Unplanned - Chapter One
Silco x OC canon divergence AU (NSFW)
Warning tags: Lactation kink, canon typical violence, MDNI
Summary: Silco gets more than he expected from a girl who sweeps him off his feet. Literally.
Link to it on Ao3 here
Micheal pushed her way through the tight alleys, panting heavily and barely able to hear the racing feet behind her over the sound of her heart beating in her ears. She hit a wall hard and pushed herself off it to get leverage down the next alley, this one wider and leading out to an empty street. She'd be able to at least fight with that much space. She hoped.
A quick glance over her shoulder as she neared the street had mismatched eyes falling on the five men who were stumbling over each other as they bounced off the same wall she had. Too close now.
The air was abruptly knocked from her lungs as she exited the alley, slamming right into someone and toppling them both to the ground. She spun her head to finally look forward and found herself on her hands and knees above the very pissed off Eye of Zaun.
Fantastic.
Her lungs hadn't quite gathered air back yet so she didn't say anything as she quickly rolled off of him and looked to the men who had been chasing her. They still seemed hellbent on finishing this fight until they caught sight of the man on the ground next to her. They couldn't have run away fast enough.
Micheal panted and looked to the older man who was seemingly as winded as she was, though she had a feeling most of his panting was out of anger. "I am so sorry." She breathed out, pushing herself to her feet and holding her hand out to him. Despite the sting of him slapping it away she didn't blame him, watching as he got to his feet on his own.
Silco opened his mouth to snap at her but the words died on his tongue as he finally got a good look at the girl. Now, a normal person would think that's not something you see everyday, but Silco was not normal and he did in fact see that every day when he looked in the mirror. Still, it was quite a shock to see the girl with a pure black left eye, like his just without the burning orange iris. She seemed to notice his shock and he quickly steeled himself. "It would be wise of you to watch where you are going." His words were thick with venom, dripping heavy with each one despite him still staring into her eyes.
"Was more concerned with what was happening behind me." Micheal retorted, brushing some gravel from her bloodied palms after the impact with the ground. "But I'll be sure to watch where I'm going next time I'm being chased." The displeased look on the man's face made her tense. "Sir."
Silco stared down his nose at her, seeing how she didn't exactly cower away from him, more so playing nice than actually being intimidated. Most people would be scared shitless about looking at him, let alone running him down and then responding sarcastically of all things. He took his chance to look the girl over, intrigued by her now that he knew she wasn't terrified like most. Long black hair was done up in a single braid that hung over her shoulder and fell down to her hip. She was wearing a button up dress shirt that rivaled his in red, though it was clearly matched to her blood red right eye. It was tucked into a pair of black dress pants, suspenders hanging by her thighs, used for fashion more than practicality. Not one he'd lose in a crowd. "Why were they chasing you?"
"Bumped into one of them." The girl shrugged, rubbing her shoulder at the memory.
"You seem to have a habit of that."
Micheal snorted softly and shook her head, arms folding across her stomach and it was clear now that she had bruises along her arm. "Blind in my left eye. Not easy to watch where I'm going." She shrugged again, used to running into things, her hip also bruised in multiple places from walking into tables. Her depth perception sucked.
A soft hum left the man and his lips curled up in a small smirk. "I suppose I can forgive you for running into me then. This time."
The girl laughed and caught his gaze. "I appreciate it. Didn't really want to die today." She teased, rocking from her heels to her toes. It was her turn to look the man up and down, pleased to finally see him up close after a few glimpses in the streets. He wasn't as scary as people made him out to be, at least not in looks. Who didn't have scars? Live down here long enough and you'll start to wear them proudly as a warning to anyone who tried to fuck with you. Look what I can handle. "Well, I hate to keep you from whatever business you have. Sorry again for running into you." She beamed and went to leave, blinking in surprise when his hand caught her elbow.
"Do you have somewhere you need to be?" Silco asked curiously, not wanting this girl to slip through his fingers. It wasn't just her eye drawing him in, but he'd admit it was a major factor. There was something else though, like a whirlpool around her that swept him in the moment she got close. He wanted to know her, even if it was unorthodox of him to do so. He made the rules, and he could break them.
"Not at all, just assumed you did."
He smirked slightly and nodded his head in the direction of the Last Drop. "Allow me to buy you a drink."
Micheal couldn't help the soft snort that escaped her. "Wouldn't it be free for you?"
"Humor me."
She laughed but nodded, ignoring the twinge of loss she felt when his hand left her arm. It was a gentle hold, even more so than she expected considering this man's reputation. The girl easily fell in step behind him and followed the crime lord to his club. Not something one does every day. Still though, the moment he didn't stab her from crashing into him she felt at ease just talking to the man.
Its was pretty early in the evening and yet the music from the club vibrated the ground beneath her feet as they approached it, the double doors being pushed open for the man and subsequently her. The crowd parted for him as well, just enough that she occasionally had to push some people away if they cut between her and the crime lord, despite being practically on his heels.
The older man lead her up the stairs to the second floor, private booths lining the walls and he took one next to a closed door with two guards outside of it. A wave of his hand had the girl sinking into one side as he stood in front of the table. "Give me one moment." He said just loud enough to be heard over the music before he moved to the door and stepped inside.
Micheal glanced around before she shifted a little further into the curve of the booth so she could see her surroundings better. She caught the glimpses of a few people at other tables, the weight of their judgement hitting her heavily. Even as she dropped her gaze she could still feel theirs burning into her.
It wasn't until Silco returned that she finally looked up, watching as he sat and carefully slid himself just a little further into the booth than necessary. "Can I ask how you handle it when someone shows damn near disgust purely for your eye?" As she spoke she absently leaned her head into her hand, cradling it in a way that kept her eyes from view of others in the club. She opted to stare at him, noting that he was now sans coat and had a cigar between two fingers, a lighter in his other hand.
Silco frowned slightly at the question and looked out over the club, seeing the ones whispering and how their glances locked with the girl but avoided him. "Usually I stab them in the eye." The laugh he got from the girl made him smirk, seeing her shoulders ease. The moment she looked away he caught the eyes of a guard over her shoulder and glanced at the table across the way, a silent command to rid whoever it was from his club.
"I guess that's one way to handle it." Micheal smiled, keeping her gaze either on Silco or the table until someone approached.
"What would you like?" The older man asked, fingers gently drumming on the table.
"Whiskey sour."
"Make it two." Silco said to the waiter who scurried off.
It was once he was gone Micheal saw that the group of people in the booth across the way were being forced out, glancing over her shoulder to see one of the guards was gone from his post at the door. "I look away for two seconds." She laughed, shaking her head. "You didn't need to, I may hate the staring but I can ignore it."
"If they're staring at you for your eye, then it's an insult to me as well." Silco said with a clipped shrug, lighting the cigar in his hand before bringing it to his lips. "Besides, I'd prefer to have all of your attention at the moment." The words fell from his lips along with a cloud of smoke.
Even with all the flashing lights, Micheal was positive her blush was visible, cursing the heat that only burned more when the man smiled as he noticed. "You have it."
"Excellent." Silco smirked, only breaking eye contact when their drinks were served before he turned back to the girl and raised his glass. The soft clink of their tumblers was drowned out by the music, his gaze glued to hers as he took a sip, deft fingers barely holding the edge of the glass until it was set down. "What's your name?"
Micheal laughed softly as they clinked their glasses together, humming at the question. "My name huh? That's a tough one. I don't normally tell people my actual name unless I trust them to keep it a secret. Can I trust you?" The question was about more than just her name, the obvious weight of it resting heavy in the air between them.
"You can." Silco said through another puff of smoke, lips curling into another smile as the girl leaned in closer.
"Most know me as Micheal, but you may call me Nina." Her voice was just loud enough for him to hear, but even so he had shifted in more to catch every syllable. The pleased look on his face made her shiver slightly and she grinned as she sat back and sipped her drink.
"A lovely name, for a lovely woman." He purred the words as he tapped his cigar over the ashtray at the center of the table.
"You flatter." Micheal laughed, though once again she knew he could see her blush. "Am I allowed to use your name or is it strictly sir?" She once again rested her face into her hand, cradling her cheek so she could look straight at him and only him.
A small hum left the man as he mulled over the answer despite knowing he wanted to hear her say his name. "You may use it." He said the words casually like it was no big deal when they both knew that it was.
"Wonderful." Micheal smiled but didn't say his name, the dark thrill of a look in his eyes all she needed to know that he was enjoying the playfulness. "So tell me sir, what's it like being the most dangerous man in the Undercity?"
"It has its perks." Silco chuckled as he brought the cigar to his lips. "For example, I can easily threaten someone to say my name if I need to."
The girl quirked a brow and grinned. "Oh? And what sort of threat would that be?" Her mismatched eyes widened as a hand slid beneath the table and over her thigh, squeezing and dragging fingers enough to part her legs.
"The threat of not going further." Silco said casually, like his hand wasn't slipping higher up her thigh, stopping just before his fingers brushed against the seam at the center of her pants.
Micheal's blush was undeniable and she squirmed in her seat, looking around as if someone might see despite the dark room only being lit up by strobing lights. No one could see. No one would notice if she rolled her hips forward, so long as she kept her face passive. "That is quite the threat." She downed the rest of her whiskey and caught his eyes with her own. "If I give in, will I be stuck in this booth with just your hand to satisfy me?"
Silco's eyes were dark and his lips were glued upwards in a smirk. "I'm sure we can come to another arrangement, though I do like the idea of watching you squirm in a room filled with people none the wiser." He purred lowly, running a single finger along the seam of her pants just to watch her shiver.
"You are an evil man~" Micheal laughed, keeping herself from pressing into that teasing finger. She spared a glance out into the club again, over the side of the railing to see a portion of the room below. Mismatched eyes followed the rhythm of movement until she spotted someone who seemed utterly out of place as they stood stark still amongst the mass of dancing figures. Her body reacted before she even properly registered what she saw, grabbing Silco's vest and tugging him down into the booth as a bullet hit the cushion where his head had been. It came as no surprise when the crowd below went into hysterics a moment later as the shot was undeniable despite the blaring music.
A hand slid around the wrist that she only realized was still grasping the crime lord's vest when she felt it, drawing her gaze as he pulled her with him out of the booth and to the door behind it. The guards in front had already opened it, and the moment it shut she heard them shouting at the droves of people pushing their way out of the club.
Micheal said nothing as they climbed another set of stairs, a hallway at the top that he lead her down before pushing open a door and pulling her inside. She barely got the chance to see she was in his office before her back was pressed against the door, his body against hers. Her mouth opened but all words died the moment his tongue met hers, eyes falling shut as she slid her arms around his shoulders and tried to tug him even closer.
Silco wasn't used to people saving his life if he wasn't paying them to do it, so it was quite a shock when he heard the shot the instant he was tugged down and out of the way. Oh he definitely wasn't going to let this girl go. The man all but dragged her up to his office, breathing sped up from adrenaline and his want for her.
The second they were alone he was on her, leg slipping between hers as their mouths met. The moan that slipped from her lips was all he needed to hear before he started to undo the buttons of her shirt, getting annoyed at the last few and ripping the rest of the garment open. He pulled back from her mouth and nipped his way down her jawline, across her throat where he made sure to leave deep red bruises, and down her chest. He kissed and bit at the top of her breasts, a hand sliding up from her waist and to her back where he eagerly snapped the clasps of her bra undone.
Micheal panted softly and moaned as his mouth trailed down her body, whimpering when he sucked hard on certain spots. Her hips rocked forward along his thigh and she bit her lip as her gaze fell to watch him. The hungry look in his eyes had her throbbing and she pushed him away so she could slide her shirt off, the bra falling to the floor as well. Her head hit the door as the man got back to work, chipped teeth and hot tongue finding their way to her nipple, fingers pinching the other.
"F-Fuck Silco." She finally let his name slip past her lips, the growl he gave in return making her shudder. A gasp left her a moment later as his hands slid beneath her thighs and lifted her up, the man deceptively strong as he carried her to his desk and nearly threw her onto it.
Silco stared down at her, panting as he ran his hands from her throat to her chest, briefly squeezing her breasts before going lower and catching the button of her pants. Once again he worked quickly to get it and her zipper undone, smirking as she lifted her hips so he could tug her pants off. The deep blush that hit her cheeks when she realized he'd also pulled her underwear down as well had him chuckling lowly. "No time to waste~"
Micheal laughed a little breathlessly and let him pull her pants off after a hasty removal of her boots as well. She bit her lip and spread her legs for him as he took in the sight of her, propped up on her elbows and looking at him with a hunger rivaling his own. "Then you better hurry up." She teased, giggling when he tugged her to the edge of the desk before he started to undo his own pants. Four buttons popped and he pulled himself free, her eyes widening at the sight and she had to shut her mouth before she started drooling. "Holy fuck."
Silco smirked and stepped forward, humming as she wrapped her legs around his waist. "Beg for it." He purred as he teased her clit with the head of his cock.
Micheal moaned and shivered at the touch, biting her lip as she looked up at him through her lashes. "Please, please Silco I need you." She pleaded, body jolting whenever he'd drag himself over her clit. "F-Fuck fill me please!"
The older man chuckled at her, watching how she so easily came undone. "Good girl~" He said lowly, lining his cock up at her entrance and pushing himself deep in one smooth thrust. The wet heat was incredible and he groaned as he braced one hand on the desk at her side, loving the way she arched up into him.
"O-Oh Silco...!" Micheal whimpered and fell flat against the desk, his cock so big and stretching her so wonderfully. The twinge of pain mixed with pleasure and she rolled her hips against his, groaning at the feeling.
Silco hummed and leaned over her completely, catching her lips in another hungry kiss as he pulled himself out to the tip and then snapped his hips forward. Her cry of pleasure dripped into his mouth and he moaned, starting a rough and fast pace. His lips once again found her jaw, moving lower and lower until he was at her chest again. This time he started with the other nipple, having neglected it before and was making up for it now.
Micheal whined and arched up into his mouth, threading her fingers into his hair and gasping when it earned her a borderline painful bite. "Sil-ah! S-Silco...!" She couldn't form any other words, his name dripping from her lips.
Then the man suddenly stopped everything, pulling back and she didn't know why until her gaze fell to her chest. Her cheeks burned a bright red with embarrassment and she sat up, placing a hand over her chest and the her now leaking nipples. "I-I'm sorry–" Her apologies were cut off by his lips on hers, a firm hand pushing her back onto the desk while the other moved the arm she had covered herself with.
"Don't apologize." There was a kindness in his gaze, mixed in with a new hunger she didn't expect. "Just tell me if it starts to hurt." He moved back to her chest and caught a nipple between his lips, moaning around it as he started to suck the milk from her.
"O-oh fuck...!" The girl's head hit the desk again and she whimpered loudly as not only did he start to milk her but his hips started up even harder than before. "S-so good!" She cried out, fingers moving to tug at his hair as his hand cupped her breast and squeezed. The pleasure was intense and she could feel that wonderful heat pooling in her core, whines and moans leaving her freely.
Silco did not expect that but he couldn't deny how his cock throbbed as realization dawned on him, the sweet taste on his tongue making him want more. The moment his lips were wrapped around her again he was sucking hungrily, blue eye falling shut as he savored this moment. He got lost in his actions, moving from one nipple to the other, hips rocking of their own accord while his hands and mouth worked on milking the girl of every last drop.
It wasn't until she nearly screamed his name and tightened around him did he get pulled from it all, his forehead falling between her breasts as he moaned and his hips started to falter. A few thrusts later and he buried himself deep as he came hard, filling the girl with every last drop before he slid his arms beneath her and pulled her against him. He panted against her skin and kept his face buried until the high wore off, slowly releasing her and standing up a little straighter to admire the complete mess she was.
A bit of clean up and redressing had the girl sprawled out on his couch, bra still off as her nipples were quite sensitive now. An arm hung over her face as she rested, not having been fucked like that in ages.
Silco sat behind his desk, cigar between his lips as he reorganized it, papers having been crumpled or mixed around during their moment of fun. He tapped his fingers along the arm of his chair absently, a thought nagging at him but he wasn't sure how to broach the subject other than just being blunt. "You have a child."
Micheal blinked behind her arm at the words, a soft hum leaving her. "I had a child." She corrected quietly, letting her arm fall and head tilt so she could catch his gaze. "My daughter was killed a couple months ago...she wasn't even a year old yet at the time..."
Silco felt his chest tighten and he pushed himself from his chair, crossing the small gap between them before he sat on the table in front of her. "What happened?"
The girl sat up a little, mismatched eyes dull with sadness. "My sister gave birth to a still born, and it drove her insane. She killed many people that day, including the children of our other siblings." Her voice was quiet and she let herself fall back to the cushion, staring up at the ceiling. "Been trying my best to not let it get to me, to not end up like her." A hand slid into her own and she squeezed it, turning to look at him again. "I'm fine..."
Silco brought her hand to his lips, placing a gentle kiss along her knuckles. "I...may not know the loss of a child, but I know the betrayal of someone you considered family."
"Is that what caused this...?" Micheal reached up and gently cupped his scarred cheek, her thumb brushing beneath his black eye. "What did you do about it?"
The older man sighed through his nose and nodded, instinctively leaning into her touch. "It is." He squeezed her hand gently, his free one stroking the soft skin of her exposed arm. "I killed him."
The girl hummed and nodded. "I killed her too." She admitted quietly, relaxing into the couch more at his touch. "You know...I never thought I'd relate to the Eye of Zaun so much~" She teased, lightening the mood a little. "Come on, I don't want to spoil such a good time."
Silco managed a soft chuckle and nodded, kissing her hand again. "Would you like another drink?" He placed his empty hand on his knee and pushed himself to his feet, fingers still holding hers until he walked far enough away they slipped free.
"Yes please." Micheal hummed, sitting up enough to prop herself up on the arm of the couch, already missing his touch. "Another whiskey if you have it."
A deeper chuckle this time, mismatched eyes glancing back at the girl. "Its all I drink~"
The girl laughed through her nose and shook her head. "We may have too much in common, Silco. It's becoming eerie." She cooed, reaching out to take the glass handed to her. "Thank you."
"Perhaps, though I find myself enjoying it." Silco admitted, gently lifting her legs so he could slide into a space on the couch before letting her rest her feet across his lap. "Wouldn't you agree?"
"Wholeheartedly." Micheal smiled, letting the man shift her around and sinking a little lower into the cushions as she sipped her drink. "Are you going to find out who took a shot at you? I got a pretty good look."
"I'm not going to do anything. If my men know what's good for them they'll be in the streets searching right now." Silco said with a shrug, pulling a cigar from a tray on the small table next to the couch, an odd placement since it was unlikely he shared them with guests.
Ah. Its because he sits here and can't be damned to cross the few feet to his desk to get more.
Micheal found herself laughing softly at the revelation, watching him take a drag off the cigar before leaning his head back and blowing rings of smoke into the air above them. "I'm not sure if anyone's told you recently, but you're so fucking hot." She purred, seeing his blue eye widen slightly and a smirk grace his lips once again.
"You flatter~" He echoed her words from earlier in the night, taking a sip of his own whiskey. The hand that held his cigar rested on her leg and he absently smoothed a circle with his thumb over her. "But I will be honest and say no one has ever said that to me."
Micheal nearly choked on her whiskey, sitting up and looking at him with wide eyes. "Are you serious? No one?" She set her glass down and shifted herself around until she was straddling his lap, hands on his chest. "Then I suppose I will have to tell you how hot you are a lot more huh?" She grinned and caught his lips in a sweet kiss. "Honestly I've seen you walking the streets before and couldn't tear my eyes away, though I'll admit I was terrified of ending up on your bad side." She ran her fingers along his scarred temple and into his hair. "Had I known what it would be like on your good side, I'd have run into you sooner~"
Silco shrugged slightly at her astonishment, not willing to admit any previous trists he'd had were because he paid for them. No one wanted to sleep with a scarred man. An evil man. At least, not until now. He looked up at the girl in his lap, a hand on her thigh that still held his fizzled out cigar. The kiss was short, sweet, and he found himself wanting to follow her lips when she pulled away. A smile formed on his lips as she spoke, setting down his glass so he could reach up and take hold of her face.
Instead, his hand wrapped around her throat.
"Some people, they're good at lying. Others, well, they lay it on too thick." His voice was low, bored even. His grip tightened as her nails dug into his wrist, those wonderfully mismatched eyes of hers wide with fear.
"N-not...a...l-lie." Micheal wheezed out the words, tears pricking her eyes as her vision started to darken. "S-Silco..." She did her best to focus on his gaze, tears finally falling as she reached out and gently placed her hand on his cheek, finger swiping beneath his fiery orange eye before the world went dark.
16 notes
·
View notes
12 notes
·
View notes
WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
The ultimate shadow ban survivor guide
I've seen multiple people I follow, or their mutuals affected by shadow bans lately (makes me wonder if it's @staff's attempts to fight bots going totally haywire). As someone who survived a 2-month-long shadow ban on my main this winter, I thought I'd make a post.
First step of being shadow banned: calm down and take a breath. A shadow ban is just a stupid glitch in tumblr's anti-spam system. You're not losing your blog. You're gonna need a whole lot of patience, and deal with inconveniences, but it's fixable.
Read the incredibly useful post All About Shadowban by @that-damn-girl. It outlines the symptoms quite well. The only thing I'd point out is "your original posts won’t be visible to your followers either" - afaik that doesn't happen. Everything you post and reblog will still be visible to your followers, and also they can interact with your posts - like them, reblog them, reply to them.
Just like the post says, contact support. I recommend using a different email than what your banned blog is registered to; not because your ticket won't go through (mine actually did, as I found out when they finally replied), but because you might not receive an email confirmation for your ticket (it's somehow tied to the anti-spam thing, I think), and you're going to worry and try to send more tickets, like I did.
Now wait. And wait, and wait, and wait. They are SLOW. I've seen some miraculous 1-day unbans in the #shadow ban tag, but most people, like me, wait around a month for support to reply. Those are the same guys going through thousands of bot reports every day in addition to user tickets.
If you're going to wait, might as well keep blogging. Now if this is your sideblog that's shadow banned, consider yourself lucky. Make a new temporary sideblog, use it to post your original stuff so it goes into tags (mind that it might take a few days for a new blog to start showing up in tags). Reblog everything to your shadow banned blog so you still have all content in one place and your followers see it. If it's your main that's banned, you can still do that, but there's the extra pain of not being able to reply to posts or send non-anon Asks, since that is only done from main. Might need to register a separate account for that.
Some more fun facts under readmore.
Fun fact #1
Trying to send support follow-up emails in the request confirmation email isn't going to do anything to speed up the process. But I did tweet at them using this tumblr support summoning picture by @cornmayor and offered a raccoon blood sacrifice to resolve my issue when it was like a month with no response. This is what they replied.
3 hours later I got an email that my shadowban was lifted. I honestly don't know if it was a coincidence, but I mean, this is tumblr staff. Maybe they do accept blood sacrifices.
Fun fact #2
If you're wondering why my shadow ban lasted 2 months if I got a support reply after 1 month, well. It's hard to say exactly how their ban/unban system works bc support replies exclusively with pre-written template sentences, but basically they fucked up. The first time they told me my blog has been restored, I gained pretty much all functions back, except that my posts were still not appearing in tags. Which means probably that being hidden from tags is some kind of different flag on your blog that they forgot to remove. So I had to send a follow-up ticket and wait another month.
My advice is, when they tell you it's fixed, don't take that at face value, go and check all the functions you'd lost (replies, messaging, asks, tagging, appearing in notes, getting mentioned by others).
629 notes
·
View notes
I’ve been so ill this past few weeks and been hospitalized because of medical concerns. Found out that I have a tumor and it was already malignant. I have a Stage 2A Cervical Cancer and needs help ASAP. 🥺
GOAL: $1800
Oh this is gonna be so fun. Buckle up, children, time for
✨SCAM EDUCATION✨
1:
Someone you don't know sends you an ask and asks for money
This in itself is an alarm bell. Maybe you're used to it if you're a big account, but if you're a smaller one that alone should make you suspicious af. This user does not follow me nor do I follow them. The only case in which this is acceptable is if you're running a donations blog (you know, the ones who collect people in need and make periodic posts to boost them? Which are way more expert in checking for possible frauds, or so one hopes)
2:
If you scroll down their blog, they're very recent
This is their first ever post, notice the time stamp. If it's still active when you're reading this, you can check yourself.
It's even worse because, while it makes sense for someone very desperate to open accounts on any social media that comes to mind and start begging, you scroll down their blog and their posts are mostly untagged gifs of popular shows and scantily clothed women. Which in itself is not a crime, I often do it too (though I don't go around asking money to strangers) but when you've known for weeks (see pinned post) that you were sick, and your blog is only 5 days old, I would expect at least one post about it other than the pinned one, no? Or even just one single original posts instead of only reblogs and one answered ask to another 6-days-old account
Also I'm not one to judge others' sexual preferences but if you're a mom I would expect at least one of the thirsty posts to be about a man, but oh well. Definitely not enough
3.
Check for others' warnings
There's a whole blog dedicated to listing all the scammers here in Tumblr, but I can't fucking member I should follow them if and when I remember
The fastest way is to search for their PayPal account name. First, though, you have to be CAREFUL about clicking suspicious links - always copy the link and paste it in the url bar to quickly check where it redirects you. In this case I saw It did redirect me to PayPal, and I did load it only because I don't have any PayPal app or credentials saved on my phone, so I don't risk payments or credentials getting sent automatically.
Unfortunately this must be quite recent, because searching for Christine Owaga (this guy^'s PayPal) only got me some Facebook accounts, and I don't remember my password so I'm not gonna check those.
However, since this is an ask on Tumblr, I looked on Tumblr for terms like "scam alert", "scam warning", "donation scam" and so on, and I did find something interesting:
Same exact message several times, more than one account, only one of which is still active.
Then I scrolled a bit more and found this one with a sliiiightly modified text, gonna bet that it's because that was when the victim brought a link to someone with a much bigger collection of receipts lmao just gonna link it here
The PayPal account name is different tbh, which means this dude is at least a bit smarter than an actual bot and knows how to spam semi-efficiently. Kudos!
This is not how a legit ill person should behave. Not even trying to bring some evidence, just leaving a trail of deleted accounts.
Gonna tag everyone I saw reblogging the scammer's pinned post so that they can delete it and maybe warn their followers (assuming they're not bots themselves)
@thecherry95 @back-in-19something @underthewingsofthblackeagle @fantasticcollectorkitten @takineko @razzgamer5 @jacks-ace @windywillows-world @aurelia-which-means-sunrise @comradesmooches @loch-tess-monster @urazayt @boodubious07 @satinfables @rateater69 @irontyphoonobject @blackfairyemoji @dannyfoggings @helloparzival13 @rusalkascave
63 notes
·
View notes
Here at i-am-an-arson-enthusiast, we i am dedicated to bringing you top quality content such as but not limited to: gay things, cats, and even live arson that you don't even have to tune into!!
hi this is my intro post :D
basic questions that i love answering
“hey what should i call you” good question. i dont really care, most of my mutuals call me arson. thats cool. bc i love arson. (clearly) but you can call me really whatever. planet names are dope as shit, but only @marcysbear gets to call me neptune. also enthu is off limits, only @terrifying-acceptance gets to call me that.
for the record: if you call me either of those names and are not either of them, that is crossing a genuine boundary of mine. you ARE NOT allowed to call me those names if you are not the designated person for that.
“ur gay” woah really i didnt know that ur like the first person ever to notice that!! (no ur not, ive known that for years)
“what type of gay” yes. the easiest way to explain it is bisexual. that being said: i use bisexual surprizingly little. i call myself lesbian and gay all the time (as in wlw and mlm). i’m arospec, i think im grayromantic? idk. but fun fact: it’s been over TWO months now of this identity crisis; my personal record :) also im polyamorous and will joke abt kissing u if ur cool with it :3
“gender????” im genderfluid. which explains the pronoun changes. im also trans, nb, genderqueer, and any of the genders and terms i need to articulate what the silly lil dudes in my head make me feel.
AUDHD :D explains why i am obsessed with space (going back to names planet names are cool and epic btw)
“do u horny post on main???” i reblog horny posts to my main but i dont normally do the original horny posting. tell me if i need to tw that btw :3
my cool and epic tags
i try to consistanly use them but sometimes i dont. sorry.
woah i’m using queue - i’m actually queuing a post for once instead of spam reblogging (which i mostly do sorry not sorry)
woah a real text post - me positing an actual text post for once but it’s becoming more common
cool ass art - art that i reblog (it’s all cool)
arson does half way decent art sometimes - my art. art i made. yea
the beloved - my beautiful beautiful queer platonic partner @terrifying-acceptance who i tag in a lot of shit :]
i will keep adding more as i remember them and make them so yea :D also i try to tag for things but i often dont add tw or cw because. idk. just havent ever done that. if you need me too you can tell me in any form and ill try my gaddamn hardest to add them. feel free to *kindly* remind me if i forgot. (as in no verbal abuse ya know. if ur scared ur probably fine)
the last section that is mostly important for followers :]
if u wanna follow me it’d be cool if you have a banner and pfp but as long as ur like not a bot ur good.
feel free to ask questions :) this is the point at which i tell you that i love getting asks and dms. my dms are always open unless i am dead. (current status: alive at very least.) also i am in school so you are practically guaranteed to get a response not immediately. give me 12-24 hours to respond before being offended. after that it’s fair game.
I genuinely do not care and give no fucks about what you believe and how you live your life as long as you dont hurt yourself or others, you are not offended by me being very not religious/spiritual and you do not shove it down anyones throat.
I mostly do reblogs and tag them as such half the time
lastly if you interact with this post it lets me know that you read it but i’m gonna look at your profile anyway if u follow me so you don’t have to.
thank you for reading all of that i know it’s long. your cool so here’s a cookie 🍪 also here have this
credit to @v-4-l-0-n and @theprideful :)
(order of the banners are “exclusionists fuck off”, then this user loves being a lesbian, gay, bisexual, trans, genderfluid, then non binary)
69 notes
·
View notes
things that will always make me assume a blog is a bot/spam account and not a real person:
the url is a keysmash, a name + random numbers, or a series of random words that tumblr probably generated itself
there is no blog icon
↪ there is a blog icon, but it's of a random beautiful woman
there is no blog title
↪ there is a blog title, but it's the same name/words as the url
there is no blog header image
there is no blog description
there are few or no original posts
↪ there are few or no original posts, just a tiny handful of reblogs
(any combo of the above tbh)
if you don't want people to flag your blog as spam and block you, i recommend doing the following:
come up with a unique url that reflects a personal interest
give your blog an icon. it can be clipart. it can be a picture of a tree. it can be anything as long as it's not a random beautiful woman.
give your blog a header image w/ the same guidelines as the icon
give your blog a title that's not just repeating your url
put something in your blog description that sounds like a human wrote it and not a machine (even just saying "hi i'm here to lurk and that is all!" can be enough to let people know you're real)
make a few unique posts or reblog things regularly using tags so folks can tell there's a person behind the postings
i realize this is kind of annoying, but it is necessary tbh. at least for me, as i've been having to block/report 500+ spam accounts per day for like four whole days straight now and i'm losing my mind. if you don't make it clear you're a person and not a bot on tumblr you're gonna get flagged and/or blocked. it's kill or be killed out here and you will be just another casualty of war.
12 notes
·
View notes
If you people don't start reblogging art (and writing!!!) I'm gonna start biting you
Look at this shit
These are the top 4 today, LESS THAN HALF of the people who liked it have reblogged. That first one especially makes me want to chew glass
Oh! But those are in the top today! So surely everyone will see them!? No?? A lot of people don't go into the tags! And also think how many more people would see them! You can only like something once! Even if every one of those only had 1 follower that's still roughly 300 more eyes on the work!!
But those are new, you say. Surely the older stuff isn't like this? Incorrect! Let's sort by top of the last year
TRAVESTY *bops you all with a newspaper* that last one is one of my all time favorites (I'm going to list them in a reblog, because I know sometimes too many links kills a post) it's an amazing piece of art and look how little love it has
It has FOUR TIMES more likes than reblogs???? Think how many people could've seen this artist's amazing work!
Excuses I see:
It won't fit my blog: a) you can make multiple blogs! This is my side blog, I made it in October, tagged things appropriately (used the good omens tag for a bit, I've dropped it now since), and have gained a nice handful of followers! That wasn't the point but I'm glad you're all here (hai!)
b) it's your blog! Use it how you want to!! "Oh people will unfollow me!" this isn't the I have followers klout website. This is the have fun and hope you can make someone else's day fun in the process website. If it sparks joy, reblog it!
I don't wanna upset op with spam: that does not happen here. Artists, writers, and bloggers love seeing you. Go nuts
Reblogging is time consuming: you can quick reblog (on mobile hold down on the reblog button and swipe up to the blog you want, sorry idk how on computer but I know you can) reblogging is only time consuming if you want to comment or tag. If you're willing to leave a reply you should have time to reblog! (Commenting and replying both have their place, it's ok to reply only while still reblogging!!)
Tagging things intimidates me: people carry on entire conversations in the tags, people leave the wildest shit as tags, people have confusing tags to organize their blogs, people leave absolutely no tags at all! You do not have to tag things!!
I have my likes turned on so people can see: you look like a bot, stop that. Empty blogs get blocked! I'm begging some of you to please reblog something. No one goes straight to people's blogs to look exclusively at their stuff (....ok well some people do but most people just scroll their dash)
Likes are bookmarks! That's it! Or a way to interact with some random thing someone said about their day that you can tell they don't necessarily need reblogged. This isn't twitter, where (apparently?) reblogging something is kinda frowned upon. This isn't instagram where likes mean everything. This is Tumblr, and it survives on reblogs!
7 notes
·
View notes
I'm going to be starting my very first commissions soon! I am very excited but do you have any tips on what I should and shouldn't do?
Oh that’s very exciting! Hmm I have a post somewhere but I’ll just answer anyways 😂 This is gonna be insanely long
- Don’t be disappointed if you don’t get a huge amount of people asking at first. It’s all about drawing people in and growing an audience! If you don’t have an audience yet, it’s always worth it to market and advertise pretty well. Multiple social medias, using common tags, promoting in say, is discord server if you’re in one or something, all that jazz
- Pricing is very difficult and it’ll fluctuate and change over time. You’re not gonna get it down first try, and they’ll change with your workflow and what you realize you can and can’t do/handle! Personally, I took the amount of time I take on each canvas and estimated some average times (I.e. a rendered bust takes me 1.5-2 hours) and multiplied that by ah, $30 I think at first? And then doubled my prices later down the road
- Additionally however, pricing in such a way that you make good money for your time is important but, and I can’t stress this enough, PLEASE consider the people you’re advertising your work to and who follows you, what communities you’re in, etc. For myself, I’ve recently began to aim for higher quality clients who can pay more all at once and so I can get more money with less commissions stacked in my queue. Thus why my lowest price is still quite high. If you want more frequent clients, most often it’s best to keep your prices relatively low but still good value for you. Again, it’s all about finding that balance and figuring out your workflow
- Speaking of workflow, there’s no one right way to do commissions. Your process is your own and from my experience, I’ve gone through a bunch of different processes with different people! Haha, I’ve even signed a contract once to really seal the deal on the terms and conditions. Make it your own! Be as professional as you feel the need to or not. Do whatever makes you comfortable as long as it’s not at the expense of the client, of course
- You may or may not be contacted by spam bots and other accounts about your work. Believe me, it’ll happen once or twice that you might be scammed if you’re not careful (it’s happened to me twice) but if I could say, it’s usually accounts with names that don’t match their icons, using little/terrible punctuation and very automated repsonses, requesting work that’s not what you do usually, requesting work of family members/pets, offering very large sums of money, whatever else. Just be safe!
- Hmmm what else….
- Make sure you have plenty of examples of your work and the style of art/coloring that you’re advertising. If you’re offering something new, just get like 3-4 examples in and have a consistent process before having people pay money for it. I love my current rendering style but I had to wait til I had a few to know how I wanted to go about offering it as a new coloring style and how it’s different from what I would typically do
- Some clients are definitely rude and pester. It’s okay to put your foot down and say you’re not comfortable working with them. Personally, I offer up other artists if that’s the case (within reason, I don’t send rude people generally but sometimes clients get frustrated with you because you’re not the kind of artists they’ll end up wanting to work with) or if I’m just not able to do a commission because it’s, for example, out of my skill level or something. Always good to send people to artists who are open for work
- I’m actually learning this myself but if you’re working with someone who’s well known (I.e. I worked with good ol Xisumavoid), having T&Cs is useful for those larger clients. Xisuma actually gave me his terms and conditions to fill out in the invoices so if the client has that as well, it works that way too! And again, if you have questions or you’re uncomfortable by someone else’s T&Cs, say that! Believe me, they’ll work with you if they truly intend to use your work (bless that man, he was so kind and transparent about the whole process)
- Of courses you are just starting out but you never know!
That’s pretty much he main stuff. Just make sure it’s seen and clear, you’re valued and understand your value, and that everything you’ll be doing is all up to you. If you have artists friends (or myself) that you’d ever need input from, give them (or me) a holler! This is all just me, other artists have more or different ways they’d suggest going about things so if you don’t agreed with anything I’ve said, that’s alright 😌
50 notes
·
View notes
d:\users\junggunz\rules
fuck it we ball. i'm making my inbox guidelines a separate post to clean up my pinned lol. it's a long, long post but you can find important info like how i deal with my inbox, what i don't write, trigger warning tags, and my anon list.
HONESTLY it's the most important thing to read on my blog
you're getting blocked if... if you're racist, homophobic, transphobic, fatphobic, a terf, a partypooper, can't seperate fiction from reality or if you're gonna send anon hate. i'll tolerate blank blogs but if you don't have at least title/description/profile picture, i'm gonna ignore you like you're a bot lol.
if you wanna be mutuals, just ask since this is my sideblog!!!
˚◞♡ i take requests for smut drabbles and oneshots for character x fem bodied reader. i am also open to requests for gn! reader. just specify (´。• ◡ •。`) ♡
˚◞♡ all 'requests' sent to my inbox are currently being treated as suggestions because my to do list is long af and i write soooo slow. buttt active members of the first church of junggunz get priority when it comes to requests! plz plz plz don't rush me since i write during my free time. if you want to commission me to write something, that's different.
˚◞♡ i try to be as inclusive as possible so i'm usually vague with the reader's appearance and don't use too much gendered language. y/n in my writing's only set physical trait (if mentioned) is that they're shorter than the character.
˚◞♡ i'm really good at keeping my masterlist updated so ALWAYS check my masterlist first before sending in requests for things like prompt games.
=͟͟͞♡ I DO NOT WRITE: incest, lolicon/shotacon, ddlg dynamics (daddy as a title is fine), age regression, pegging, character x character, male!reader smut, cbt, anything involving bodily excrements that aren't cum or saliva etc...
=͟͟͞♡ sidenote: if you're unsure about whether i'll write something, just ask! i'm really nice unless you're rude first. once again if i've decided to write your request, it'll be in my updates section! i'm running on one brain cell, so please don't rush me or spam me with the same request over and over.
also please keep in mind, if you request anything from me, i have the right to not fulfill it. not only do i write for free, your request may be out of my comfort zone or i just straight up don't know how to write it. once again, i'm writing everything with one brain cell and she gets tired.
✧˖° tw tags are... tw: noncon, tw: dubcon, tw: drugz, tw: yandere, tw: stepcest, etc. (if i need to add more things, i will.)
𝖆𝖓𝖔𝖓 𝖑𝖎𝖘𝖙
hehehe if you'd like to be one of my anons, just send me an ask with your preferred emoji, name, charanon or whatever.
ex. "hi, can i be 🤰anon?" or "i love the pregnant emoji - 🤰anon"
₊˚⊹♡ emoji anons
🐻 | 🍷 | 🦢
₊˚⊹♡ named anons
none yet!
₊˚⊹♡ charanons
dg anon 💕 | gun anon ☁️ | jake simp anon ❤ | vinny anon ✨
i might start a taglist but...too many of y'all don't have your age in your blog so we'll hold off for now.
22 notes
·
View notes
(an edit later pinned post cause its late asf)
DNI and Blog Rules I Guess :]
Honestly I don't have much that'll be here-
All that matters to me is that everyone's respectful and lets this be a safe space for everyone :]
The only people who are on the DNI list are:
1. Homophobes
2. Racists
3. Proshitters (Proshippers)
4. People who choose hate over kindness :(
Honestly what's important to me is that you're respectful and treat everyone here nicely! You guys all deserve kindness <3
Proud of all of you guys and I love ya!
Take care of yourself and feel free to vent on any posts that are marked as vent posts- Other than that I'd prefer to keep the comments chill!
Also I’m blocking empty blogs that don’t have a unique pfp or bio, just- don’t look like a bot ig?
I used to be @soup-ig but when trying to delete my old spam account, i deleted the entirety of my tumblr account and lost everything :,3
I’ll link a post to catch you up to speed on what my old account had that was important: HERE
Another important vent post I feel that ppl might want to read: HERE
Also gonna just say that if you’re interested in finding a new, small streamer to watch then go to THIS post! I love this person very dearly and I’m hoping to help her get at least a little traction :3
Anywho, love ya guys!! <33
Also the tag(s) below will be:
#reblog cause my old account no longer exists 😭 - self explanatory
#soupy thoughts - my rambles
#soup rambles - another rambling tag
#soup speaks - why do i have so many tags for my rambles???
#soupy reblogs - might start tagging stuff i reblog? not sure yet lmao
#soup rants - again, self explanatory
24 notes
·
View notes
Abt me/this acc!
You can skip to dni!
Name - You can call me any of these! - Fang, Lupe, Echo/Ecko, Lobo, Wolfie, Wolve or Pup ☆
+ petnames/titles?: puppy/puppie/pups/pubby (any variation really) puppa, papa and dada (im okay with anything really though feel free to ask about any others!)
Age - 20
Pronouns - he/they/it + neopronouns: pup/pups, canine related neos!
Likes/interests - kpop, anime, sanrio (puppies) animal crossing, cookie run, genshin, idv, collecting plushies + stickers
I am a pet dreamer/regressor aswell as a dog/wolf/canine therian/kin and furry, though i am a cg/handler too! (Both coping mechanisms!) Interested in a cg (puppyreg) and/or pet! Im okay with agere too though^^ just as long as youre around my age, 17 at least! Dont be afraid to dm me (:
Please use tone tags when talking to me!
Srs, nm, j, hj, s, p, r, li, ly, others are okay too but these are usually the ones I need!
I love to make friends!! Dont be afraid to message me or interact :D im also okay with spam likes/reblogs etc! I am quite bad at making conversation but ill try my best! Just bad at messaging first ): i also have a spam insta which i use more and get notifs there, if youd like the user to be friends you can dm me! Or pinterest^^
DNI
If you are an nsfw/kink account or interact with accounts of that nature, this account is strictly sfw
If you are homophobic, transphobic, racist, abliest, anti - therian/petre and agere + participate in cancel or cringe "culture" and things along those lines, I will not tolerate it on my account and you will be blocked
If you are under 15, this account is safe for everyone but i am just not comfortavke with it, or at least dming (:
! If you know me irl or on another platform, this is my safe space, do not take that away from me and do not talk abt/mention it to me either, in the nicest way possible...unless I have personally told you abt this acc I dont want you interacting with me here
Typing quirks (will add more when/if i remember)
m: me/im/i, b: be, s: so, ss/is? jst: just, gnna: gonna, wnt: want/wont, cld: could, shld: should, hve: have, nd: and, yr: youre
+ liked posts may not be safe, if youre looking through those be careful because some may be triggering or upsetting!
If you have read my dni please send me or comment any 1! of these emojis 🐕🐶🍮🐾🦴 if you dont you may be removed, or blocked if your acc is blank cause ill assume its a bot (or pls let me know youre not!)
63 notes
·
View notes
any explanations for the interaction with that minor and their audio smut?
Haven't heard it. But here's my advice.... If you are offended by, or don't like something, scroll by it or block the tag or person. I constantly get spam bots and adult rated blogs popping up all over my view of Tumblr and I'm not into seeing all that but I either scroll by it or I block it. Because some people don't mind seeing it and it's not gonna go away or help to complain about it.
If someone is posting about actual real life underage/adult ships, then I could see that as more of an issue. If it's between characters, I don't see that as being as bad. Especially if the actors playing those characters are actually older than the characters themselves.
I mean, you can argue how messed up it is to write fanfic about Lucifer. If it were the real life Lucifer, I'd be bothered. A character doesn't bother me since they're portrayed by someone many people adore and it's more about them than Lucifer anyway.
There is a TON of stuff online we each don't like in some way or another. You can't avoid it. I'd choose my battles differently and go after legit underage stuff and try and stop that. People write all sorts of stories and as long as they're just stories, you can't do much about it. You'll have that in even the most famous writing and it's not going anywhere. Same with stories with violence, forced sex fantasies, murder, torture, etc. I myself won't read stories with animal abuse or hunting, etc. Luckily, most people put trigger warnings so you can avoid it.
7 notes
·
View notes
may i ask how long u've been on tumblr/how you reached 10,000 followers? it seems like quite a feat and i've been trying to post my own stuff (aesthetics, themes, moodboards, etc) for while now almost regularly and i've been stuck at 59, 60, or 61 followers for that entire time. it only ever fluctuates between those three numbers and my most recent followers have been bots. i guess i'm asking if you have any advice? 😅
i’ve been on tumblr for exactly two years, but in october 2022 i accidentally deleted the account and had to start over (kids, the lesson is to never try to delete a sideblog on your phone, do it on the pc, that’s the only place you can do it, because if you try on the phone it’ll delete everything, all of your blogs, including your main) so, it’s taken me 1 and a half years.
well, i have tons of advice about all manner of things, but this specifically, how to get more followers? it’s a little more loosey goosey and based on luck and stuff. but here are a few of the advice i can give:
well, first of all i believe that kindness goes a long way, certainly with getting your followers to stick with you.
ALWAYS check the tags when you post stuff you want people to find, make sure you aren't using any tags that are broken or anything. this is part of the routine i have whenever i post a new fic, always always check that it's showing up in the tags. i'm also always that anon for my moots whenever i notice that their stuff isn't showing up and they either didn't know or needs a bit of help. if you don't know your way around tumblr tags, then this post right here is very very helpful. also just use the proper and appropriate tags, but i'd think that was a given.
you say that you post stuff like moodboards and such? to be honest, i don't know how many of my followers follow me exclusively for that genre of my content, i don't know how many followers are normal when that is your blog's thing.
some people like to spam post a ton of stuff, some people like their dash extremely active, i personally don't. i've unfollowed/just not followed people who i like just fine, but who post an overwhelming amount. i might not be the only one who's like this. i personally have some posts queued, i have a bit of a schedule of regular posts that i trickle out. like stuff that i reblog, there is a pattern to how i do it, just to spread it out and to keep it organised (because everything in my life is meticulously organised). like i always have a comforting little thing to reblog between 5 and 6 in the morning for me, because then it'll be one of the first things people in my timezone sees and one of the last things a nightowl might see.
also try and keep your blog organised, have tags for things so that it's easy for people to filter (and also easy for you to find stuff), have a pinned post that's kind of a gentle welcome/intro/guide to whoever clicks on your blog, that kind of stuff, also just try and make the blog pretty and inviting, not just the default tumblr icon and stuff (those lowkey scare me)
keeping timezones in mind when you post. think about if it's a good time for most people, is it a time of day where one could be looking at their phone, taking a little break.
reblog stuff! interact with people! support others that you like and maybe that someone will support you!
i've never posted stuff "in order to get lots of followers," or anything. i just personally really like my writing, and since i do, then there must be someone else that does as well. turns out i was right.
learn that your blog is like your little house. you make the rules, you decide who gets to stay, you get to do whatever makes you happy and no one can tell you that you are wrong.
at the end of the day, everyone is gonna like something different, you can't please everyone, so just make your blog, your content, exactly how you like it, just be your wonderful weird beautiful self and no one else.
「 come join my 10k celebration 」
4 notes
·
View notes
Me: Wow, this tag I follow would be way better without all the bots and/or annoying tag-spammers clogging things up. I'm gonna block them so I can look through the latest posts without scrolling through a bunch of crap
Tumblr: Whoops! There's nothing here :) Looks like this popular and active tag actually isn't active at all :) See, there are like three posts published after the spam you blocked and then literally nothing before then, because we don't know how to build a fucking website that'll paginate reverse-chronological searches without getting confused when you want to filter out some of the results
3 notes
·
View notes