#bird keeping

[toastandjamie]

On the left is when we first found Egwene and the right is a picture I took of her today :D

Poor Egwene had been on her own for at least two weeks, I don’t know if she was abandoned or escaped, but after a few weeks of looking no one stepped forward to claim her. With some help I built a giant loft for her and she looks so much better now. I really love her so much, and I’m so happy to have her <3

I’m going to post so many pictures of her lmao

#pigeon #my beautiful baby #pet pigeon #bird keeping

[marchtothefuckingsea]

so this yellowthroated warbler was scratching at the window at work today (ie 10 minutes ago) and I opened the door and she walked right in and she is SO friendly?? i grabbed her to try and give her water, she didnt drink but she fell asleep in my hand. I've tried giving her a box to be in and she won't have it, it's gotta be my hand. what am I supposed to do now???

she also can't seem to fly very far, which I'm not sure if it's something wrong witb her or if that's just how they are. i don't know much about birds in general. help.

#help #yellowthroated warbler #warbler #birdwatching #birds #bird watching #bird keeping #birdkeeping #i really need help though #seriously #im also beginning to feel like snow white because what the fuck #this is getting so weird at this point

[aquilacalvitium]

BIRD PEOPLE HELP I NEED TO LOOK AFTER A PIGEON

He's unable to fly. His wing isn't broken - we suspect a muscle injury, but he just won't fly. We took him to the vet and they said we have two options. 1) Keep him overnight then take him to a wildlife rehab centre or 2) Keep him for several days until he's flying again.

Either way, he'll be staying with us overnight and I need advice from experienced people!!

He's in a wicker cat basket lined with a towel (it does not smell of cats, it's been almost a full year since we used it last). The cage is big enough for him to walk around and open his wings and I've put a bowl of bird seed and a shallow bowl of water in with him. The window is open so the room can remain cool and ventilated and we have ensured that no cats can get anywhere near him.

PLEASE tell me if there's anything I'm doing wrong or something I should be doing that I'm not, and any tips for a potential long-term stay would be GREAT.

We will keep him if we have to but I would much rather he go to a rehab. I will also try and get them to let us take him back here after recovery so he can go back into a familiar environment. We also suspect he has a mate nearby so releasing him anywhere else would not be great.

Other than a potential muscle injury and an old scab on his back, he has no visible injuries and no skin was broken. He was given a full health check from the vet and they've cleared him of anything serious.

#pigeon #bird #bird help #advice #bird keeping #aquila thinks #HELP!!!

[inkskinned]

probably time for this story i guess but when i was a kid there was a summer that my brother was really into making smoothies and milkshakes. part of this was that we didn't have AC and couldn't afford to run fans all day so it was kind of important to get good at making Cool Down Concoctions.

we also had a patch of mint, and he had two impressionable little sisters who had the attitude of "fuck it, might as well."

at one point, for fun, this 16 year old boy with a dream in his eye and scientific fervor in heart just wanted to see how far one could push the idea of "vanilla mint smoothie". how much vanilla extract and how much mint can go into a blender before it truly is inedible.

the answer is 3 cups of vanilla extract, 1/2 cup milk alternative, and about 50 sprigs (not leaves, whole spring) of mint. add ice and the courage of a child. idk, it was summer and we were bored.

the word i would use to describe the feeling of drinking it would maybe be "violent" or perhaps, like. "triangular." my nose felt pristine. inhaling following the first sip was like trying to sculpt a new face. i was ensconced in a mesh of horror. it was something beyond taste. for years after, i assumed those commercials that said "this is how it feels to chew five gum" were referencing the exact experience of this singular viscous smoothie.

what's worse is that we knew our mother would hate that we wasted so much vanilla extract. so we had to make it worth it. we had to actually finish the drink. it wasn't "wasting" it if we actually drank it, right? we huddled around outside in the blistering sun, gagging and passing around a single green potion, shivering with disgust. each sip was transcendent, but in a sort of non-euclidean way. i think this is where i lost my binary gender. it eroded certain parts of me in an acidic gut ecology collapse.

here's the thing about love and trust: the next day my brother made a different shake, and i drank it without complaint. it's been like 15 years. he's now a genuinely skilled cook. sometimes one of the three of us will fuck up in the kitchen or find something horrible or make a terrible smoothie mistake and then we pass it to each other, single potion bottle, and we say try it it's delicious. it always smells disgusting. and then, cerimonious, we drink it together. because that's what family does.

#this is true #writeblr #warm up #relatedly for some reason one of our Favorite Jokes #amongst the Siblings #is like - ''this is so good u will love it'' #while we are reacting to something we OBVIOUSLY find viscerally disgusting #like we will be actively retching and be like ''nooooo it's so good'' #to the point that i sometimes get nervous if someone outside my family is like oh u should try it its good #(obvi we never force each other to eat anything. we are all just curious birds and #like. we're GONNA try the new thing.) #edit to answer why we had so much vanilla: #my mom is a very good cook and we LOVE to bake. so she just had a lot of staples in the house. #it's one of those things that's like. have u ever continuously thought ''ah i should get butter im probably out'' #even tho u are not out of butter. so u end up with like 5 years of butter. #my mom would do that in a costco but like with vanilla extract #to be fair we WERE always using WAY TOO MUCH bc we were kids #so like she was right to stock up #ps. yes we were VERY sick after this lol i just didn't want to include it in the post in case ppl had an ick about that #u can tell it's real bc we knew "oh no we fucked up that's too much vanilla to waste'' but our reaction was to just. keep drinking it #> sibling understanding that vanilla extract isn't free > knowledge mother doesnt mind if we use it for milkshakes #> sibling choice to maybe get in a loophole of ''not wasting it'' if we drink it bc that's the same as using it (not throwing it out) #listen bud i was like 13 and my sister was like 9 #when my mom discovered this we. got in. A LOT. of trouble. a lot of it. a LOT of it. #3rd edit bc i guess it isn't clear - i am 1 of my brother's 2 little sisters #i am the middle child #out of all the ways i have had to explain a post before being like ''did u forget a middle child can happen'' is my favorite

[bigfatbreak]

Birds of a Feather previous / next

#my art #feralnette au #birds of a feather #long tags #sorry I went apeshit in the tags #LETS SAY IT ALL TOGETHER NOW #I - M - A - G - OOOOOOOOO #its fun drawing marinette's back to Alya and having her appear stout and unstoppable and totally logical #and then you see her face and she's like two seconds from completely snapping and is keeping it together by a thread #as a note just because mari feels very certainly abt smth doesnt mean she's right. feelings can be valid and also irrational #in the throes of grief she decided it was better to be alone than to lose someone again so she started pulling away #and lila made pulling away very very very easy to do #shes also vaguely aware she's being unfair in pinning this on alya which is why she started spinning the drain on cockmoth again #legitimately all the shit that's happened to her wouldn't have been so catastrophic if he was never in the picture and she knows it #but the bitterness of her bestie choosing a fantastic liar over her at the worst of times stiiiiiings #alya's personal timing was bad but lila really took advantage of the fact that marinette had been acting off and weird #she basically clocked marinette as being unstable from SOMETHING and made up a lie about her #knowing she wouldn't have the strength to defend herself #between her social life going tachy bc of lila and losing fu in a way that felt like personhood death marinette was really put on the spot #and alya doing her thing of busting in there and assuming her bias is correct was a terrible combo #essentially marinette is highly unstable and alya is just realizing that #busting in and giving her a lecture when she's slightly hysterical and definitely delirious from exhaustion is NOT the way #to show her she's self sabotaging #cuz thats just gonna make her double down on self sabotaging. bc marinette will not accept that she is also a CHIIIIILD

[fyanimaldiversity]

A beautiful grey American crow (Corvus brachyrhynchos) [x]

#source says leucistic so we’ll go with that #leucistic #leucism #american crow #crow #bird #Corvus brachyrhynchos #looks diluted such a nice color #I can’t remember seeing one such a nice solid grey #have seen brownish and white and maaaaybe a very light grey? #good job nature #keep up the good work

[nonasuch]

here is a concept: time travel cop, fish & wildlife division

most of their job is dealing with the kinds of assholes who think black market tiger cubs are a great idea right up until someone gets mauled, except these are even bigger assholes with black market Smilodon cubs that they are even less equipped to care for

this is the most straightforward and therefore relatively headache-free part of their job, because it’s the same “put that thing back where it came from or so help me” song and dance every time

it’s also significantly less depressing than the trophy hunters who don’t even want an alive extinct animal. those are extra annoying because you have to undo the time travel that let them kill that poor Megatherium or thylacine or anklyosaur or whatever, and it’s always so much extra paperwork.

and those people suck, definitely, and have fully earned a stint in Time Jail. no question. but they still do not create anywhere near as much work as the obsessive hobbyists with their exhaustively careful best practices and worryingly good track-covering. also, weirdly, it’s almost always birds with them?

like. the guys who will flagrantly abuse Time Law to bird-nap breeding pairs just long enough to raise one clutch of eggs apiece, and return them seamlessly to their spots on the timeline. who are so determined to keep their pet (ha) projects going that no one even realizes what they’re doing until they have an entire stable breeding population of passenger pigeons up and running. who are now the reason that reps from six different zoos are about to start throwing hands right in front of you over who gets dibs.

those guys cause the most paperwork. and half the time they’re snapped up by the same zoo or wildlife preserve that gets their colony of ivory-billed woodpeckers or Carolina parakeets or — once, very memorably — giant fucking South Island moa, and they never even spend a day in Time Jail.

#purely notional fiction #time travel #actually the tropical fish guys are probably even worse than the bird guys #but they keep a lower profile so they’re harder to catch #time cops: fish & wildlife

[emberglowfox]

he did get those braids after all

#loz #totk #link #tulin #zelda #totk spoilers #my art #tulin's dialogue is the wikipedia entry for wind lol #and link is signing “bird” in the second panel #this is post-canon to me btw #zelda not keeping some light dragon traits even subtle is an attack against me specifically. cmon #also yes that's a sheikah tech right arm on link. do with this as you will #i think chilling and listening to people he cares about infodump is link's fave thing ever btw #sorry this is all u get from me tn im sleepy #sparks art

[shadowedge0-blog]

#pokemon #articuno #gotta keep birds chilled #but a freezer

[toastandjamie]

This is your daily reminder that Egwene the Pigeon is watching you and she is most certainly judging you.

#pigeon #bird keeping #pet pigeon

[poorly-drawn-mdzs]

Lap Pillow

[First] Prev <–-> Next

#poorly drawn mdzs #mdzs #wei wuxian #lan wangji #Confessions of a missed opportunity: I almost had LWJ in purple for this comic. #WWX gives him one of his layers to wear and it's never specified what colour it is. #We all love the red inner robe from CQL (And other illustrations) but sit with me for a moment. Think about LWJ in Jiang Purple. #Right now. Close your eyes and give it 5-10 seconds of rotation in your brain. #Welcome back. It's beautiful isn't it. As I write these notes I am upset that I backed out of going through with it. #I think I will simply have to draw it another time. If we get gusu lan white wwx we *need* yunmeng jiang purple lwj! #Anyways; this comic is the pinnacle of teen wangji's bursting-at-the-seams-emotionality that I love him for. #For my sanity I need that teen losing his mind and following bird rules (get fluffy - get blushy - keep beeping) #He is a loser nerd with a begrudging crush on a boy that he doesn't know how to be normal about. #LWJ seems like your typical 'cool guy love interest' until you realize that he's actually kind of soggy and pathetic. #My favourite lan wangji trait is that he's funny as all hell. I feel like wwx a bit because I had a character epiphany when I realized this

[halorvic]

Futurama S11E07

#sigh. #sars cov 2 #covid 19 #futurama #gotta love how they are once again downplaying the seriousness of the developing h5n1 situation too #definitely not concerning that many mammals in the wild are being infected by birds #and definitely not concerning that cows and chickens are being infected now #and about 3 detected cases in humans (so far) #it's nothing serious anyway - it's not like viruses can keep spreading and mutating if left to spread without appropriate mitigations! #that's never happened before! it's definitely not happening with anything else right now! #''ABC'' right???? #so weird and ''random'' that cases of rsv flu tuberculosis mpox measles are popping up constantly everywhere these days right?? #love this new normal!!! #ppl continue killing and disabling themselves and other ppl and FOR WHAT #FOR FUCKING WHAT

[kedreeva]

I'm so sorry, I'm absolutely losing it. I went to my neighbor's today to find out what I would need to do to care for their puppy this weekend, and This Fucking Thing appeared ajgldfkjhfg she is a turkey hen. you know, the birds who quite famously look like this

with no feathers on their heads, or very little, mostly along the spine/top of the head... and this gal just rocks up with not only a LITTLE bit of feathering, but almost completely covered. Even her WATTLE had feathers.

I'mc rying

i said, what the hell is going on here? and they were like

her name's Fluffy

#turkeys #turkey #birds #bird #I can't #I wheezed laughing #MA'AM PLS #I have seen some hens with a LITTLE extra feathering #like a thicker mane down the spine #or a little extra around the ear feathers or something #but never like this #this gal heard “bearded hen” and got the SPIRIT all right #look at her little fuckin' eyebrows!!!! #GOD if I wasn't neck deep in peafowl breeding I would take her to breed feathered-headed turkeys #I would just keep picking the ones with the most feathers on their heads until they were plumed

[rust-berrie]

them and their birds <3 (happy 8th anniversary to stardew valley!!!)

#my husband (emily) #and my wife (shane) #stardew valley #sdv #stardew valley fanart #stardew valley art #sdv fanart #sdv shane #stardew valley shane #shane stardew valley #stardew shane #sdv emily #stardew valley emily #emily stardew valley #stardew emily #my art #this was supposed to b a trio thing with eli (my farmer) bc he keeps pigeons/doves #but i felt too cringe to share it lol #just know they’re a bird trio #i messed up so bad on emily’s rendering oopsies #IM SO EXCITED FOR THE UPDATE YOU DONT EVEN KNOW

[hellsitegenetics]

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

#hellsitegenetics #faq #intro post #flowers #plants #requests #birds of paradise #asks #remember to keep checking back!

[pythnensis]

i'll keep all my plans close to my chest

alt ver and initial sketch under the read more :3!!!!

#sorray if it looks weird. i still don't quite understand how to go from greyscale to colors!!!! #i might keep drawing birds w kzm sorry for being a bird head.... #my art #digital art #art #artists on tumblr #fan art #kazuma asougi #kazuma asogi #asougi kazuma #asogi kazuma #the great ace attorney #ace attorney #great ace attorney #dgs #tgaa #大逆転裁判 #dgs art #“thanks ryutarotakedown for the alt text :3!!!!!!”