with you, it feels natural. deep down, he cares a lot about you and tries to keep you happy as best as he can.

- he will not tolerate anyone talking bad about you, threatening you, or (god forbid) hurting you. he will take pleasure in making the person suffer should they ever lay a finger on you.

- whatever you want you will eventually get. a sweet snack from the kitchen? aemond’s got it covered. a punishment for the man who jeered at you in town? you may not even mention it to him, but he will find a way to get it done.

- a lot of his actions towards you when his family is present are a way to one-up his brother while also showing you his commitment. his brother slings an arm around his wife’s shoulders? aemond is leaning against you and wiping the corners of your mouth with his hands to show just how gentlemanly he is.

- he has trouble sleeping most nights, so he’ll toss and turn until you get the hint to cuddle him.

- sometimes he treats you like you don’t know how to do things yourself, which can be frustrating. he fully knows you’re capable but it slips his mind during certain events. just let him know you don’t appreciate it and he’ll immediately stop; he never wants you to think that he views you as less than you are.

- he will take interest in and read about all of your hobbies to get to know you on a deeper level. he loves that you are passionate about these things and will absolutely support you.

Reblogs are greatly appreciated!!

#solar eclipse. #aemond targaryen fic #aemond targaryen x reader #aemond x you #hotd #aemond targaryen headcanons #aemond targaryen x you #house of the dragon #hotd x reader #hotd x you #aemond one eye #aemond x y/n #aemond fanfiction #aemond fic #aemond x reader

[g4l4xy-qu33n]

Hello! So I'm new to your blog and I have to say that I LOVE it already, keep it up! :D

I don't rlly know if you're taking requests rn, but oh well, worth a shot. Can I request some platonic or romantic (it doesn't rlly matter) hcs with TADC Caine? I just can't get over this silly man and I'd like to read more about him!

Hi!! Yes, requests are open! (I should probably specify that - sorry!)

Also tysm!! It's so nice to hear that someone likes my blog &lt;3

A/N: I've never written for the silly teeth man before, but his personality came really easily to me - for some reason. Of course, as usual, these are all my personal headcanons for him, so please please please don't get mad at me if I 'got something wrong'. And also, this is written with afab reader in mind, but it can apply for any gender reader you like, as no pronouns or specific descriptions are used!

Warnings: Mentions of smut, and smutty activities. Apart from that, nothing but pure fluff and showman-style romance!

Romantic Headcanons for Caine!

(I couldn't think of anything I could write for platonic, I'm a lot better at romantic-)

Starting off, I definitely think that Caine is a romantic type. (What showman wouldn't be?)

Caine would favour you over all the other circus members, and deny it if he gets called out.

He would exempt you from adventures that you don't want to do, and instead take you out for a fancy candlelit meal at the digital restaurant shown in the pilot.

Think fancy wines, lavish suits or dresses, romantic jazz music played by a digital band, and candles. Tons and tons of candles just floating while you two eat the best digital food of your life.

And dessert? Angle Food Cake of course, made specially by him or bubble.

You'd dance to the music, ballroom style, with a few dips and extra special moves included.

Every time you would go out with him, he'd give you a gift. Maybe a fancy brooch, or a piece of jewellery encrusted with jewels and plated by gold.

Fancy outfits are also to be expected.

You'd be given the luxury of a larger, more secluded bedroom as well!

The bed would be adorned with silk sheets and a bed canopy, most likely in red to remind you of him.

And I'm not sure if you want nsfw, but the nights you guys would spend in that bed would be fun, to say the least.

He'd happily indulge whatever you're into. Ai's are always wanting to learn new things, after all.

He'd spoil you rotten, both in bed and out.

When it comes to affection, he's a good mix of a lot of different types of affection.

As stated above, he's a gift giver, but also big on acts of service.

He's a big believer in words of affirmation, but not too often. Don't wanna give you an ego. (Although with the way he treats you, I feel like you would already have one depending on your personality)

He would love calling you pet names. Traditional ones are his favourite, like darling, honey, lovely, dove, doll, etc.

When it comes to physical affection, he'd probably draw the line at holding hands and cuddles. Heck, even cuddles would be a bit too far sometimes. Maybe just an arm swung over your shoulder when you're watching a movie? Sure... you can lean into him as well, just not too far, okay?

And kisses are... a challenge. Depending on how you look in the digital world, kisses may be manageable. He has no lips over his teeth though, so if you really want to kiss him... uh, try your best. (Maybe just kiss his teeth?)

He'd definitely get flustered if you initiate anything or give him a gift, though.

Like he'd be all confident one second, and the next he'd be flustered and stuttering at your kindness.

He would also display your gift with pride for the whole circus to see!

That's the only thing the circus members'll see, though.

Caine would be fine being affectionate with you in private (if not too much) but in front of the others the furthest he would go when it comes to affection is pet names, or maybe flashing you a wink.

Not that the others really care though. I feel like they'd all be pretty indifferent to it, no matter how much affection you guys show.

If you bug him about it, he'd probably give in. Eventually.

AAA I'm so sorry I took so long! Home life has been crazy, but I don't really see that as an excuse-

And I hope you see this and like it! (And I'm also sorry it's a bit short-)

-Galaxy

#Caine x reader tadc #caine x reader #tadc x reader #tadc caine #caine #the amazing digital circus caine #the amazing digital circus #caine x you

[peripaltepsy]

BEWARE OF "body mod advices" - they can be dangerous and LETHAL.

(this post was about a deactivated blog but extends to any possible future blog like it)

edit3 since he deactivated: Red told me in the DMs that he WILL be more careful about all this risk stuff, I believe he is going to do better. Im sure he's a good person and he also was extremely civil in the DMs. Since he's not here to defend himself anymore I'll gladly take his side and say that despite this mess, all Red wanted to do was indeed reduce harm and potentially save lives. Good luck on all your endeavors, Red, I wish you a beautiful and successful career and that you have a great positive impact in the atypical dysphoria community, both on and offline. I don't know how my post truly impacted you, I'm so sorry if you're feeling bad. You acted the best way you possibly could.

Second, if Red comes back, DO NOT HARASS HIM, let him be himself and don't let his past hold them down.

Third, all my points still stand for their deactivated blog and any potential body mod tips blogs in the future. Please everyone, take care, stay safe.

Past edit: DONT HARASS any possible blogs like hers, just REPORT and spread awareness, (also don't make the same mistakes as me: TALK TO THEM FIRST)

Past edit: minors please interact with this post, forget my bio for this one

Past edit: editing editing the post since I talked to Red and he isn't bait. I definitely should have talked to them in DMs first. I sincerely apologize. So sorry Red! To those reading, don't make the same mistake as me, ok? Always talk to people privately first, I genuinely fucked up bad. This mistake of assuming others intentions, can traumatize them. If I were in Red's shoes I'd be traumatized. So yeah, I fucked up bad.

Their intentions are genuine but my point still stands that its extremely dangerous and can't qualify as harm-reduction / end edit note

alright, I'm not transid/radqueer but you guys need to REPORT AND WARN OTHERS of these accounts as soon as they appear. Do not entertain them, no matter how desperate you are to transition. You can become a victim of dangerous charlatanism.

LONG POST AHEAD, VERY IMPORTANT NEVERTHELESS

Archive to what i'm about to post

Red claimed to be "a non-professional surgeon, planning on getting better with practice." Bad move!

Red has told me he's pursuing a medical degree and won't actually do non-qualified surgery.

.

Red: "The blog is centered around an idea of "extreme" body mods that I would like to explore further, [...] things like breaking and re-mending bones, creating new joints, replacing skin, etc."

My point: the road to hell is paved with good intentions, and your blog was unsafe.

.

To any possible counterarguments: "But they (people following/asking advice) know the risks!" That's victim-blaming. Red gave himself the responsibility to give harm-reducing advice, but he didn't do a good job.

"But I know the risks!" You can't possibly know the risks because Red doesn't know either or "kinda knows" but has not properly informed his audience, it didnt give sources, oversimplified their advice and failed to provide accurate information about risk. Or gave plain misinformation.

Again I'm not transid, I can't possibly imagine what you're going through in order to try anything at all to feel better, including trying experimental surgery not legally available or not researched at all. However, please please please do not become a victim of medical deceit or whatever tf it's called. Even if the blog owner tries their best to be reliable.

They might sound confident, but they do not know what they are saying, what they're telling others to do.

.

Ask: "How would I make my skin gray without tattoos?" (DO NOT SHAME THIS USER BTW)

Red: "[...] I assume you want permanent grey. To do this, it's pretty simple, although it'll take a lot of time. Basically, what you want to do is to constantly be exposed to lots of silver. Any product with silver in it like specific lotions and skin creams. also fish, milk, mushrooms, and whole grains tend to have silver in them! So tldr, consume lots of silver!"

STOP!!! DONT FOLLOW THIS ADVICE!!! DONT OVER-EXPOSE YOURSELF TO SILVER!!! "Silver toxicity causes argyria. Silver toxicity occurs when too much silver is in your body." <- from a simple research on "too much silver in blood"

THE RESULT WILL BE ARGYRIA. EVEN IF YOU DO IT SLOWLY, YOU ARE BUILDING UP A HEAVY METAL IN YOUR BODY. THE GREY SKIN IS NOT PRETTY NOR WITHOUT GRUESOME SIDE SYMPTOMS.

Yall. Anything in excess will fuck up your body, including iron, vitamins, and silver.

To whoever asked Red, I don't know your mind, but I'm sure you'd love to live a happy life with grey skin! You'd love to have a body you're comfortable with and looks rad as hell! But you wouldn't be able to enjoy it if you're deeply sick with ARGYRIA, WHICH IS WHAT RED'S ADVICE WILL GIVE YOU!

.

Ask: "How do I get darker skin without going too dark? I’m pale and burn easily, I just want a color similar to Lin Manuel Miranda" (AGAIN DONT HARASS THIS USER)

Red: [...] "expose yourself to the sun more! As you do this, you'll get tan which will protect you from future burns and make your skin slightly darker, do this enough and you can engineer your skin to be as dark as you want!"

THATS MISINFORMATION! Yes you may tan to get darker (Lin's tone may or may not be achievable to you) but one: it's not permanent unless you're constantly going out; two: SKIN CANCER!!!! DONT OVER-EXPOSE YOURSELF TO THE SUN!!!! USE SUNSCREEN!!

TO ANYONE SEEKING A MUCH DARKER TONE: YOU CAN'T "GO AS DARK AS YOU WANT TO" BY TANNING. Just look at people who have lived their whole lives outdoors like farmers! White people can't tan to black! There's a limit to how tan you may get! Are you seriously gonna risk skin cancer for an impossible thing???

.

Red: "Self amputation is really dangerous! You should learn how to use a tourniquet, that way, you can stop the bleeding! [...]" WHERE ARE YOU GETTING YOUR SOURCES, RED?

If anyone reading this is seriously thinking of amputating themselves, and will not change their minds no matter what, please just have someone immediately drive you to the hospital. I do not support such operation and you can still die or get horribly sick even with your best precautions, but you better receive actual medical attention and stay alive rather than trying to heal it yourself. Because what you'll most likely get from following Red's advice is DEATH FROM BLOOD LOSS. Again, if you absolutely cannot get rid of this dysphoria with therapy, or manage it at least, or have a doctor do it for you, I still would NEVER suggest you do it yourself, but IF you end up doing that then at least please go straight to the hospital instead of trying to heal it yourself.

.

Red: "do not try and break your own bones to make modifications! [...] Get another person (Like myself) to help you with the bone breakage instead."

NO ONE KNOWS WTF THEY'RE DOING. YOUR FRIEND DOESN'T. RED DOESN'T (as they advertised in the post). NO ONE IS GOING TO GET MODIFICATIONS LIKE THIS. NO ONE IS GOING TO BE HAPPY. EVERYONE IS GOING TO BE EITHER IN PAIN, RISK OF HORRIBLE INJURIES OR TROUBLE WITH THE LAW. FUCKING AROUND = GUARANTEED BOTCHED OPERATION.

Also, now that Red has clarified she won't perform surgery until having an actual degree, you can't really go to her XD

.

Red: "Some advice for surgery [...] This one's important, make sure your patient is strapped down and properly sedated, if they move, even slightly, you risk hitting a vital artery or organ, if you do hit an artery, don't panic, this is why you learned how to use a tourniquet! if you hit a vital organ though, odds are you won't know how to fix that, so be extra careful with abdomen and face surgery!"

Thats still promoting medical malpractice, mutilating and potentially killing friends, dangerously downplaying surgery so much, this is not harm-reduction

.

Ask: "I want to be blind in one eye, but more-so in the sense of extreme but not total vision loss. I want to do something permanent in the future!" (AGAIN DONT HARASS THIS USER)

Red: Well, a simple fix to your problem is just get some calcium hydroxide in your eye and wash it out a few minutes later, this should lead to permanent, extreme (but not total) vision loss in that eye. Keep it in too long and it can cause total vision loss so be careful!

Ok so, it's great that you're trying to come up with alternative ways for users not to kill themselves by gouging their eyes out, but you've still failed to give them the full picture

From a quick search "calcium hydroxide in the eyes": Exposure to the skin can produce burns, painful irritation and necrosis, and exposure to the eyes may cause severe pain and vision loss that can be temporary or permanent. If calcium hydroxide is exposed to the skin, contaminated clothing should be removed, excess amounts of the chemical should be wiped off and the affected skin should be flushed repeatedly with water. Victims of calcium hydroxide exposure to the eyes should flush their eyes with water continuously for the first 15 minutes, but all cases of external exposure should receive immediate medical care. Inhaling calcium hydroxide through the nose or mouth can also cause immediate, painful and potentially life-threatening complications. Throat and nasal passages may become painful and swollen, and the swelling may restrict airways, making breathing difficult or impossible. If the calcium hydroxide particles are carried all the way to the lungs, this may further complicate breathing. Victims of this type of exposure should be taken immediately to a fresh air environment, and emergency services should be contacted right away. Administration of oxygen and emergency respiratory assistance may be required.

.

Red (answering an ask): "the question shouldn't be what DO people replace their skin with, it should be what CAN they, after all, just because it's never been practiced or very rarely practiced doesn't mean it's bad or impossible! Of course, my personal favorite skin substitutes are rubber and red velvet, I am also a big fan of stainless steel."

(Don't promote such an operation). THIS OPERATION IS BAD AND IMPOSSIBLE TO SUCCEED. SKIN CAN ONLY BE REPLACED WITH SKIN. SKIN IS A LIVING ORGAN. ANY OTHER SUBSTITUTE WILL CAUSE YOU TO LOSE BODY PARTS OR DIE.

YOU KNOW HOW PEOPLE WITH TRANSPLANTS NEED LIFE-LONG MEDICAL ATTENTION SO THEIR BODY DOESN'T REJECT IT? HOW TF WILL YOU DO THIS WITH FUCKING RED VELVET?

YOU WILL FUCK UP YOUR BODY'S IMMUNE SYSTEM A THOUSAND DIFFERENT WAYS.

ANYWAYS. CROSSTAGGING FOR REACH. PLEASE EVERYONE REBLOG. THIS IS SERIOUS SHIT.

#radqueer #rq community #rq 🌈🍓 #pro rq 🌈🍓 #pro radqueer #transid #transid please interact #transid safe #transabled #transharmful #pro transharmed #pro transid #pro transx #pro transage #pro transabled #radqueer coining #radqueer safe #radqueer please interact #pro radq #rq safe #pro para #pro rq #transid community #transx safe #transid coining #diaracial #pro diarace

[princemick]

TUMBLR F1BLR RULES!!!

hi, hello and welcome, we've seen what's been happening to twitter and we welcome you to our little corner.

there are however some things that differ from Twitter to Tumblr and so we have some different rules and behaviour then you might be used to!! I'm gonna try to explain them to you in this post! everything is below the tab!

reblog reblog reblog!!! likes do absolutely nothing, and your blog 'aestetic' in reblogs doesn't really matter unless you're a specific aesthetic blog, reblog are the way people see the content. likes are private! so remember to reblog the stuff you see and like!

DO NOT STEAL GIFS/GRAPHICS I WILL COME AFTER YOU!!! always ask if you can use a gif an then ALWAYS CREDIT properly

shipping is, prevalent. shipping even rpf is ingrained into tumblrs culture on every side of it if you dont like it thats a you thing, you can 'blacklist' tags so just add 'rpf' or the shipnames to them and you should be good!

continuing with that idea, curate your own experience is the most important thing on this site, blocking and blacklisting is normal and very much allowed and welcomed. almost no one is going to change how they do or act around here for one person, just unfollow or blacklist.

but do NOT put long posts or x reader fics, anything in the main tag without putting it under a 'read more' tab people will get annoyed by you

followers dont matter!!! no one CARESSS about basically anything this site is wonderfully anonymous and we can't see how many followers anyone has so genuinely no one gives a shit do whatever you want

remember to trigger tag and unlike twitter spell it out completely! so when a crash happens or is talked about make sure to tag it 'tw crash' even with reblogs!! also remember to tag when you're being negative about a driver as 'anti *insert first name*' never do full name then it will show up in their tags which defeats the purpose of anti tagging.

adding to that, use tags! they're one of the best tumblr features its free to be overenthusiastic and excited in the tags BUT the blog you can reblog it from AND the op can also read those tags so keep that in mind!!

be nice! this shud be a given, be nice, let people do their thing and vibe, just support people and block when u you dont vibe with them! when you do wanna send hate asks do it off anon, dont be shy do it on main

and things arnt 'weird' in the same way they are on twitter, this place has no drivers and no public figures so shame is a lot less existent here, you have to get used to that

and lastly as quoted by my anon 'Don't be afraid to be funny or weird be thirsty on main ship the middle aged man no one cares.'

and most of all. HAVE FUN!!! dont be scared to ask people how things work most of us are very okay with answering 'dumb' questions a lot of us have been here for about a decade we know its a confusing platform please ask away!

#kyle.txt #f1 #formula 1 #f1blr

[rouge-heichou]

Hello Tumblr people!

As I've said on my new blog, I'm retiring from Tumblr. However, I still have a bunch of prints and charms in storage that probably won't see the light of day again. As my Etsy Store has been pretty MIA ever since Crunchyroll struck me. And I'm also not feeling like putting it all back up again.

I don't want neither the prints nor the charms to just rot away and collect dust or just throw them away, there's too much effort that went into them.

so I thought I'd just hand them out.

the idea I had was, packing up some prints, like a random 5-6 of all I have, pack them up and send them to anyone who wants some.

Same goes for Charms, although, it'll be a little less random here, as my evelopes only hold max 2 of them, as well as the Dabi ones being nearly sold out. So heads up for that, it's probably gonna be either Toga or Hawks.

All I ask is for you to cover the shipping. (If you wanna add a little tip or whatever, go for it, but it's not required.)

Shipping Internationally is USD 7.88 (with tracking) Shipping within Germany is EUR 2.70 or EUR 3.95 with tracking added. Edit: Shipping Internationally is USD 4.03 (with tracking) Shipping within Germany is EUR 1.60 with basic tracking or 2.70 with basic tracking + prio.

Payment is either via Ko-Fi or Paypal https://ko-fi.com/rougeheichou Paypal: [email protected]

Obviously I'd need your names and addresses, so if you decide to go via Ko-Fi please make sure to tick the "private message" box when you enter your Info in the message box. An Email Address would be good too so I can notify you when I send the stuff out.

Here's some pictures under the cut:

ps; yes the manifacturer put Toga on the wrong backing card, but I have plenty to put her into the right ones lol.

#pwyw #psa #reblogs are appreciated despite my dead blog #thank you loves