crumb-crumblet-s-crumbington

[crumb-crumblet-s-crumbington]

do u think he has a shot

#ethan winters #karl heisenberg #wintersberg #resident evil #resident evil fanart #rebhfun #resident evil village #resident evil 8 #re8 #the four lords #im going to be so serious #i love portraying karl as the most loser guy ever #hes so arrogant but he needs ethan so bad it makes him look stupid

[crumb-crumblet-s-crumbington]

animatic i made in like a hour for fun ft my friend @demelly

#crumb #cuptoast

[crumb-crumblet-s-crumbington]

crumbfestation information!

crumbfestations ref

crumbfestations hero costume

#crumb #cuptoast #bnha oc #bnha #mha #original art #crum #crumbessage

[crumb-crumblet-s-crumbington]

mithan growing old together and comfortably retiring becuase of all of mias money from the connections

based offa this post

#ethan winters #mia winters #resident evil #resident evil fanart #rebhfun #resident evil village #resident evil 8 #re8 #mithan

[crumb-crumblet-s-crumbington]

circus AU i make with my friends :3

#crumb #cuptoast #friend art #original art #this is ur sign to make AUs with ur friend group #its really so fun #here r some AU ideas ive done with my friends #mlp... pixie hollow... zombie apocolypse... bnha... #its totally fun #i cant reccomend it enough

[crumb-crumblet-s-crumbington]

my bnha sona with @heraxic jellyfish...

#bnha #mha #bnha oc #original art #crumb #cuptoast #friend art

[crumb-crumblet-s-crumbington]

im so glad people like crumbfestation! here is his hero costume!

prev post

#bnha #mha #bnha oc #original art #crumb #cuptoast

[crumb-crumblet-s-crumbington]

little resident riding hood, where ethan and rose go to collect apples to make a delicious pie for an ill mia, but in the shadows theres something big and bad lurking...

#ethan winters #mia winters #rose winters #rosemary winters #chris redfield #karl heisenberg #resident evil #resident evil fanart #rebhfun #resident evil village #resident evil 8 #re8 #little resident riding hood

[crumb-crumblet-s-crumbington]

it tried to register its quirk as "chat" but they thought it was crazy

bnha sona i made for a thing with friends

#bnha #mha #bnha oc #? #original art #crumb #cuptoast

[crumb-crumblet-s-crumbington]

uuuuaaauauaagaahh

#denki kaminari #hanta sero #kamisero #mha #bnha

[crumb-crumblet-s-crumbington]

Medusaberg first encounter pt3 (final) (cw eye-related gore, thanks miranda)

(pt2:)

something something xenia guest rules and handshakes to show you’re unarmed

imagine you get horribly mutated and kidnapped to an inescapable island where the only times you’re not completely isolated is when you’re getting hunted down and attacked by people who see your head as a glorious trophy. imagine begging for them to listen, begging for your life, but they only see it as trickery and weakness. eventually you give up trying to convince them and strike first cause you want to survive. now for the first time in 700 years you meet someone who isn’t taking orders from your abductor or an overconfident fool striving for legendary status. theyre like you but marked for death and old hopes reignite, but your amiability has rusted over from centuries of cruelty.

wouldn’t it be wild if they were the first to listen anyway.

#THIS ROCKS!!! #I LOVE THIS!!!

[crumb-crumblet-s-crumbington]

uagauauaaaagaauagauauga

#denki kaminari #hanta sero #kamisero #mha #bnha #rewatchjing the show #they like #dont even have any scenes together #HELLP #like #idk where 14 year old me got anything from #like yeha they r always standing next to each other but sero has so little screen time he doesnt even do anything 😭 #crumb cuptoast forever doomed to always like characters who r sidelined

[crumb-crumblet-s-crumbington]

more frames for my animation!

#cw blood #ethan winters #resident evil #resident evil fanart #rebhfun

[crumb-crumblet-s-crumbington]

The past is so overwhelming

#THIS ROCKS LIKE CRAZY #OMG I LOVE THIS #SO AWESOME!!!!!!!!! #BEAUTIFUL

[crumb-crumblet-s-crumbington]

working on a animation full of many colors! here r some of the snippets of the sequence of ethans life pre RE7

#ethan winters #resident evil #resident evil fanart #rebhfun

[crumb-crumblet-s-crumbington]

rewatching mha and drew my old faves

#denki kaminari #hanta sero #mha #bnha

[crumb-crumblet-s-crumbington]

redraw of a old comic

#ethan winters #karl heisenberg #rose winters #rosemary winters #wintersberg #resident evil #resident evil fanart #rebhfun #resident evil village #resident evil 8 #re8