#rr don

[total-drama-brainrot]

First time drawing Don, please be nice.

+ Bonus transparent version.

#I forgot the bow but let's ignore that. #Anyway uhhhhh #Don Big Naturals #total drama #td don #rr don #ophe doodles #shitposting #high effort shitposting

[ducktracy]

a short placing heavy emphasis on Hungarian Rhapsody No. II is a rite of passage for golden age cartoons. Bugs Bunny did it! Tom and Jerry did it! Daffy and Donald! but one thing Woody Woodpecker has above the competition is that he is held hostage by a group of gangsters and is forced to entertain, lest he get executed. amazing

#fans of Mickey's Trailer will note the similarities at the beginning of the moving van stretching out the fence--that's because #this was directed by Don Patterson who animated that absolutely BIZARRE cut in Trailer #please look it up if you haven't because it is some of the best animation you will ever see. it is insane #i'm so sad i didn't know this short existed until yesterday because i love it. i love musical cartoons and the story/hook of this one #genuinely made me laugh. and Daws Butler voices the gangsters and cop! #Hungarian Rhapsody No. II... gangster is named Mugsy... it's almost a Friz Freleng short! almost #Hugh Harman did write this one though which is bizarre to me. yes that Hugh Harman who established and ran the first 3 years of the Warner #studio with Rudy Ising #(and Herman Cohen animates on this who of course was a longtime WB animator!) #i love cartoons #ww #convict concerto #patterson #vid #also i am team Rhapsody Rabbit on the RR vs Cat Concerto debate i'm sorry Tom (and Jerry) #but one short has Bugs Bunny killing a man in cold blood and the other doesn't

[starryluminary]

Ridonculous Race but Noah is friends with Owen part 8: Where would I be without you?

I am holding back on yelling for ten paragraphs about this moment in rr proper. Instead I will say that I made Emma outright say she can’t be with Noah cause I feel like adding the “not on the show” part does not warrant such a strong reaction. Also Owen tries so hard. He cares so much and tries so hard and it’s borderline therapeutic to draw Noah reciprocating the efforts (in his own silly ways)

It’s also been a full year since I’ve initially started this series! Happy Birthday, Noah is friends with Owen!

Transcript:

Image 1 Emma: I like you!! A lot! Emma: But…

Image 2 Emma: …I can’t be with you. I’m sorry.

Image 3 Owen: Oh boy.

Image 4 Don: Reality TV schmos- I mean “Pros”… Don: I’m afraid you’re last. It’s time to go…

Image 5 Don: …Is what I would have said if this were an elimination round, but it isn’t!

Image 6 Don, offscreen: Congratulations, guys! You’re still in the game!

Image 7 Owen: Noah…? You ok, buddy? Noah: I… Uhm…

Image 8 Noah: …Ow.

Image 9 Owen: Aww, Noah!! Owen: Don’t worry- it might hurt now, but things will get better! I promise!!

Image 10 Owen: Besides… There’s ton of other fish in the sea. Like this one! Owen, in cursive: I wuv you, Noah! Kissy kissy, mwah mwah mwah! Noah: Ew. No thank you.

Image 11 Noah: I think it likes you, though.

Image 12 Owen: Oh my— NOAH!! Owen: That’s a dead fish- why would you do this to me?! Noah: Ha ha ha

Image 13 Noah: Ha… Noah: …Thanks, Owen.

Image 14 Owen: Ha. Owen: Glad I could help!

#Tablets at 10% and its 15 minutes to midnight but I made it. On the day #Can you believe it’s taken me a year to finish my rr rewatch. Wild lmao #total drama #total drama ridonculous race #total drama presents: the ridonculous race #tdrr #total drama noah #td noah #total drama owen #td owen #total drama emma #td emma #emma race #total drama don #td don #noah is friends with owen #Starry makes art #just in case it looks like Don is giving Emma the stink eye I promise he’s not. that’s supposed to be his neutral expression #I do not disrespect emma

[totaldrama-showdowns]

Round 1 Match 18

Propaganda

Chris v Don: toxic old man yaoi

they don't have any actual beef but there's a surplus of art of them beating eachother to the death and i just think that's beautiful

Jo v Brick: Do I even need to explain? Jo and Brick are the best rivalry in the whole series. Unstopable duo

He ran backwards with earplugs just to one up her U_U

See the exchange from the beginning of Episode 2

The Best part of RotI

They're so funny together oml. Wish they had even more time together as frenemies

what does propaganda mean

that whole scene when they’re arguing about who had the better run changed my brain chemistry

When even the official compliation of Jo vs Lightning moments just gives us more Jo vs Brick ones...

The roti rivalry

They were super funny in roti and I love them with all of my heart

save me jock

JOCK!!!!! JOCK NATION RISE UP 🙌

#total drama #poll #favorite rivalry showdown #chris mclean #don rr #jo td #brick td

[mudora]

No one:  Absolutely No One:  Me: So hey, maybe some LoZ Return and Reconciliation smut? THOUGHTS? *SWEATS*

#Rose don kill me #loz rr

[candyredappledragon]

What have we done… He’s going to explode if this keeps up…

... noooooooo im n ot .!!!! i t hihk i d ese vre a d rink- ack.... kin da hur ts to bre ath haha.

#rotomblr #pkmn irl #thanks for the ask! #trainer kieran #text post #don t wo rr y!!! im ok!!!!! #ju st a lil o wie.

[asbestieos]

edenstar (re)play for your edenstar needs

WHAT BEAST HAVE YOU UNLEASHED IN ME IMG GOING JOKER MODE LISTENIGNG TO IT RIGHT NOW IM JUMPING GOIT MY BEDROOM WINDOW AND CLIMBING TOT MY ROOFTOP ANS SCREAMING I LOVE EDENSTAR!!!!!!!

#YOU DON UNDERSTAND…… I LOOPED (RE)PLAY IN MY SPOTIFY BC IM SO EXCITED .. DAICHI MIURA IN MY TOP 10 #AGAUAGAAHAAUAGAGAGAHAGAHAS SCICI JDK N K I TS GOOD.. IITS STRWAKKKY RGGOOD……. ITSSRREALLLYY GGOODOD…………. ITSD RR #IT SRE ESRY GODO.. ITS RE WJESISLJCCL J KDNCKCN!!1!1’bn !:’bddn AAUAUAGGAGAGAGAGAGGAGA #ENSTARS #PIPER ENS POSTING #ASTAPOSTING #NYX DID I JAB W ATAG FOR YOU .. #I DTHINJ I DDDID ILL GOG.. FIDN IT IN A SECONFF…… OAJ M YG ODOD DONT T UST OBEYY #AAHAGAGAUAGAUAGAUAGAGA!1!1!&//!AGAAHAUGAAG!1!!11!!11!1!1!

[chromet]

Don Toliver X Ice Cream

#don toliver #ice cream #bbc #rr #rolls royce #custom

[yakumtsaki]

why does sugar look like that...

you know why

#looking @ u don #rr #Anonymous

[perpetual-pathos]

GET FUCKING SHELVED HONG LU I HAVE NOT TAKEN YOU OUT FOR BATTLES ANYMORE AHHAHAHA

#gameposting #i recently got all don id and ego #also jefe sinclair but thats not important #i ignored hong lu for the rupture team and semi tremor team its so fun not using bleed #thank you seven outis and w don #when will i do rr i wonder

[total-drama-brainrot]

If I see the term 'Don Big Naturals' on my dashboard one more time I'm gonna enter my Joker arc.

#/j #benny this is directed towards you #leave that poor man and his honkers alone #rr don #ophe rambling #no main tags we die like the scarab beetle intern

[weneedatdcharacterwho]

A RR team of newlyweds that used the game as a free honeymoon. They are one of the first teams eliminated and its like:

Bride: that million dollars would have been an amazing wedding gift.

Groom: But hey, we got a free vacation to Spain.

Bride: Plus Im pretty sure the show will fly us to wherever the finale is too.

Both of them: Thanks Don!

.

#that's SO so so cute #I hope they're like. still wearing their wedding attire that would be so funny #hopefully the bride didn't pick a long train+heels #total drama #fanofanimation #total drama ridonculous race

[ferrouswheel11]

Red Robin redesign based on the idea of an inverness cape... this version of RR has returned to his detective roots, puzzling over Gotham's toughest mysteries and donning the cape and cowl when it's time for some good old-fashioned legwork.

I know in my heart tim is a Cape Guy -- the Question may rock a detective’s coat and fedora but that's not the right look for tim (not to mention batman!damian already has a claim on the coat-as-cape look). But tim is also a confirmed sherlock holmes nerd, so the two-layer inverness-inspired cape seemed a good way to subtly infuse some detective vibes into his costume.

#batman #dc comics #tim drake #red robin #batman fanart #the suit has a red yoke so that a little color peeks out over the collar of his cape #it’s kinda unternet-y #plus… yknow… robins #the harness situation on his belt is just bc I think he’d be into that #maybe yellow would be better idk #hard to see but important to mention he has those spike things on his gauntlets #do they catch on his cape? maybe. do igaf? #I know jason already has red lenses in his mask rn but I really liked when tim had the green nite-vision lenses in the 90s #actually have a different idea for the legs/shoes but too late oh well

[starryluminary]

Ridonculous Race but Noah is friends with Owen part one: Let’s get this started right!

Why is Noah so mean to Owen in rr. Why doesn’t he like him at all. Why does he treat him so coldly when Owen’s just trying to engage. It makes me mad so I’m starting this series out of spite. I want them to be FRIENDS

Transcript:

Image 1 Don, offscreen: Owen and Noah: seasoned reality TV participants!

Image 2 Owen: Yea- ha- ha- ha!!! WOO!!

#edit: added a transcript under the read more cause my handwriting will get incomprehensible one of these posts #also with all this nowen ripper family stuff I’ve been growing a soft spot for them #so you might get these mixed with the kiss edits hope that’s cool #ALSO I promise I get better at drawing Owen #I had only drawn him like twice before starting this so he’s gonna look wonky forgive me #total drama #total drama presents: the ridonculous race #total drama ridonculous race #ridonculous race #noah total drama #owen total drama #noah td #owen td #tv reality pros #noah is friends with owen #Starry makes art

[lonestarflight]

Rollout Ceremony for the third operational orbiter, Discovery (OV-103) at Palmdale, California. On the stage is the Don Beall of Rockwell (at lectern), Dr. Rocco A. Petrone, the president of the company and the crew of her first first flight STS-41-D.

She is named for several different ships:

"The name Discovery was chosen to carry on a tradition based on ships of exploration, primarily HMS Discovery, one of the ships commanded by Captain James Cook during his third and final major voyage from 1776 to 1779, and Henry Hudson's Discovery, which was used in 1610–1611 to explore Hudson Bay and search for a Northwest Passage. Other ships bearing the name have included HMS Discovery of the 1875–1876 British Arctic Expedition to the North Pole, and RRS Discovery, which carried the 1901–1904 Discovery Expedition to Antarctica, led by Captain Scott."

-information from Wikipedia: link

At the beginning of her career, Discovery weighed roughly 3,600 kg (7,900 lb) less than Columbia due to lessons learned during the construction and testing of Enterprise, Columbia and Challenger. She weighs 6 pounds (2.7 kg) heavier than Atlantis and 363 pounds (165 kg) heavier than Endeavour. Part of this was due to the greater use of quilted AFRSI blankets rather than the white LRSI tiles on the fuselage, and the use of graphite epoxy instead of aluminum for the payload bay doors and some of the wing spars and beams.

"During her construction, Discovery was fitted with several black tiles near the middle starboard window where there should have been white tiles. It is unknown if this was the result of a harmless manufacturing mishap or done intentionally to give a distinctive look to the shuttle. This feature has been called 'teardrop' and allowed Discovery to be easily identified.

Upon her delivery to the Kennedy Space Center in 1983, Discovery was modified alongside Challenger to accommodate the liquid-fueled Centaur-G booster, which had been planned for use beginning in 1986 but was cancelled in the wake of the Challenger disaster."

She was originally intended to be the dedicated US Air Force shuttle and launch DoD payloads from SLC-6 at Vandenberg AFB but these plans were cancelled in aftermath of the Challenger disaster.

Commemorative stamp from Rockwell International (source)

Construction milestones:

1979 January 29: contract award to Rockwell International's Space Transportation Systems Division in Downey, California

1979 August 1: start long lead fabrication of upper forward-fuselage, Downey

1979 August 27: start long lead fabrication of Crew Module, Downey

1980 March 3: start fabrication aft-fuselage, Downey

1980 June 20: start fabrication lower forward-fuselage, Downey

1980 September 29: start assembly of Crew Module, Downey

1980 October 1: start fabrication/assembly of mid-fuselage, San Diego

1980 November 10: start assembly of aft-fuselage

1980 December 8: start initial system installation aft fuselage

1981 March 2: start fabrication/assembly of payload bay doors, Tulsa

1981 June 1: start fabrication of vertical stabilizer, Fairchild-Republic

1981 October 19: start fabrication/assembly of body flap, Downey

1981 October 26: start initial system installation, crew module, Downey

1982 January 4: start initial system installation upper forward fuselage, Downey

1982 March 16: mid-fuselage on dock, Palmdale

1982 March 30: Elevons on dock, Palmdale

1982 April 30: Wings on dock, Palmdale

1982 April 30: lower forward-fuselage on dock, Palmdale

1982 July 16: upper forward-fuselage on dock, Palmdale

1982 August 5: vertical stabilizer on dock, Palmdale

1982 September 3: start of final assembly

1982 October 15: body flap on dock, Palmdale

1982 December 28: crew module on dock, Palmdale

1983 January 11: aft-fuselage on dock, Palmdale

1983 February 25: forward RCS module on dock, Palmdale

1983 February 25: complete final assembly and closeout installation, Palmdale

1983 February 28: start initial subsystems test, power-on, Palmdale

1983 May 13: complete initial subsystems testing

1983 July 26: complete subsystems testing

1983 August 12: completed final acceptance

1983 October 16: Rollout from Palmdale

1983 October 28: SSME on dock, KSC

1983 November 5: overland delivery to Edwards AFB

1983 November 6: ferry flight to Vandenberg AFB

1983 November 8: ferry flight to Carswell AFB

1983 November 9: ferry flight to KSC

1983 November 15: transport to OPF and start modifications, KSC

1983 December 9: transfer to VAB for storage, KSC

1983 December 22: SSME on dock, KSC

1984 January 3: transfer to OPF, KSC

1984 January 5: SSME on dock, KSC

1984 May 12: transfer to VAB, KSC

1984 June 2: flight readiness firing of SSME, LC-39A

1984 June 25: Conduct STS-41-D, first flight, launch KSC, launch scrubbed at T-9 minutes due to general-purpose computer No. 5 disparity with primary set of general-purpose computers.

1984 June 26: Conduct STS-41-D, first flight, launch KSC, launch postponed indefinitely due to shutdown of SSMEs 3 and 2 at T-4 seconds due to slow opening of SSME 3 main fuel valve, SSME I never received a start command.

1984 July 14: rollback from Launch Complex 39-A to VAB, KSC, for remanifest of payloads

1984 July 17: transfer to OPF for reconfiguration of payload bay and for remanifest of payloads

1984 August 2: transfer to VAB and remate with SRB and ET

1984 August 9: rollout to LC-39A

1984 August 28: remanifest 41 D mission launch for Aug. 29, postponed for 24 hours for software verification

1984 August 30: launch of STS-41-D

Date: October 16, 1983

NASA ID: S84-30898

source, source, source, source, source, source

#Space Shuttle #Space Shuttle Discovery #Discovery #OV-103 #Orbiter #NASA #Space Shuttle Program #rollout ceremony #Rockwell International #Palmdale #California #October #1983 #my post

[real-total-drama-takes]

I'm here to share my warrior cats au. this is a very very long ask so sorry and if I'm missing anyone lmk but I'm pretty sure I got everyone

thunderclan - TDI original

Owen - oakstar (previously oakmouth)

Gwen - bramblevole (deputy)

Noah - newtspike (medicine cat, HATES his job and refuses to get his own herbs)

Alejandro - eelshine (he was a stray visiting but he ended up staying. his name went to al -> eel -> eelshine)

DJ - dapplejump

heather - duskheather

Bridgette - leafwave

Ezekiel - Zeke ( kittypet who is horribly, horribly lost)

Izzy - frecklehawk

Trent - troutsong

Courtney - eaglecreek

Eva - evefight

Cody - cloverslip

sierra - sandpaw (actually one of the oldest in the clan, noone has given her a warrior ceremony yet. Cody is her begrudging mentor)

justin - juniperface

Harold - houndleg

leshawna - lavenderfire

Tyler - tanglestep

Lindsay - lizardshimmer

Beth - birchbush

Katie - kitecloud

Sadie - silvercloud

Geoff - goldenhail

Duncan - duskclaw

windclan - TDI 2023

Priya - puddlestar (previously puddlestone)

Bowie - ivyberry (deputy)

Julia - snakeshell (medcat, absolutely bitch to everyone)

Raj - riverowl

Wayne - willowsnow

Millie - cricketspirit

chase - runninghare

zee - squirrelbird

ripper - raggedbrook

Emma - emberviolet (this is a reference to the song by hole btw)

axel - amberfight

nichelle - nectarbright

Caleb - cedarpelt

scary girl/Lauren - lakebone or scary shecat

mk - mousekite

Damien - daisymist

Riverclan - roti the radioactivity is just pollution. nothing too bad things are just a little more weird than the other clans

lightning - lightningstar (previously lightningpelt. he got struck by lightning once when he was an apprentice and has burn marks down his back)

Cameron - smallmaple (deputy)

dawn - dawnblossom (medicine cat)

scott - dirtfang

Dakota/dakotazoid - "kittypet" that keeps visiting the clan when she was young and eventually she grew up into a "massive monster". she's actually a borzoi

Zoey - shyrose

mike - mudstrike

Anne Maria - applemoth

jo - jumpsmoke

brick - stonerunner

Sam - streamclaw

b - beaverdusk

staci - softmouth

shadowclan - pi

Shane - rottenstar (previously sheeptalon, but he got hit by a car on his way to get his nine lives and got revived prematurely. he's been terrified of other cats getting revived ever since)

sky - skystep (deputy)

Leonard - leapswirl (medicine cat, generic medcat magic but also Tammy is a kittypet who lives in a smarthouse and he thinks he's magic bc of it)

jasmine - tallmagpie

Amy - applewish

Sammy - snailwish (snapplewish)

Scarlett - blazesnake

sugar - sweetjay

Ella - songfeather

Dave - driftwhisker (previous kittypet, he's the only one that knows what a smarthouse is. he also doesn't know that medcats are magic)

Rodney - mooseheart

beardo - stray that lives in an old music shop

max - darkwind

Topher - gopherlight

don, Chris and chef are the only two cats anyone can see in starclan. noone knows why and noone questions it. they don't even have warrior names, just don, Chris and chef. blaineley is in the dark forest.

also all the rr characters that aren't already mentioned are kittypets/strays. crimson and enuui are two kittypets who live in the same apartment block. the cops are the two cats that the police keep in the precinct. Brody is a cat that visits thunderclan with Geoff sometimes.

.

#warrior cats anon #total drama #long post #td warrior cats au