#its almost a good thing i dont go out much rn bc i dont think i can get away with wearing shortsđ
...
5 notes
·
View notes
Headcanons for sukuna as a volleyball player - idk if i wanted this to be set during highschool or not so i guess it'll be kinda generic or all over the place haha,, dedicated to @luvkun4 my love, who likes haikyuu and sukuna so its a perfect combo for her
warnings; NSFW, throat fucking, rough and angry sex, degradation, femme reader, youre kinda his pocket pu$$y but also his sweet gf, minor angst but with happy end -- this wouldve been a good fic but i dont have the energy for a fully written fic nowadays, im alr working on a billion rn
edit; THIS ENDED UP BEING SO LENGTHYY sorry, i wanted to add in the drama
right.. idk from where i should unpack this
we all know... sukuna would be competitive as fuck.
i know for a fact that he hates losing so much
which is what makes him such a good player tbh, the balls not gonna touch the ground as long as hes around
heâs a wing spiker, and definitely the ace (cough, totally not inspired by this gorgeous fanart)
hes so mean and arrogant but is willing to demonstrate teamwork in order to win and so theres obvious respect between him and his teammates
uraume is the manager, tho its clear that they favour sukuna the most pff
sukunas such a powerful player, no one can beat him one on one and hes so sexy when hes playing seriously
volleyball sukuna and his fuckin horse cock, u bet u wanna get wrecked by his shii
problem is, i cant find a creative way of how yall first metÂ
idk, probably through mutual friends, out in a big group at a restaurant ?? maybe you hooked up with him afterwards and you both caught feelings for each other
yeah something along those lines
anyway ofc seggs after matches are a regular thing haha
its almost an expectation that you come to see his games now
here comes the smut smut smut
vb sukuna would totally drag you into the unisex bathrooms so you can âhelp him relaxâ right before the game starts...
nothing like cumming down your throat to get him all warmed up
and youre such a whore for him, you can never say no bc YOU DONT WANT TOOO <3
even tho you make a fuss about the icky floor pfft, he grunts and lays a bunch of toilet paper for u to kneel on, what a gentleman
his soft groans as he lodges his thick cock into your warm mouth, and then pushing your head down to go even deeper
the pleasures just too great, the thrilling mixture of being in a public toilet right before a big match, fucking your tight throat raw
and your teary eyes, fluttering your lashes up at him with a mouthful of dick, he could laugh from how adorable you look
after hes done spurting stringy thick ropes of his seed down your esophagus hes just:Â âthanks babe... you sucked the nerves right outta me.â
and you know its bullshit bc hes smirking in that sarcastic way, and its a fact that sukuna doesnt know what it feels to be nervous!!!
lucky for you, he treats you better than anyone else - he wipes your mouth and kisses you before parting ways with you
likes to give you another smirk once he finds you amongst the audience
its crazy how much energy he still has after games
on the rare occasions when his team loses... oh boy
100% takes his frustration out using sex
just thinking abt the simmering anger...practically throws you onto his bed
pins your body down and slamming into you with his whole body weight
ruins you so bad, bruises and bites literally everywhere
but like... youâre into that shit
butterflies in stomach whenever the other team ends up winning
âugh...fuckinâ squeezing me like that... you donât want me to stop, do you?â
âmaybe you like it when i lose a game. what a whore.â
âsukuna...sukuna, too bi-big..â
âoh? and youâd think this cunt would be pretty used to it by now,â he responds cockily. it turns you on when he uses such vulgar language.
spills so many loads into you, youre like a cream filled donut by the end
spanks you too, handprints on your ass and all - omg imagine the strength as a vb player
the aftercare is nice, usually he brings you to the bath immediately and check you out if you need ointment applied to your skin or vice versa
but it wouldnt be surprising if he got lazy with it on some days, especially after an exhausting game, having sex on top of that is gotta be tough
also he spends a lot of time training and practicing, which adds to your loneliness
sometimes you overthink it and feel like youre just being used, but instead of communicating it, you just act more sensitively around him
and vb sukuna sucks at picking up the small cues, so he just thinks youre being unreasonable
the two of you get into a pretty heated argument which ends with you storming off one time
theres a bit of silent treatment going on, but then afterwards you start talking with him ânormallyâ again
theres an obvious distance growing between you and him, and your attitude is colder than it used to be. sukuna thinks its something thatll pass sooner or later
but then you text him, saying that you wont be able to come and see his game
thats not right. hes had a few fights with you before, but youâve never skipped out on coming to watch him like this, ever.
but being a prideful tsundere he is, he just replies with a âdo whatever you wantâ before chucking his phone off to the side (which he checks later again, to see if you said anything more after that. you didnt.)
on the day of the match, hes constantly checking the crowd if youre there
its not like *glance* he cares *glance* about you coming *glance* or anything *glance*
his mates raise eyebrows and tell him to focus properly and hes never looked scarier lmao
they won in the end, but the taste of victory isnt the same
the group wants to celebrate and go to some restaurant to eat but he skips out and goes home alone
and when he opens his door to an empty and dark living room, he cant shake off the feeling of uneasiness in the pit of his stomach
totally doesnt google search âsigns of an incoming breakupâ
feels worse afterwards
eats a nice and nutritious meal he cooked for himself, but it tastes kinda like cardboard
i said previously that sukuna doesnt know what feeling nervous is, but now he does, hes terrified youre gonna pull the breakup card on him, he wont know how to deal with that
he has a feeling that if he doesnt do something about this now, he will lose his chance forever
sukuna calls you but you dont pick up
he finds his way to your front door and rings the bell, and you call out from the other side asking him what he wants from you
âwhy didnt you pick up any of my calls? i want to talk.â
he hates how whiny he sounds.
you crack open the door ever so slightly, so only one of your eyes are visible to him
âabout what?â
âabout... this. about us.â
â...youâve been crying. let me in.â
he gently pushes open your door and you stand out of the way, letting him
...and he starts with an apology. about saying mean things to you during the argument, about acting like he doesnt care when he does (he cares so much abt you that it drives him mad), pretending not to notice how upset you were
you watch him sternly, but end up bursting into tears bc youre so relieved he came out and admitted to his faults, and that theres hope for this relationship
youre bawling as he pulls you into his arms, and you confess that not going to see him and treating him coldly was the hardest thing youve ever done in your life
sukunas so relieved you still feel deeply for him, and simultaneously upset bc youre upset
you reveal that youve been feeling neglected, feeling like he only liked you for your body, and you too, apologise for not communicating that and acting sensitively instead
hes appalled, calls you an idiot but then retracts that statement and denies ever having thought in that way
the two of you snuggle up so close together in your bed, communicating and chatting and catching up for hours while he occasionally eyes the mountain of used tear-filled tissues in your room, rather concerned
for a while, he doesnt initiate sexual activity unless you specifically want it bc he wants to prove he likes spending quality time with you just as much <3
and when sex does eventually happen, he makes it very romantic and meaningful, with proper aftercare, continuously whispering âi love you,â throughout
and he shall do anything to have you keep loving him back.
some general stuff with vb sukuna:
mad tall. i wont give an exact number but anywhere between 195 - 200cm tall :>
mad horny. hes like an animal
hes such a big eater,, i mean, i see sukuna as a big eater in any au but this one in particular bc hes an athlete haha
u probably make protein shakes for him and stuff, but hes not rly on a strict diet or anything, he just eats anything and everything
has a lotta fangirls >:( but he ignores them now, after he met you >:) but before, he probably played around a lot and hooked up with some >:( he never liked any of them to stick around, tho >:) except you >:)
goes on morning runs, at like 6am and gives u a kiss on the cheek beforehand
is so fucking touchy clingy, always needs you on his lap, hands under your skirt or shirt
the last guy who tried to hit on you got a nosebleed, getting hit with a volleyball (its so funny, he changed his aim mid-spike during a practice match)
haha he was sent to the bench for that one (everyone was chuckling behind their hands)
the headband was given to him by you, bc he once complained abt having to gel his hair every morning + gel doesnt keep his hair in shape when hes sweating excessively
thats all for today <3 thanks for reading
Masterlist
tagging; @yuujispinkhair @moonchild-artemisdaughter @skunaskitten
799 notes
·
View notes
an mc with echolalia repeating noises/words/phrases the demon bros say (especially things in demonic language) and some of them getting Annoyed thinking its you mocking them and challenging them (lucifer, satan) or that ur making fun of them in a demeaning way (levi, mammon) and the general confusion and possible angst from hurt feels bc they dont know this is just a Thing some humans do. i think solomon would get caught in a loop with mc tho especially during nightbringer era like sol makes a Noise, mc repeats it, they go back and forth bc sol thinks its cute n understands the stimming nature it can have and everyone else is just '???? did the humans break???'
sorry if this doesnt make much sense its 3 am for me but i saw the ask abt demons not rly understanding humans and was like. lets take it up a notch with autistic (and other neurodivergent) traits and behaviors. bewilder those bitches some more. also i love ur writing its so good thank you for all youve blessed us with <3
AutismCore me me me me me relatable i love this ask sm i am stimming rN
pls send in a req for the others! if i do all in 1 post itll be soo long (also if u want a longer one send in 1 character and we can get some real angst in here)
Lucifer is one who doesn't mind very much. He's used to the Anti-Lucifer-League mocking almost everything he says, so there's not surprises there. However one evening at the dinner table, he it comes along in passing.
"Yes, I've never quite understood if you enjoy my presence or not, as you seem to mock me so often, MC."
"Wait, what are you talking about?"
"I heard you the other evening, you were speaking of what I had said to you, repeatedly. If I recall, it was, 'Don't dally with the dragons, MC'," he smiles at you, but there seems to be a little aggression behind it.
"Oh no, that's not mocking, Luci, it's called echolalia! It's a symptom of my autism." You go on to explain, and it seems like a small wave of relief washes over his eyes.
"Very well. I'm glad we got that misunderstanding cleared up."
The one who avoids you is Mammon, he's only now been caught up to by you, as you sit into the chair next to him at dinner. It's mostly quiet, until everyone has left, besides you him, and Leviathan and Beel, who are having this own conversation. You speak quietly, "have you been avoiding me, Mammon?"
"Why'd ya think that? Maybe it's you avoiding me!"
"Well, I haven't seen you almost at all in 4 days. Everytime I see you, you turn the other way. You feel the sting of fresh tears start to burn in your eyes, and Mammon can't help but feel a little guilty.
"Why'd ya even want to be around me, I heard you mocking me. You were sayin' 'mammoney' over and over."
"No, Mammon, that's not it at all!" You furrow your brow, and more tears start to come forward. This is not the first time you have been misunderstood by someone about your symptoms. You go on to explain, practically pleading with him to believe you.
"So it's just somethin' some humans do? Really? I think Levi does that sometimes," he chuckles, a small blush gracing his features.
The one who is most hurt by the misunderstanding is Leviathan. For sure. He heard you saying "Ruri-chan" over and over to yourself and assumed you were making fun of him. He hid away from you for days until you caught up to him, and asked if he'd been avoiding you. You missed your best friend dearly. "Of course I have! I heard you mocking me! I thought we were friends." His frown was evident, and you had to pry to find out what he was talking about. "Leviathan, what in the world are you talking about?"
"I heard you! You said," in his best mimicking voice he could muster, "Ruri-chan, over and over."
You were quick to stop him, trying your best to explain. He was still hurt, but he did feel a little silly.
"Oh, I guess that makes sense. I do that too sometimes, repeat things when they're f-fun to say, I mean," he seems to trail off, averting his gaze. His anger had not dissipated, and he felt silly for ever being mad.
"I-I'm, I'm sorry for misunderstanding you, MC."
102 notes
·
View notes
âdating dean winchester | dean winchester x fem!reader headcanons
!!!: my work is not to be reused without credit/permission!
request rules
warnings: nsfw & mentions of drugs! minors dni! fluff & not edited
authors note: im really obsessed with him rnđ«Ł requests are open!
he is so desperate for your love & attention that its kinda concerning. he never got love growing up or has been involved romantically with anyone for long & he is used to one night stands that dont go anywhere. so its very refreshing to him to have someone being as equally in love with him as he is w u
he is very hesitant to talk about his feelings & past to everyone, including to those he loves. but you really get him to open up to you about those things. which is really good for him bc he learns that his dad was a shit father & he finally gets to know what real love is. & what it actually feels like to have someone be concerned & care for him. & he knows that he doesnt have to hide anything from you bc you wont judge him or think of him any differntly
when sleeping next to him, he finds it very hard to let you go from his grip. hes very touch starved & craves any touch he can get from u. whether it's spooning you, putting his hand on ur thigh, or just holding ur hand
he is a very conflicted person. almost in every episode he thinks something is wrong w him bc he "enjoys" killing. but it really is bc hes pushed aside every emotion he has ever felt & doesnt deal with them. him being with someone who is willing to listen to his vulnerabilities really helps him figure himself out
he is a VERY loyal person & boyfriend.
he likes to give gifts & is very close to being ur sugar daddy from how much money & gifts he gives u bc he thinks that the only way to keep u around is to give u everything u could ever dream of. which is very unhealthy thinking on his part
he needs CONSTANT reassurance. he needs to know that you will never leave him for someone better. believe it or not but hes pretty insecure. hes not insecure of his abilities in bed or looks but insecure of his lifestyle
he gets you little souvenirs from every state he visits! & now u have a whole bookshelf of knickknacks
type of person to tell u that he loves u within a week of dating. im half joking but he falls for people very easily
hes pretty controlling & protective of u, he just doesnt want you to get hurt. he will not let you go hunting with him, anyone, or alone. he needs you to be safe at all times. which yes, is understandable but you have to tell him that its toxic when it gets to the point hes too nervous about you leaving the bunker, your house, motel, anything really. & there's probably a tracking device in ur bra
he never smoked marijuana or says he does in the show. but everytime he sees a bong hes gets weirdly excited so i think hes a pot smoker. which is nice! bc hes very good at getting you strains of marijuana that r good for u & fit ur needs. he rolls ur blunts/joints for u!! & he even lights them for u as well! smoking weed is a huge part of his aftercare for u as well bc it helps to calm u down
he is very casually dominant! he orders for u, ties ur shoelaces for u, takes away ur soda if uve had too much, denies chocolate from u if u have too much cause he needs u to be healthy for him & eat right. he turns off the tv at the same time every night & makes u go to bed. he doesnt like it when u cuss & gets on to u everytime that u do cuss. he likes to pick out ur outfits as well. he also doesnt let u drink due to the fact his father was an alcoholic
he teaches u how to play pool & poker!! & even takes you out shooting every once in awhile!
he has the BIGGEST innocence kink known to man. he literally loves taking virginites
he literally has an angel kink. theres nothing that screams innocence/corruption kink more than that
he likes to dress you up as an angel too!! white lace lingerie & it would get him going more if he could get you to wear a halo headband!
his literal petname for u is, 'angel.' inside & outside of the bedroom. youre just so sweet & precious, how could he not call u angel??
literally just wants to corrupt u everytime he has sex w u. taking your innocence or making you look innocent while doing a not so innocent activity
a lot of people think hes a switch but i dont think so tbh. he literally has no control in his real life which would make him more likely to want control in the bedroom. not saying he tops everytime but theres no chance i can see him giving up his domination/control
but what i do know for sure is that this man is a FREAK
his list of kinks is longer than the amendments on the bill of rights
breath play, bondage, knife/gun play, impact play, corruption/innocence kink, praise/degradation kink, literally anything if youre down
i mean. he is horny 24/7 so it is for certain that he would try anything once or do anything sexually w u as long as u liked it
he LOVES to praise u! youre his 'pretty baby' or 'good girl' but he also LOVES to get praised too. he needs to know how good he is doing
but there are times that hes very degrading, usually when he has had a bad day. because u can be his 'good girl' one day & the next youre his 'dirty slut'
he is also a brat tamer! if your acting too bratty he will bend u over his knee
dean winchester masterlist
masterlist
461 notes
·
View notes
Hi!! Could I request dazai with a weird person? (Ik it's not the term, maybe artistic, maybe something else, weird is the only global term which isn't that wrong). Basically they're extremely drawn by art, notice the most niche and least noticeable things and 'it makes sense in my head sorry' is their daily sentence which leads them to feel alone and not understood. Like this with dazai would be interesting I think (like the dynamic, i cant go on bc its starting to get so long but the whole 'dont feel like a proper human being too' ahhh i cant put the right words). There again- I'm sorry it makes sense for me-
Anyway have a good day and sorry <33
A/n: Hello Anon!! Of course I can do that!! I am working on multiple requests at once, kinda overworking myself with studies and work and on top of that I have finals soon and I should study a bit more.. ANYWAYS I related to this a little too much so I think I know what you mean by âweird person that canât really describe what they thinkâ kinda stuff. But this isnât about me so I HOPE YOU ENJOYYY
Warnings: to lazy to read over this rn so not proof read at all.. ALSO INSPIRED BY âno longer humanâ by osamu Dazai lol?? Donât know why but here we are :) reader doesnât have a gender aswell, so GN reader
Dazai x Misunderstood! Reader
You couldnât quite remember how you got to the art gallery with Dazai, but here you stood Infront of an magnificent piece of art. You could see how old it was by the cracks and discoloration, yet the way it was drawn, with such delicacy was as if it was drawn only a few minutes ago to you. The emotions and thought behind it, still visible to your eye. The way the eyes of that women were slightly casted down, the dark colored theme, the way the posture was drawn, everything seemed so right.
That was something everyone could see, yet even the way the clothes hung from her body made an important difference to the picture âCan you see her naked shoulder and the robe that almost seems to be put on lazily?â you had begun your sentence, âit resembles her innocence and purity, no men could ever touch her..â your voice got a little dreamier on the end. It took you some seconds to notice thatâs Dazai didnât respond. You immediately got embarrassed âit made sense in my head.. sorryâ
You looked to your feet, cursing yourself out for saying such stupid things to him as if he could understand what you were thinking⊠if he could ever understand how you felt when the art practically screamed for you to tell its story, because you knew no one else could quite think like you. No one could. You were alone in this world that seemed to abandon you. Reject you from society as if you werenât a human being. As if, the moment you shared a piece of your mind, you were no longer human..
You snapped out of your thoughts as you felt a soft hand on your shoulder âYea, but also look at her hips, the way her robe curves there.â he pointed subtly to were he meant, âshe also seems tense, as if to say that she knew what the men around think of her.â impressed you looked up to the tall brunette âYou saw that?â in response, Dazai only chuckled âOf course, you are not the only one that has a unique way to see and think.â his hand gently squeezing your shoulder
âYou are not alone. Not everyone might understand what you are trying to say, but I promise you there are always a hand full of people that do. Donât push yourself down, see the ups of having a unique way to think, even if you canât voice it.â he shot you a cheerful smile and for the first time, you felt accepted. Accepted in this so shallow society you always had claimed not to be a part of.
102 notes
·
View notes
i was going to type out a huge post about the stage since i snuck in one last full watch before it went away but tumblr killed my post as i was making it and i donât feel like making another one lol
so new encounter thoughts: clifnotes version!!!!! itâs fitting bc thatâs what this stage was anyway lol
i enjoyed myself!!!!! i wasnât disappointed by any performances, tho since i was ride or die for akira ichiro and ayukawa jakurai, i felt those losses keenly lol. i was also surprised how much i felt like i was missing aramaki sasara watching this play lol. there were some changes to the origin stories, ofc lol, but the stage has always had superior bb takes so i really appreciate them changing ichiroâs more shallow dismissal of his bros in canon to him being scared for them after what happened with samatoki and chuuoku. itâs his biggest conflict in these battles so i appreciate them making it a primary focus
i read a tweet from a fan idk who they originally stanned but said they were considering becoming a hama lady after the stage and abso-fcking-lutely LOL uehara-san is incredible as samatoki, yuki-san can also inspire the masses with his looks and dancing and flow and tho stage rio didnât have much presence in the play, him opening his heart to samatoki thru their battle and then teaming up with the both of them after fighting together is a great slight change to their origin story
*slams thru the wall like the kool aid man* AND THE NEW BAT HAIYUU ARE ACTUALLY MAGNIFICENT like backwards order since i have Things to say about nakanishi kuukou lol but nakatsuka-sanâs hitoya is very cool!!!! his voice envokes almost the same amount of hype takeuchi-sanâs voice does for me, like itâs deep and rough when heâs going and itâs sooooooo good. stage hitoya in the legends era cared for jyushi certainly, but i donât think he flat out babied jyushi as much as he did in new encounter like my god lmao. it might be more indicative of the difference between actorâs personalities lol and i suppose hitoya did try to get kuukou to lighten up on jyushi when they first got started. also, there was this look he gave kuukou when kuukou started to goad him into being on his team that exuded cool charisma i think nakatsuka-san might be another actor too cool for hitoya LOL
i didnât think it was possible for a jyushi to be even more baby than daigo-sanâs but goddamn i think sakayori-san managed it LOL and again i do think some of that is bc of the source material they were adapting. i saw reports that new encounter jyushi was kinda spoiled by his team and i could see the undercurrents of that in the way kuukou would pat his back when getting up or the way jyushi would lean into hitoya and hitoya would actually wrap an arm around him lol. but iâm not complaining ITS CUTE. sakayori-sanâs silhouette is so crazy like his build i think is exactly the way i envisioned jyushiâs so i kept vibrating out of my seat whenever he did a flourish and i got to see his figure lmao. i saw a report commenting that he needed to work on his vkei mode voice bc it was hard to differentiate and maybe???? idk i could tell the difference just fine, even if his voices donât have as much of a gap as sakakihara-san or daigo-sanâs
i want to throw up out of excitement thinking about nakanishi kuukou which is how i know heâs officially part of the kuukou brainrot LOL heâs kuukou!!!!!! he is so purely kuukou that everything i feel about kuukou is pushed onto him and i feel like i should apologise rn bc that comes with a heaping dose of objectification!!!!!! but itâs chill!!!!!!! *kicks down a wall* HES GOT MUSCLE ON HIS TINY FRAME!!!!!!!!!!!! like when he gets going going, that jacket starts slipping off and the camera caught just the right angle and lighting to show the contours on his arm muscles and i started yelling!!!!!!!!!!!!!!!! thick neck thick calves thick arms HES BUFF!!!!!!! BLESS NAKANISHI-SAN!!!!! and thankfully itâs not for the aesthetic like heâs athletic asf too with jump kicks backflips air somersaults and the like. he is probably the best person to have gotten the role after someone like hirono-san, whose kuukou has shaped the character so thoroughly that even in this new stage, direction choices were made to preserve the hype his kuukou envokes. if the writing on nakanishi kuukou stays the course, itâd honestly be a bonus to have that extra hype kuukou lol. and on that note
I DONT HATE STAGE KUUKOU WRITING LOLđđđ
now itâs just an origin story so thereâs plenty of time for shit to go awry but rn iâm feeling massively satisfied lol. there were some lines that were raising my hackles but frfr??? thatâs just me being sensitive after all these years lol itâs fine. no nod to kuukouâs history with ichiro but tbh i donât come to the stage for that lol but it made me think of the complaint that nagosakaâs get together story felt rushed compared to the other divisions. and they were lol but iâm not sure if thatâs the stageâs fault or the source material. on batâs side, bc they formed nagosaka alongside the og teams in the stage, ramudaâs development thru bat got axed in favour of jyushi falling for reiâs scam that brought dh together. itâs a choice that further isolates nagosaka so while within the stage narrative it makes sense (does jyushiâs character a disservice tho), it kinda annoys me thinking about the long term lol but itâs probably not going to matter in the long term either so ultimately itâs fine. i guess. maybe lol
one last nakanishi-san ramble and iâm done lol but that fanservice part really showed off his charm lol like when he rolled up on some fans arms spread wide and demanding their ears and attention!!!!!! đ«đ«đ«đ«đđđđ and as he was heading back on stage, there was a lone bat fan along that aisle so he paused and leeeeeeeeaned back into that backtrack and flashed the bat hand sign at her and i couldnât stop my unholy noises even if i tried heâs so cute omfg help heâs adorable like actually đđđđđđđđđđđđđđđđ
8 notes
·
View notes
silly question but: does wolf alĂk look any different from a regular wolf? when she's fully transformed, is there anything that sets her apart, or does she just look like an average, straight up wolf?
ty for asking this actually!!! i think about this a bunch, like, what human traits alĂk keeps, if she can bark/howl, if a pack of wolves would accept her, etc !!! ill talk about this under cut bc its like . idk? im not sure if this is body horror ? like its not just her being a wolf , its her being a messed up wolf .. uncanny wolf up ahead!! + some blood but not that much.. also warning ur getting a much longer answer than you were probs asking for lol
so i made a little image getting into details about her mutation just now, But i do first want to show off this art that my friend blazy (@/mothssmeat - go check his art out its super swag!!!) made of her for artfight last year !! He Gets Her he gets her wolfness he gets it
check out the speedpaint !! blazy's sooo niceys for drawing such an awesome alĂk art ... its So good . do you see how her nose is turning into one of a wolf? but so painfully ?? so slowly that its just !! how shes tearing up, blood around her ?? god . like God. oh my goddd . and her fur !! how its growing in patches around her body, starting like wild from her head, her eyebrows combined, just like !! its growing around like mold and i find that really cool .. hehe sorry just had to fangirl about this art ofher . i dont get the chance oftne . anyway. in a more professional manner: god sorry i cant yet . oh my fucking goddd . oh my GOD !!!! just look at that . what is that thing!!! dear god!!! ok. im normal now (lying ).
look at her hands and feet. human joints should not be like that, and wolf paws do not look like that. her claws.. god just look at them. blazys art explains alĂks messed up wolf situation far better than i ever could. her ears, too, are just... god, look at them!! i have to move on from this art or ill just keep saying "look at it!!" but, well. Look at it.
some of my own alĂk wolf art:) the first one is when shes fully transformed, but also the first ever art i did of her like that, so take it with a grain of salt, but still take it. the second is her like... in her metamorphisis era - my internet connection is kinda MEAN and EVIL right now so i can't add them rn .. ill either rb with them later or edit them into the post. for now i just put links to the images :( sorry! plus the mentioned image from before. now Onto serious business
something that alĂk always has, no matter form, is her human eyes - but they're not really human! their colouration is one of a wolf's, and her eyesight is also almost as good as that of one. this is messed up when she's in full wolf mode, because its really.. just, weird. can you imagine looking at a dog with human eyes? a cat? a cow? no!! because its weird!!!! shes a FREAK!! (affectionate)
another weirdo thing about her face is her teeth. hes got canine teeth, no doubt about it, but i do think she has a bit more teeth than she should have.. maybe three more... ? two more? i think the amount of teeth is not equivalent with neither the amount humans should have nor the amount wolves should have.. like 38 or smth. this doesn't change in her transformation, but her jaw and gums do! it hurts! Ouchies! it also shifts her teeth around.. tbh i wouldnt be surprised if she lost a tooth or two transforming sometime.
as you may have noticed, alĂk has most of her fur on her head! this is because of hair! she has a big ol' tuft of fur on her head when she's in wolf mode and it makes her look silly. depending on how far along in transition they are, their fur is like... its in blotches over their body. a tuft here, a tuft there, no fur at all someplace else... her spine gets covered in fur first. bc its like !! hair to tail:)
her limbs are weird, too. her arms are more humanoid than her legs - my friend mikey @/monstertsunami shows this wonderfully in his art of alĂk and their gf idk who she is i heard shes some kind of loser? ermmm what the freakđ„
oh wow it let me add an image that time Awesome!!! anyway, you can see how her feet are pretty pawsome, huh?? shes got pawpads - is that what its called for wolves? i cant find info :( - and her joints are more.. like, look at how she's standing! her ankles! everybody say thank you mikey... !!! this stays in her wolf form, in a way
in the 'mentioned image' from before, you can see - ifyou can read my handwriting lol - that there's text around her feet/paws (peets...) that says 'human hands - fucked up paws'. in the linked image 'first one' , you can see her fucked up wolf hands more clearly! thats something that ive kept. i think she could grab you, even as a wolf. she keeps her thumbs. even if they dont work as well. this makes running as a wolf difficult for her, because her fingers are very much in the way !! herr back feet are more wolf-like in her wolf mode, even twisting her hips to work better !! opposite goes for her hands, though - her arms, like.. theyre not good for wolves ! her elbow is forced into a shitty position, her shoulders are.. bad...
and, as mentioned, her nose is fucked up. the smell of blood is an intimate friend of hers đ„it like.. god, her face goes through So Much. her skull gets absolutely , like ... goddd shes definetely broken bones transforming before... her nose is like, stretched out ? idk how to explain it .. its like if you used the 'free transform' tool on it
in short, id say theres a few main things that set alĂk apart from a regular wolf:
human eyes
human hands (sometimes covered in fur)
teeth
body isn't always fully covered in fur (its not easy for his body to bust out ten thousand fur strands all over his body, ya know? needs resources for that to happen)
movement (can't run as well, vocal cords arent probs in the best state after her neck fucking... look at it)
smell. she smells weird. oyou dont care about that but wolves would i think
then there's like, little basic anatomy stuff, like she will Never have the proper body of a wolf . maybe if she was like, for a year as a wolf, or two, or maybe even fine her body would be like Ok were wolf now . and her bones would settle ... but this is a question of years and time she does not have. her lifespan is also all kinds of fucked up. if she wasnt being experimented on evey day of her life ever, she'd probs live until her 40s? maybe late 40s if she had a HEALTHY LIFESTYLE filled with JOY and WHIMSY!!!! but i think now she'll die like, in her pafl au, i dont think she'll make it to 35.. sad! ouppy gone
also im working on an alĂk thing .. + the other two .. but also alĂk
CANINE GIRL coming to YOUR THEATRES in SOON!!!! hehe... im not making a song thats like too much for me. i can only make music that soundgs good to me idk how to make music that others would find tolerable .. my blessing .. teehee .. ill make alĂk like, a page, like the tptm girls have .. nina and nastya too:) nastyas mockup page is done.. but im not showing!!! you get a sneakpeak of the text tho . ty for the ask â€ïžim surprised its letting me add images now . wifis been weird all day .. u also get to see a wip of her display sona
idk what her name would be . superlative girl ? unrivalled ? irrelevant ? victorious ? precious ? vote in the comments down below!!!Ninas will be some shit like. unknown girl. apathy girl. etc ... i havent gotten to alĂks display sona yet but you KNOW shes ouppy!!!!
okieeeâŒïžâŒïžâŒïžthats it . hope ur ok with me sharing the tptm stuff .... â€ïžâ€ïžđ„đ„đ„ty again for the ask !!!
5 notes
·
View notes
iâve stanned svt for a while and i just wanted to build on what the other anon said ^^
i highly doubt any of them will leave!! theyâve said many times in the past esp seungcheol that the members are more important than the company. if one of them was to leave i imagine all of them would follow.
unfortunately pledis is really fucking useless đ they almost never handle things well and within the industry most companies only care about what kfans have to say. majority of ppl getting on joshua for possibly dating someone are kfans and no matter how much we ask them to protect the boys better if itâs not kfans asking for it then they just wonât do anything :/ but joshuaâs situation rn is not comparable at ALL to the shit lucas did - shua hasnât done anything lmfao.
as for the hao/hoshi/dk thing.. ah itâs hard, but out of context or not, i donât think that acknowledging that what they said was wrong or understanding why a lot of people were upset makes you a bad fan or them bad people etc etc. you can love people and still criticise and disagree with them. as cliche as it sounds, theyâre human too and they wonât be perfect all of the time. itâs good to remember that, and that goes for any group or person you stan.
sorry for this rant.. tldr: the guys love each other, no one is leaving anyone; do not worry! focus on the present. i understand the worry, but constantly thinking about the possibilities of everything that could happen is just so draining imo. iâm gonna go now LOL. much love đ«¶
i completely agree with u! pledis is fucking useless i knew this before even getting into svt bc my older carat friends would tell me đ and yeah i absolutely dont see any of them leaving. theyre the literal definition of found family i dont think theyd ever wanna continue if even a single member had to leave.
pledis rlly only cares for kcarats. maybe for jcarats too since they bring in the most revenue to them. and since they dont seem to care for the shua situation i doubt pledis or hybe will ever do anything :/
i also agree abt the dk minghao hoshi thing. it was very disappointing to see as it happened but sadly thats just to be expected from idols :/ but as u said its still completely understandable for people to be hurt and angry at their actions.
thank u for coming in to give ur two cents anon ily <3
7 notes
·
View notes
hi from one OC creator mutual to another i just wanna say i have been seeing all your OCs whenever you post them and your dedication to making full body refs of so many little guys just floors me. like i may not fully know whats going on there (though id like to) but your art and dedication to it is amazing. i just thought id say so bc ive thought so for a while i just dont know how to say shit like this without sounding weird LOL. anyway tldr you have such an incredible drive to create and its awsome and i love your OCs never stop posting okbye
HI OMG sorry im replying late i got kind of busy for a sec there, but i love this ask to much its so sweet <3 i promise you dont sound weird at all!!!
i really appreciate the encouragement too! making a lot of full body refs is taxing but its also like. a passion project kind of so i cant not! even though im really excited to almost be done w it (im working on commissions rn though so its on a bit of a pause for now!)
ive seen you talk about your ocs too!! i saw your tags on my post from a couple days ago and read through them :D you have a really cool concept and like, OCs meant for games are sooo interesting to me bc idrk much about #gaming so i have no idea how to create a story for one really! so it similarly floors me when people are able to do that. its like a different skillset for mentally planning the narrative i think, and on top of that is how the games themselves would work... it seems like a lot of thought and planning and its really awesome to me!
id also like to know more about your OCs too :) whenever you wanna talk about them my dms and askbox are open! discord too! i'm finn_again. i like hearing about OC stuff and obvs if you wanna know stuff too that also rocks bc i love sharing lol
but again tysm for the motivation! if i can help it i will never stop posting and keep drawing them :) i hope that once im done w the "drawing all the refs" project i can pop out some more misc stuff, like alt outfits or au concepts or even comics (funny or serious) and maybe that way people will also be more interested than just introduction/reference posts đ
for both of us though, i hope we get to share our stories with the world for real. like you said in the tags of that other post, these things are like our babies. and i wanna see them grow up strong and have them leave the nest for others to enjoy hehe. seriously, good luck with everything bc im always cheering on other ppl who have passion projects like this, they mean everything in a way thats hard to describe! so! i believe in you and wish you the best!!!!
12 notes
·
View notes
okay, replying to the long anon message this way so i can put it under the cut for spoilers :)
if it wasn't for fanfics of acotar i would have dropped it in acowar tbh, there were too many inconsistencies with the plot and characters and so many things that happened so the story moved forward but had no reason to happen, like it was out of nowhere and she prioritized romance over plot more and more each book and then prioritized smut in acosf over her own characters. i know ppl like that book but that was a shit characterization of nesta and cass and everyone that showed up almost and what for? to have a bunch of smut scenes that didn't actual help anything with nesta's development or the plot (i think it didnt even help with them getting together bc i would have prefered they actually started getting closer organically and then the tension starting after that) and she actually had a good idea with the valkyries but then the blood rite kinda cheapened it in my opinion bc they literally won with the power of friendship when sjm could have just skipped more time ahead (since they're immortal) and then when the 3 of them were realistically ready they could have won, and since the 3 bat boys winning was such an important thing i think if she really had to have that parallel than she could have wrote it better
i absolutely agree with this. and there's amazing examples of fantasy books where the smut hasn't ruined the plot and it's flow is great. but like, she's just cranking these books out with little thought i swear. and she can brag that she wrote cc3 in whatever like 6 weeks or some shit and then scrapped the whole thing. but like? sounds like a rush job to me? and how does she keep up with all these fucking characters because i can't. cc3 will make me lose my mind i swear. cass/ness had so much potential tbh i was here for it but acosf was a complete whirlwind of fuckery. and i get that it was no longer feyres pov or whatever but what the hell, that's not my cassian.
im glad you mentioned the bryce and az chapter bc i havent read that series and i dont want to but sjm is crossing them over to get people to read it (which makes me want to read it even less lol) and its just one more storyline she probably can't keep up with. like it's crazy how we still don't know so much about the acotar world or the characters, even rhys we still don't know how far his powers go or so much about his backstory and why? bc sjm doesn't care about building a character, i know it's a romance book but you can't just ignore every other aspect of the book
literally the only reason i read it was for the crossover. it was one of the worst books ive ever read and long as fuck too. did not need to be that long. i couldn't tell you a single thing that happened in it to be honest besides the fact that literally every man bryce came across had to make sure to mention how beautiful she is. fuck off with that shit fr.
also! this one is kinda me being picky maybe but the jokes about feyre having canned food in this setting with no other modern stuff is actually bad world building imo, i mean there were no signs of industry in the book and then a can of soup shows up out of nowhere? before other more basic stuff than would have to have shown up already? idk what that was about. that and the leggings, im not saying it's not possible for them to be there but to this day my mom calls them tights bc that's what they were called until a few years ago so seeing the word in the fantasy setting sjm had set up literally pulled me out of the book
OMG you're so right i never thought much of the soup can but you're so rightttt im actually dying that's so funny. yeah, leggings was stupid as fuck too, you're telling me they have synthetic stretchy fabric? be so fr rn
maybe im in a mood today too lol but i really just much prefer fanfiction over the books, in fact i only finished them bc since i was getting spoilers from fics and thought i might as well read them
i feel this so hard đ
7 notes
·
View notes
its almost midnight so you know what that means! random thoughts while i unconsciously panick over how tired iâm going to be tomorrow when i have to wake up at six again :D
today im thinking about love languages. more specifically, unconventional love languages that i hc the sides do! from the same people (complete lie but just roll with it) who brought you remus biting people to show affection, we bring you
virgil likes to pat/slap people. just. pat on the head. slap on the face (gently,,,must hit affectionately)
roman loves all love languages, but only in specific contexts. quality time, as long as he is fully aware of how much the other is enjoying it as well as he is (silent quality time is a big nono). physical touch BUT ONLY SOMETIMES!!! and sometimes, ONLY PHYSICAL TOUCH IF YOU DO NOT HUG HIM RIGHT NOW HE WILL CRY
janus squeezes. squeezy hugs. squeezy hand holding. sometimes its feels like hes trying to literally squeeze the life out of you (hes not, but he doesnt really understand his own strength)
is it possible for someone to be touch adverse but also touch starved. because that is logan and roman. ask them rn if they need a hug. god knows they wont tell you themselves-
patton is so gifts of service its like. stupid. nothing even belongs to him anymore. he has no concept of personal belonging. everything that is his is also everyone elses. must,,, gib everything,,,
janus, remus and virgil also headbutt people. just to check up on them. they dont rlly do like, words of affirmation or quality time. they communicate purely on physical touch and gifts sometimes. sometimes they engage in friendly headbutting battles
remus needs to spend all his time with the people he likes. all of it. just be with them all the time. even if its just pure silence, he needs to know somebody is there or else he will explode
oh also they have specific things for different people!!! like remus spends most of his time w/logan bc heâs the only other one who also needs to be around people a lot!! must of the time logan needs it to be quiet, but he still wants someone in the room
vi nd pat exchange many gifts. it started with the cards and now they make each other a bunch of handmade stuff too!!! like patton whittles figurines for virge and virge sews pat stuffed animals.
similarly, janus and patton exchange food. all types. just. gib meal. ily
honestly patton is the only one who rlly tells ppl that he loves them. nobody else rlly likes to say it out loud. it means so much when they do say it tho
virgil and roman obvs do the opposite of words of affirmation. they tell each other that they hate each other so that they know that they love each other.
the reason that logan and roman argue a lot is bc they donât share love languages rlly. they have like, opposite cycles for needing/hating touch, which leads to some hurt feelings when one of them gets denied. they remedy this by spending at least one full day a week hanging out and doin things together
remus and virgil fight. so often. they wrestle a lot. it means that theyâre having a good day
janus is very smoochy. did i mention that. did i mention that that one college projection au by haysgrove made me obsessed with that hc. yeah heâs a kissy boy. the others never really mind, they know itâs just a thing he does (nd he always asks first!!!)
36 notes
·
View notes
cough. idk if i explained how theo was brought back but basically . it was liam had the idea to bring theo back. hayden, his GIRLLLFRRIIIENND. was not on board. she used to be in his pack. anyway liam who literally almost killed scott ......... was like "we need something capable of absorbing a lightning bolt. or someone." and liam knew theo killed josh for his power. so he knows he could take a bolt of electricity. in theory he's risking a lot. (he needs someone to absorb lightning bc the ghost riders aka villain of the season travel on lightning and he wants to be able to capture one and then go from there.) he went to kira's mom and asked to bring him back. he was confused when kira's mom gave him the sword and said "youll have to do it yourself" bc he figured that she was gonna do it. and then she tells him "whatever happens...is your responsibility." hayden said she supported him in whatever but right before he put the sword in the ground where they left theo all those months ago, she said "WAIT" and he did it anyway and theo came from hell dirty and scared like a wild animal he IMMMEEEEDIATELY pins liam to a wall with his forearm on liam's throat. . listen. when i tell you he's looking around frantically and afraid its like they cant even talk to him. hayden is like "theo we're not trying to hurt you!" ans hes like . off somewhere. and he says "where's my sister?" <- in some weird growl because he is PETRIFIED RN. and they mistake theo's question for memory loss. liam says "your sister's dead. she died a long time ago." ans HAYDEN SAYS "you killed her ...remember?" hayden..... shut the fuck up. YOU DONT KNOW THAT.??? anyway and then theo says hes gonna kill liam and etc etc then liam holds out the sword as a obvious threat and theo backs off. says that they need his power to help them. AND THE DEAL ALWAYS WAS. THAT THEY USE THEO AND SEND HIM BACK. THAT THEO HELPS HIM AND HE GOES BACK. THATS HOW MUCH THEY HATE HIM. EVERY WRONG OR WEIRD THING HE DOES OR SAYS ANS SLMEONE SAYS "send him back" LIKE FUCKING CHILL GIVE HIM A MOMENT. anyway that was always the deal. but liam said "help us and you can kill whoever you want after. but if you kill US. then you're gonna be worse off than ever." <-ish. and theo says. "theres nothing worse than what ive been through." they do not respond or acknowledge that. do mind tho, liam treats theo with the most respect, more than anyone else does even tho he has good enough reasons to despise him. unlike hayden he recognized how scared he was. and didnt yell at him or accuse him of killing his sister. just said she died. anyway. so theres this contracption that they have able to hold all the jules or voltz of electricity in a lightning rod. they brought theo to it to TEST if he could handle a lightning bolt. liam tells him he can do it. he cant. he doesnt have  josh's power and he doesnt have tracy's power and hes back to classic theo. he thinks hes gonna get sent back by the way liam and hayden are talking so that mf starts going "hold hold hold on i can help" he has information on the ghost riders and he knows shit from the dread doctors and HE REMEMBERS STILES!!!!!! stiles got taken by the ghost riders and if you get taken you get erased from everyone's memory and basically reality. ans since he was in hell he . remembers him. and he also has exclusive information on the person liam ans hayden brought down with them to test the lightning. hes a science teacher at the high school. but in actuality, theo knows who he really is. i aint got time for all that rn. anyway liam lets him stay on account of knowing who stiles is and the fact he probably does know things.
imagine coming out of literal hell and some bitch is like "you killed your sister" babe one of us is going back down there and it won't be me
7 notes
·
View notes
Same anon as from before, first of all the tangets were wonderful and really nice to read so thank you <3 and second of all something i forgot to mention previously: TOMMY!!!! His whole "i don't think i want a girlfriend" was AMAZING and i really hope they come back to that at some point bc just,,,, watching them discover their identities and feelings just makes this so realistic and such an amazing read!! Also him just admitting to himself that yeah he finds Ranboo hot, 10/10 no notes <3
I'm going to go on a tangent now, sorry about that, but i think you do an amazing job of showing how complex aro relationships are and how much thought and consideration actually goes into them! I feel like sometimes aro relationships and/or QPRs are portrayed as,, sort of easy? Bc it's "friendship" or whatever? But like i've definitely spent time and thoughts on trying to figure out what i actually feel and what i want out of a relationship and even "what if this is actually romantic attraction" so it makes me feel so so so seen when those same themes are coming into play here! (No idea if you are planning on delving deeper into that but no matter what i'm really thankful for what we already got <3)
HI so so sorry for the delay in answering you will not BELIEVE the week i have had (actually you totally would work was just SO MUCH)
first of all YES absolutely coming back to that. tommy has always thought he needed to have a wife and kids one day as a way to like... prove himself better than his dad. like if he could be a good husband and father it would be proof that he was better than his dad and that he wasnt like... too "damaged" from his childhood. and realizing that he doesnt in fact want that is a really big thing for him that hes only now starting to deal with.and YEAH. let me. let me bring you back to one of my favorite winterlude lines (whjich. man im rereading that rn. because i forgot my own story. and bro how was i allowed to make them so god dam gay in that.)
"He pulled back, looking up at them. Their hair had fallen to almost entirely cover their face, so he tucked it back again, because he happened to think their face was quite nice. The gentle glow of the string lights illuminated Ranboo softly, and their smile had so much warmth and so much adoration, and Tommy wondered when he had fallen in love with them."
this man. is in love. its crazy.
secondly, THANK YOU!! honestly i just try to write things that feel real to me. i do a TON of research for things i dont experience, but as an aroace person and someone in a lot of aroace spaces online, i just write what i know. i DO absolutely want to delve into it more, because the relationships are such a major part of drdi and all relationships are gonna be complex. especially the trio like... theyve all got trauma and shitty relationships in their past, and on top of that they're in what is becoming a very serious, committed relationship. theres gonna be lots of feelings and complexities and stuff. theyre also not all aroace which means theres varying feelings going into the relationship which certainly isnt BAD but it adds more! the trio's relationship is just very unique as QPRs often are!!! i am very excited to keep delving into all of that its gonna be so fun!!!
but yeah!!! thank you so much for being so supportive!!!!! i really appreciate the ask(s)!!!!
4 notes
·
View notes
In your pearlina, who confessed first and how did the other take it?
OOH BOY. What a question ! Well
(Yes i understood its an ask abt pearlina give it time.hheehee)
Tldr: marina did, pearl is sillay so it took her a huge confession to actually get it
Long answer: this below ! Thought that it would be necessary to explain what happens before hand so...
---
8 goes to pearl and marina for advice, since she has 0 idea on how to deal with her very not new (not sarcastic lol) feelings for 3 like a normal person. At first they both give out generic ass advices like well are you sure you like her or whatever that are completely useless in this context bc 8 is absolutely certain of her feelings toward 3. Anyway after some back and forth 8 decides to ask them about it one by one instead of both at once because theyre both saying the same shit rn almost. and a divergence seems to create itself between pearl and marina's opinion on the situation:
Pearl is encouraging her to jump into it and confess whenever she can, accentuating on the possibility she just might miss her chance if she lets her anxiety over this takes over, that to live a life without regret she shouldnt lie about her feelings toward 3, that if shes as such of a good friend as 8 claims itll all work out in the end, and honestly she thinks its pretty damn certain that 3 likes 8 so why all this bullshit just go girl! Go get your little meow meow!!!
Marina starts being kind of .?.discouraging i guess ? Saying that its none of her business and that its up to 8 either way and shell always be there to support her but from what she has seen of 3 there seems to be no hints of them feeling anything for 8 bc people dont just show that type of stuff this easily, and acting like its possible to be certain of how 3 feels about 8 is untrue and maybe a bit selfish even. and that once again 8 is free to do whatever she wants but she has to be realistic, if 3 does not like her back confessing will probably ruin the bond they currently have because it would become too awkward. Just think of it a bit more, observe the situation. Maybe you shouldnt think of your feelings toward them too much like just enjoy your lives together 8 !! ^_^
8 officially becomes "caught between two stools" as they say. the two extremely different tones, one of unbridled motivation and the other of... uh?. clash into her brain and it stresses her out a lot, she starts to avoid 3 bc she doesnt want to say smth dumb since she thinks whatever she could do would go against the advice of the other. (kind of ends up hurting the later's feeling but they do not mention it because it might just be something unrelated to them and theyre making it about themself for nothing. But its irrelevant rn actually LOL)
Anyway 8 goes back to discus the category 5 event (to her at least) w them again but this time she starts by asking marina. the same thing as before pretty much but 8 just starts to get cranky from the stress of it all. Marina is like uh oh. 8 gets kinda mad and tells marina its not fair for her to discourage her so much when she managed to get with pearl just fine so there is no sense to whatever shes saying since its not her experience, and was about to continue into saying that but maybe shes right and all of that . When marina cuts her off, "what do you mean, get with pearl?" And 8 is just like well i am talking about your obvious relationship with pearl of the romantic kind that isn't even worth mentioning due to how obvious it is what else??
Except that no. They're not, they're not actually together LOL .
and it just clicks into 8s brain that marina was just picking up her own anxious feelings due to her inability to confess her love to pearl (Because its obvious shes in love with pearl like she's not stupid). and throwing them at her like a bunch of dodge balls. Which isn't very nice and actually pisses 8 off so she just leaves like. Super jumps outta the mansion and breaks a window in the process.
Marina is just like :( sends 8 a few messages but they're def not getting read until the day after, or the day after the day after. Anyway ! Pearl heard them argue so she goes over to check on marina. Pearl asks her what was going on and marina tells her that 8 has asked her about the 3 situation again and pearl is like "omg me too ! So you totally told her to go confess right" eh.... not really.
So pearl is genuinely kind of surprised. rina... what the hell babe! Love ya but thats a p big social blunder u just made, not cool have you apologized to 8 yes oh ok well i guess youve got to wait now dont worry ill Try to talk to 8 too dw, you know she doesnt hate you dont worry that kind of stuff happens. But like why did you say that fr.
Marina tries to tell her shes just being realistic but pearl is like nah youre just being super negative for nothing sheesh. Thats not being realistic thats just being anxious, i get youre p much always worried for her and all but thats a bad approach to the situation.
Marina tries to stfu as much as she can by this point bc shes scared to say something that would reveal her feelings so shes just "yeah ok pearl sorry". but pearl can see shes being surprisingly silent all of a sudden so shes like. "Uh are you doing that thing were youre not saying anything because you think that whatever youll say will sound stupid"
-"No pearlie i am not"
"Yes you are !! Cmon spit it out babe, or else ill try to guess lol. Jk though you know i don't wanna be too privy i just want to make sure ur doing ok cus this is doesn't seem like u rn you're clearly going thru smth"
Marina is like .Ok pearl i just think that its normal to want to be careful when you feel something for someone you admire and love? What if you messed it up and ruined everything ? Dont the other person s feelings matter too? What if you just wanted to forget how you feel about her because she means so much to you.
Pearl stares at her and is just... ermh. wait, are you talking about yourself ? You're in love with someone and you want to forget about it because you're afraid of what you currently have with them?
Marina looks at her like the world is about to end. Annnnnnd "well, you know how i feel about that type of stuff, better to be honest and all. But i hate seeing you suffer and if you feel so conflicted and hurt about these feelings you have. Trust me! Ill make you forget all about them 'rina!!" HUH !!? "Yeah ! Why don't you try meeting new people huh? That might help you get your mind off of that mystery person, lemme make a few phone calls..."
And then the day after she finds herself at a speed dating event
"Oh god she wasnt joking" she thinks . and the dude in front of her is like " uh hello its your turn to introduce yourself. If you dont like guys you shouldve precised its annoying to switch tables-" "DIE im not even the one who booked this stupid thing" and leaves like immediately
"Pearl is so clueless. Damn it ! But also its good bc if she knew id die actually, "she thinks. On her way home, she contacts pearl to tell her her plan didn't quite work out. sorry pearlie!
Marina goes home and walks directly to the studio room bc she just wants to get this silly event out of her head annnnd. She cant find her lyrics book. Mhh. weird. she turns around and sees pearl. Holding a sheet of paper that suspiciously looks like.. UH OH
"Oh god marina... why didnt you tell me... you had... these... ABSOLUTE BANGER LYRICS WRITTEN DOWN!!! Lets make a tune w this bitch wtf" and she shows marina the like extremely insanely romantic song she had written as an attempt to confess to pearl before panicking last minute and hiding it somewhere and she looks like a ghost now.
Pearl isnt that dumb and she can see that marina looks mega uncomfortable and after a while it Clicks and she says "ohhh. Hey no worries i'm not stupid. It was for that special someone huh. Well damn marina. I know i said i wouldn't intrude but the way i see it... what you feel for them, its seems real. its not something you should hide. With how great you are you really shouldn't have any issues ! Hell if these lyrics were meant for me id probably fall in love with you if we weren't basically an item haha JUST KIDDING of course im sorry if this sounded like i was making fun of ur situation ok i will stop talking now before you lose all respect for me hahh"
Then marina looks at her. AND OH MY GOD ITS NOT FUCKING POSSIBLE HOW IS SHE MISSING IT But also its good i guess bc she doesn't love me back i'm sure but WHY WHY WHY. And just mutters "oh, ill think about it:)" and leaves the studio. Pearl asks her where shes going and she says she's going to bed. Pearl goes to sleep a little bit later but when she gets in their room she doesn't see her, and that plushie that marina sleeps with is missing, she realizes that marina is sleeping in the guest room. (Because they usually sleep in the same bed, as all besties do naturally.)
The next day marina isn't there and there are like 100 scenarios playing in pearl's head. She contacts marina and gets no responses. She asks 3, 4, capn cuttlefish, callie marie and 8 so basically like everyone she thought might know at first. The others say they have no idea but 8 says marina invited her to eat ice cream and apologize in person for the earlier events, marina told her she was just being a bit overbearing and silly. and that 8 should go tell 3 blablabla, though she left after, sure she seemed fine. I didn't pay much attention to her face, why would i... no i don't know where she went after that sorry but she said shed just walk around, is she missing ? I mean i saw her just this morning.
So nope, truly no one saw her today except for 8. She tries to think about where she could be, she checks around the city, the stores quickly asks around but nope no clues. Shes stressed out and feel stupid. There is one place left and So she goes to it because Maybe... shes there ? Its silly but maybe she does the same thing as her and goes to mt. Nantai when shes stressed out or smth
After a bit of a hike. She finds herself at the same spot in mt. Nantai where she and marina met.
And she sees said octogal seating here !! Phew thats a relief- oh no shes crying.
She immediately sits down next to her. "Whats going on marina??"
Shes trying to say that shes fine and all but the words come out as semi gibberish
She just sits there crying for a while while pearl has her hand on her shoulder.
After a while she stops crying but still stays silent, shes looking away from pearl. Pearl tries to get her to talk and after some more time she does. In octarian! A very sappy confession, her fears and the love she has for pearl, how much she means to her etc finally said out loud at last, even if pearl wouldn't understand. It actually goes for quite a while, marina had a lot to share. At the end of it, marina feels much better. Even if pearl doesn't get it, at least marina found a way to express her feelings somehow. she finally turns her head and looks at pearl, whose eyes are wide open... wait whats this reaction for, did she... understand what i said?
"Hooly shit. You really feel that way?"
Uhhhhh my life is over actually. Marina is about to speak to somehow try and go back on her 15 minutes long monologue but-
"Man... if whoever you loved was the one hearing this that'd be crazy. Are they an octoling ? Since you spoke in octarian and all. I gotta admit i'm a little jealous hah. I mean. I'm not sure i was meant to understand what you just said though. Sorry."
-"pearl. What."
"Oh i mean you were talking as if i was the mysterious someone right-"
-" OOOH MY GOD PEARL YOU ARE THE MYSTERIOUS SOMEONE I LOVE ! I AM IN LOVE WITH YOU !! ARE YOU KIDDING ME!!!" And she just starts crying again like an insane person
And after 800 fucking years pearl FINALLY. ACTUALLY GODDAMN GETS IT.
And she laughs !
Shocked, marina is about to ask her if shes making fun of her but then she hears a sniffle and when she actually looks at pearl s face proper she can see a tear running down one of her eye. Pearl tells her something like "you know, i have made jokes about it but they werent lies either, i know its wrong of me but well, my heart has been yours for a while, 'rina. Even if i never told you outright... its pretty obvious, but i was afraid of losing you, you are my world ! I shouldn't have hid it. Guess i'm a bit hypocritical huh? Sorry babe"
Marina looks at her like an insane person
"Okayy maybe i wasn't clear enough: i am in love with you too, marina. You believe me right?"
...
"Alright uhh lemme repeat that-"
And then marina jumps on her octo expansion ending style, starts crying again but of joy this time. pearl sneaks in a kiss and they just stay like that for a while, hugging eachother.
And then they go home because its starting to get very very cold lool
The end!
(Thank you for this ask, it was very fun to answer, once again if you have any other questions... ask away ! Its fun to answer lol)
55 notes
·
View notes
Alfred F Jones is crying himself that you havenât drawn Italy riding Germanyâs face he is sobbing America is crying
bitch im crying too okay AAUGWHSJIEUE WHY HAVENT I DRAWN IT YET. ITS NOT A FUCKING JOKE. IM NGL. IM NOT A SEX GUY OKAY I LIKE KISSING AND HUGGING AND MISSIONARY BUT ONLY IF THEY SAY I LOVE YOU DURING IT. BUT OHHH MY GOD ITALY RIDING GERMANYS FACE IS SOOOOOOOOOOOOOOOO HAW.... HAWT!!!!!! *SLAPS FACE* GYAHHHH!!!!!! ITS ONE OF THE FEW THINGS IM SO VERY TOTALLY INTO. I WANT ITALY TO FUCKING SUFFOCATE HIM DEATH LIKE KILL THE BITCH FOR REAL THIS TIME. I WANT GERMANY TO STRAIGHT UP ALMOST PASS OUT FROM LACK OF AIR AND TO KEEP TRYING HIS BEST TO USE HIS MOUTH EVEN THO ITALY IS GRINDING DOWN ON HIM AND DOING 90% OF THE WORLD BC GERMANYS TONGUE GAME IS SO BAD. shy** sex. fluids. TO MAKE IT THROUGH THE GODDAMN SAHARA DESERT. ITS SO GOOD BECAUSE I THINK ITALY GRABS GERMANYS HEAD AND USES IT LIKE A STICK SHIFT WHEN HE GIVES HEAD IN THE BLOWJOB POSITION. BUT ITALY RIDING GERMANYS FACE IS EVEN BETTER BECAUSE ITALY HAS WEAK AS FUCK ARMS AND WHEN HE RIDES HIS FACE HE CAN GO FULLY AS HARD AS HE WANTS TO ON HIM AND SUFFOCATE HIM AND GET HIS ENTIRE FACE ALL MESSED UP. it does have cons where he cant pull his hair to admire his own work but yknow he still gets to enjoy the fruit of his labor when he finally gets off him and sees germany withered like a mummy and gasping for dear air. germany is also the type to so very totally cream from giving head oughhggwgs OHHHVMY GODDDD đđđđ AUAGuhw IM RUNNING IN CIRCLES N SHIT OHHH MY GOD YES!!!! YES!!!!!!!!!!! ITALY OVERSTIMS HIM FROM RIDING HIS FACE SO HARD AND ITS EVEN BETTER BC EACH TIME GERMANY FINISHES HIS MOUTH SUCKS IN HARDER AAAAUUAAUAUUAAUUAUAUAGAUFWUSAAUAGWUZHS AMEN BROTHER... IM SHEDDING A SINGLE TEAR RN... AMEN!!!!!! ILL DRINK TO THAT!!!!!!!!
sorry i got a little carried away there. I just really. Really. Like italy riding germanys face. i dont even like head that much tbh but itager sex hits different for me u guys kno that
2 notes
·
View notes
omg OMG dont even get me STARTED on honey and tangerines
i've genuinely been meaning to reread it this summer, THAT FIC IS ONE OF MY FAV THINGS IN THE WORLD... THE VIBES-
like okay yes almost all of ur fics are my fav in the world, but honey and tangerines hits DIFF man
i started that fic thinking the main conflict was going to be crimeboys, and then angelduo came in with a sledge hammer holy shit
dude. that convo in chapter eight SMACK CAMMED ME SO HARD
like
i remember reading the summary and being like "ooo!! skateboarding", i didnt even clock how the part with phil could be ominous man like-
oooh boi
[takes a deep breath]
im getting emotional thinking about it rn, i havent read this in so long ohmgyod i miss this fic:(
side note before i get into my full mental breakdown over the ConvoTM, i never wanted to learn how to skateboard till i read this fic lmfaoooo
idek why, i was just... never interested, even my bf was like YOO ITS SO COOL and i was like Eh
and then i read this chapter and i was like "... maybe it Can be cool"
brooo BROOO
okay yeah that convo...
i think it's the hardest i've cried reading any of ur fics, normally i tear up and yknow do my whole Pterodactyl screech, but i dont often full blown cry, but holy shit man. Honey and tangerines? I'm pretty sure I bawled.
uh oh im crying again rereading this scene BROO ITS JUST SO WJEAFOIAWEOIRJAWEROIAWEROIWAERJAWEOIJRWAOIERKJLWERJOIWEJWEARIJ
ow
im in pain again
anYWAYS
god this fic is actually the greatest fucking thing in the world i love it so much bee u have no idea bro i adore it to my core :(((
i dont know how to describe it but ooohh my goodness
i just :(( idk i love indie vibes a lot
like... one of my favourite movies is Perks of Being a Wallflower. Indie movies are really important to me bc it just :( it makes me feel like My life will be okay, if their life works out. and... slice of life vibes are just the best
and honey and tangerines is the perfect fic to ever indie vibe, the playlist, the little fluff moments, the climax, everything about it is perfect. i can't describe how perfect it is. i adore it sosoosososososososoosososoo much
i also can... oddly relate to tommy in this fic, more than i thought. my mom didn't have mental health issues but I did have to take care of myself more than I was supposed to when I was younger, and there were a lot of parallels in this fic even though the situations were completely different, that it just... hit a lot harder for me than most fics normally do. especially like... i have a half sibling that i have a super complicated relationship with and crimeboys in this fic almost reminded me of it.
i just :(( honey and tangerines is so so important to me, and it's also just beautifully written, content aside. i love the prose in it. the way you describe everything feels so natural and real. i felt truly immersed. i lose sense of what's around me a lot quicker than i normally do when i read fics. it just instantly grabs my attention.
god, it's written so fucking well.
another way it's affected my life is after i read the laundromat chapter, it gave me the courage to ask my bf to dance w me for the first time. as i've always loved dancing but i've always been super shy about it. but reading that scene just filled me with such joy, that i had to ask my bf, and now it's one of our fav things to do :))
idk man like. wf is the fic that first made me obsessed with your writing. stars is one of the most well written and impressive things i've ever read and heyyy sandduo centric babyyy. also the WORLD BUILDING IS SO COOL. what the water gave me is the fic out of all of ur fics that makes me the most emotional /pos. a dusty tomb is my personal fav comfort fic, it's so fucking cute i love it so much (and the clinic prequel is same vibes as well). ur vamp fics are addicting as hell to read.
but honey and tangerines is the fic that's affected my life the most <3
(god sorry for the long rant, this was not meant to be this long LMAO SFDKAJ)
honey and tangerines was such an interesting fic for me to write because it connected to my irl life in so many subtle ways. I put those nods into my life in a lot of my fics, but honey and tangerines was the one most directly based out of my own life although it was mostly just the concept of having ex step-siblings that I pulled from. I also thought the main conflict was going to be crimeboys going into it, although I knew I wanted a focus on angelduo as well. but then as the story progressed I understood tangerines!tommy a lot more as a character, and his relationship with phil just expanded into so much more. I'm so happy with how it all turned out, and I'm sorry for all the tears I made you shed lol
(this response got long oops so I'm gonna put it under a cut)
you totally get my love of coming of age/slice of life indie movies. I've always been a big movie watcher, and nothing hits quite like a really well done coming of age film. ironically though, the perks of being a wallflower was one I originally wasn't a movie I was very impressed with the first time I saw it. it wasn't until I read the book and then rewatched the movie years later that I was like oh. I think for me two coming of age indie-type films that really hit for me were Lady Bird (because the relationship between Lady Bird and her mom hit very close to home in certain spots for me), and this one called Cha Cha Real Smooth. Cha Cha especially hit for me bc it's about a 22 year old who just graduated college and is trying to figure out where to go now, and I watched it only a few months after I'd turned 22 and graduated college and was floundering for what to do next. so yeah, that one helped me in the same way you described with the whole "maybe my life will work out like theirs" sense.
I'm so glad I was able to capture those vibes in the aesthetics of it all. that was half my motivation for writing it ngl. I just really wanted to try and capture that summertime haze with the descriptions and the playlist and all of it.
I'm sorry you could relate to aspects like those in the fic, but I'm also really glad it was able to provide a source of comfort for you <3
that's so sweet that you asked your bf to dance with you after reading the laundromat scene!! and the skateboarding too is so cute. I'm gonna be honest I do not know how to skateboard nor have I ever had a desire to learn, I just liked the aesthetics of that scene lmao. I hope you've been having a really good time dancing and skateboarding with your bf since though :)
icyfox aaa you're so kind though seriously thank you for all of that. one of my favorite parts about having this 'audience' (for fanfic lmao but it's an audience nonetheless) is hearing how the stories I create for my own joy impact your real lives. like, it's just amazing to me the reach my words can have, and I'm so happy you were able to get so much out of this story. ty for this it made me smile a lot
7 notes
·
View notes