Visit Blog
Explore Tumblr blogs with no restrictions, modern design and the best experience.
#tcas 2014
gbeckyg · 3 months ago
Text
Tumblr media
2 notes · View notes
gbeckyg · 3 months ago
Text
Tumblr media
Tumblr media
Tumblr media
2 notes · View notes
gbeckyg · 3 months ago
Text
Tumblr media
No ones perfect. Which is exactly why I intentionally put thousands of gaps on the huge screens behind me. Embrace your imperfections.
#EmbracetheGAP 😏☺️
2 notes · View notes
gbeckyg · 3 months ago
Text
Tumblr media
Always good to see Camila ❤️😏
2 notes · View notes
gbeckyg · 3 months ago
Text
Tumblr media
With my babies 💜 love them so much.
2 notes · View notes
lezwatchtv · 25 days ago
Text
Has Pilot Season Fallen?
Has Pilot Season Fallen? The hopes for new series flies high with the potential to be a year-round show.
Back in 2014, Kevin Reilly from Fox declared the death of pilot ‘season,’ telling the TCA he was going to focus on ordering series straight to production instead of a pilot. Pilot Season, in 2021, feels like a strange, archaic method of picking the best shows based on one, maybe two episodes, and building a schedule around it. And the fact that there are multiple types of pilots was always…
Tumblr media
View On WordPress
1 note · View note
zhiyanle · a month ago
Text
RaTG13 Is Too Good To Be True.
HTML clipboard
RaTG13 Is Too Good To Be True. ---- WIV1 pk RaTG13 (2). Zhiyan-Le, 2010-04-03. https://sites.google.com/site/zhiyanleback/2021-1/z20210404-wiv1xratg13 https://zhiyanleback.blogspot.com/p/ratg13-is-too-good-to-be-true.html https://sites.google.com/view/zhiyanlesite2/home/sars-2-origin-wiv1-pk-ratg13 WHO China trip and its SARS-2 origin report indicated RaTG13 as the SARS-2 origin from nature. Their conclusion was base on: 1]: RaTG13 has 96.2% identity, which was done on the single gene alignment level. 2]: There is only one Amino-Acid difference, which was done on the protein alignment level. Such conclusion may not stand true. Reason: Alignment and analysis on Codon level are totally ignored, which may lead to different conclusions. Let’s take an example, we have two genomic sequences with the same Am-Acid but different Codons:  
First: Arg Phe Glu Arg Arg Ser Leu Gly Ser Ser Arg Pro Thr Cys Cys AGG TTC GAG CGC CGG AGT CTC GGC TCA TCC CGA CCG ACT TGC TGT Second: Arg Phe Glu Arg Arg Ser Leu Gly Ser Ser Arg Pro Thr Cys Cys CGT TTT GAA AGG CGT TCC TTA GGA TCC TCA CGG CCC ACC TGT TGC
Their identities on the Am-Acid or protein level is 100%. And their identities on the single gene alignment level is 56%. See below:  
Identities   25/45(56%) Query  1   AGGTTCGAGCGCCGGAGTCTCGGCTCATCCCGACCGACTTGCTGT  45             | || ||  | ||     | || || || || || || || ||  Sbjct  1   CGTTTTGAAAGGCGTTCCTTAGGATCCTCACGGCCCACCTGTTGC  45
However, their identities on the Codon level: 0%. More over, their structures are different: Which is accurate? In my view, the one on Codon level is. The reason is simple: When the virus and ACE2 are running, they work on the Codon level. The given samples may have the same Am-Acid, however, their energy level or power can be very different due to their different Codons. This can be well explained by the binary-image Codon Table and by the Buckyball system. RaTG13 Reality on the Codon Level. Now using Codon study to see the identities among relevant nCov samples (with GenBank ID): • NC_045512: WH-01, basic sample, collected from a patient in Wuhan hospital in PRC. • MN996532: bat RaTG13, said as the most possible origin of SARS-2. • KF367457: WIV1, the first one of lab-product series of SARS-like nCov. • NC_028824, Bat-2012, natural bat, collected in PRC Yunnan, 2012. • NC_030886, Bat-2014. natural bat, collected in PRC Yunnan, 2014 If RaTG13 were a bat from nature in 2013, it should behave as the same or very closely to the two natural bat sample, Bat-2012 and Bat-2014. Aligning with the basic sample, WH-01 (NC_045512), on the global Codon level, the RaTG13 has a matching score of 184 and WIV1 has 190. And here is the alignment of their Codon base-gene occurring frequency & distribution: Table 01: 
Global Codon BP Freq.Distribution (raw data:NIH GenBank, by 2021-02)   NC_045512 WIV1 RaTG13 Bat-12 Bat-14 A 3038.33 2884.67 2975.33 2342.33 2552.33 C 1868.00 2020.67 1836.67 1462.67 2135.67 G 1983.67 2098.00 1948.67 1936.00 2419.00 T 3267.00 3099.67 3190.33 3250.00 2946.00 total: 10157 10103 9951 8991 10053 avrg: 2539.25 2525.75 2487.75 2247.75 2513.25 total gap w NC_45512 -54 -206 -1166 -104 avrg gap w NC_45512 -14 -52 -292 -26
The aligning result: WIV1 has the total gap [-54] and average gap [-14] , and RaTG13 has that of [-206] and [-53]. Both Bat-2012 and Bat-2014 have much bigger gaps. Clearly, WIV1 is the closest to the basic sample, meaning an obvious greater possibility to be the SARS-2 origin than that of RaTG13, which behaves very differently from natural bat samples. Ratg13: Too Good To Be True As The SARS-2 Origin. This indicator, Codon and its genetic frequencies and distribution, is important, according to PRC-PLA doctor Chen Wei (a top virology scientist and Covid-vaccine developer in China; also, she is a leader in charge of medical treatment during the early stage of the pandemic in PRC Wuhan City), because it directly tells the similarity or difference regarding affinity, stability and mutation status and trend, especially genes C & G and their quantity and distribution. S-Gene is a key factor re SARS-2 interacts with human body. Let’s do some studies on the Codon level by borrowing Dr. Chen Wei suggestion. Below are similarities among the taken samples. Fig. 01: Indeed, as Dr. Chen Wei suggested, gene C & G, as well as their quantity and distribution, play an important role, particularly in the Codon 3rd BP genes (where base-gene A & T are 0). It seems that RaTG13 is in a good position to be the SARS-2 origin: Regarding single gene-aligning closeness to the basic sample NC_045512, WIV1 has a ratio of 0.9866, and RaTG13 has a ratio of 0.9969. However, comparing with natural bats (Bat-2012 and Bat-2014), of which one has the ratio of 0.8892 and another has it of 1.0134, far enough to be role out as the SARS-2 origin by the said sample. That is, sample RaTG13 behaves very differently from natural bats, but it does not. Further, below is the Codon-leveled aligning result: Table 02:
Codon-Leveled Similarities to NC-045512   WIV1 RaTG13 Bat-2012 Bat-2014 Total Occurring 1260 1256 1269 1132 similarities 78 693 66 94 Ratio of similarity/total 0.0619 0.5518 0.0520 0.0830
The sample RaTG13 has a matching score of 693 occurring aligning similarities, others have it from 87 to 96. The gap between RaTG13 and natural bats is too big to believe that it comes from nature. In a lab field, however, it is pretty easy to reach or even to go beyond 693 similarities score. Besides, RaTG13 similarity ratio is too close to the basic sample but too far from the natural samples. In fact, when using NIH-BLAST to search RaTG13’s all possible similarities, the result has no natural bats but in three categories: synthetic construct, clones, and vaccines, all are lab/man-made work. In sum, the indicator on Codon level should be in the must-do-list when searching the SARS-2 origin(s). By using it, the picture is very different from what the WHO report said. That is, the sample RaTG13 is too perfect to be a truthful SARS-2 origin from natural bats, rather, it is very likely a lab-product. In contrast, and by all indicators, particularly on the Codon level, WIV1 has the closest relations with basic sample NC_044512, that is, WIV1 is the most possible SARS-2 origin. Reference: Message from PLA Vaccine Patent. 2021-03-15. https://sites.google.com/site/zhiyanleback/2021-1/z20210315-patent-message-en Data Availability Table 01-02 (supplement)
SARS-2: Global Codon Freq. & Distribution (raw data: NIH GenBank, by 2021-02-22)   WH-01 WIV1 RaTG13 Bat-12 Bat-14   WH-01 WIV1 RaTG13 Bat-12 Bat-14 AAA 284 264 312 132 180 CAA 230 207 243 129 157 AAC 219 186 200 129 210 CAC 192 151 152 98 125 AAG 252 239 116 114 213 CAG 184 165 84 129 183 AAT 188 233 264 150 179 CAT 181 163 165 125 130 ACA 276 283 235 175 219 CCA 101 141 113 79 150 ACC 127 135 145 89 162 CCC 44 43 43 31 75 ACG 62 52 46 60 89 CCG 27 21 30 28 72 ACT 165 246 247 155 239 CCT 93 115 107 69 142 AGA 201 149 266 137 106 CGA 36 27 37 28 33 AGC 109 86 141 92 143 CGC 29 44 39 23 100 AGG 131 108 113 124 112 CGG 24 29 28 18 40 AGT 161 143 201 146 162 CGT 50 79 63 65 108 ATA 180 168 106 191 166 CTA 274 215 119 243 211 ATC 127 131 104 83 81 CTC 120 147 84 79 93 ATG 298 357 122 319 311 CTG 271 248 79 211 203 ATT 295 281 210 220 182 CTT 276 256 213 200 178   WH-01 WIV1 RaTG13 Bat-12 Bat-14   WH-01 WIV1 RaTG13 Bat-12 Bat-14 GAA 100 199 182 91 141 TAA 289 100 319 248 76 GAC 76 145 133 57 143 TAC 201 183 252 169 214 GAG 97 178 78 69 161 TAG 211 106 123 142 102 GAT 64 173 185 79 159 TAT 135 163 279 230 174 GCA 99 187 118 107 191 TCA 193 215 183 120 130 GCC 47 78 69 53 131 TCC 79 61 72 66 98 GCG 29 47 19 58 107 TCG 40 63 33 50 55 GCT 89 261 179 114 260 TCT 139 187 199 133 165 GGA 74 95 124 66 98 TGA 258 87 305 251 92 GGC 49 73 89 62 137 TGC 193 150 244 183 193 GGG 51 50 50 43 70 TGG 195 110 253 208 179 GGT 62 195 155 118 226 TGT 286 204 358 288 215 GTA 180 153 129 198 192 TTA 362 248 220 425 214 GTC 70 106 99 91 115 TTC 180 157 207 141 102 GTG 279 212 97 266 315 TTG 366 291 188 425 302 GTT 159 237 215 220 283 TTT 298 277 368 349 259
Table 02-02 (supplement)
S-Gene: Global Codon Matching Score (raw data: NIH GenBank, 2021-02-22)   WIV1 RaTG13 Bat-12 Bat-14   WIV1 RaTG13 Bat-12 Bat-14 AAA  0 0 0 0 CAA  0 0 0 0 AAC  3 51 4 9 CAC  0 8 0 0 AAG  2 31 0 0 CAG  4 24 1 2 AAT  0 0 0 0 CAT  0 0 0 0 ACA  0 0 0 0 CCA  0 0 0 0 ACC  7 57 8 14 CCC  2 37 2 5 ACG  0 0 0 0 CCG  0 0 0 0 ACT  0 0 0 0 CCT  0 0 0 0 AGA  0 0 0 0 CGA  0 0 0 0 AGC  11 52 11 8 CGC  0 0 0 0 AGG  2 24 2 1 CGG  0 0 0 0 AGT  0 0 0 0 CGT  0 0 0 0 ATA  0 0 0 0 CTA  0 0 0 0 ATC  5 35 3 3 CTC  0 0 0 0 ATG  1 5 2 2 CTG  7 59 7 14 ATT  0 0 0 0 CTT  0 0 0 0   WIV1 RaTG13 Bat-12 Bat-14   WIV1 RaTG13 Bat-12 Bat-14 GAA  0 0 0 0 TAA  0 0 0 0 GAC  2 32 3 1 TAC  2 33 2 4 GAG  1 22 0 1 TAG  0 0 0 0 GAT  0 0 0 0 TAT  0 0 0 0 GCA  0 0 0 0 TCA  0 0 0 0 GCC  7 38 5 9 TCC  0 0 0 0 GCG  0 0 0 0 TCG  0 0 0 0 GCT  0 0 0 0 TCT  0 0 0 0 GGA  0 0 0 0 TGA  0 0 0 0 GGC  4 49 4 5 TGC  5 23 0 3 GGG  0 0 0 0 TGG  0 7 1 0 GGT  0 0 0 0 TGT  0 0 0 0 GTA  0 0 0 0 TTA  0 0 0 0 GTC  0 0 0 0 TTC  5 46 6 2 GTG  8 60 5 11 TTG  0 0 0 0 GTT  0 0 0 0 TTT  0 0 0 0
0 notes
Text
Part II: Disability Right Movement
Role of Psychology
Crethar and Ratts (2008) define social justice as a multidimensional methodology in which mental health providers attempt to concurrently encourage personal growth and the mutually decent through speak to obstacles correlated to both individual and distributive justice. The counselor or psychologist empowers the client or group to stand up for their beliefs in a healthy manner. Crethar and Ratts (2008) suggest that when they entrust their client, they base the empower around four principles: equity, access, participation, and harmony. Equity is the appropriate dissemination of resources. The Key is the everyone has access to these resources. Participation is that everyone is part of the decision-making process. Lastly, harmony is the best possible outcome for the community.
Kinderman (2013) states that psychologists should speak out against social injustices. Psychologists study human behavior, which makes them a great way to speak out for the injustices in the world. Social change primarily comes from groups and leaders (Louis, Mavor, La Macchia, & Amiot, 2014). Leadership is in a position of power to change injustice in a group quickly; however, some are unwilling to step up and be the voice for change. For the psychologist, social change could go against their code of ethics. Lack of leadership would pose a dilemma for the psychologist to choose between belief or principle of ethics. Kinderman (2013) suggest that psychologist should help other understand human behavior to shape social change.
Ethnic Inequalities on the Psychological Well-Being
People with disabilities are more likely to have lower education, low socioeconomic status, and be unemployed. Psychological well-being is already common in most cases when someone has a disability. According to Chang et al. (2014), disability was one of two factors responsible for depression rates. A person with either suffers from a mental or physical disability is at a higher risk for depression. A disabled person could be discriminated against because of limited resources. Resources may be diverted away from a person with a disability because they are considered to have a reduced quality of life and toward a person with a so-called better chance of having a good quality of life.
Analysis of any Concerns Regarding Ethnic Inequality
Disability can also affect a person’s relationships. According to Wasserman (2016), people that are married are generally happier than unmarried people. Disability can make it difficult for a person to find friendship or love. The disability is seen as creating an awkward degree of inequality and difference. Wasserman (2016) suggests that non-disabled people could think a relationship with a disabled person might be unfulfilling. Relationships are complicated for most people without disabilities. Relationships are viewed as more complex with people with disabilities because of society’s view on people with disabilities. Relationships are only one aspect of inequality that people with a disability experience. They also experience inequality in education, health care, and employment. People with disabilities understand their limitations and will not apply for the job they cannot perform. Some non-disabled people will judge a person by their disability instead of focusing on their qualifications. Society needs to focus on the person in front of us instead of the disability. Lastly, we can recognize a person’s limitations but understand they are far more capable than their disability.
Analysis of the Role of Psychology
Social psychology is a way to tie the individual to social change; however, social psychology is usually based on how individuals view others. Psychology has not had much influence on social change. Historical sociologists have been the first for social change. According to De la Sablonnière (2017), over 70 years ago, social change came up in psychological literature; however, only a few psychologists have to take on social change. Intersectionality is obtaining arise in consideration in psychology. The theory or framework comes from the work of Black feminist scholar-activists and its emphasis on interlocking systems of oppression and the necessity to effort regarding structural-level alterations to stimulate social justice and impartiality (Rosenthal, 2016). Modern curiosity in intersectionality in psychology gives a chance to lure mental health providers’ devotion to structural-level problems and make public integrity and fairness more crucial in psychology (Rosenthal, 2016). Psychologists have learned many subjects of social justice such as prejudice, discrimination, conformity, and numerous subfields around these matters in psychology. The American Psychological Association (2017) code of ethics needs psychologists to uphold all society’s rights, regardless of the stage of life, sex, gender identity, race, background, national origin, belief, sexual orientation, disability, language, or financial status. The code pushes psychologists to become mindful of these features and circumvent bias and unwarranted practices. Hays et al. (2010) suggest that group work is a way to assist in empowering clients at an individual and systemic level. Hays et al. (2010) believe in increasing attention to social justice problems using education, training, supervision, practice, and research. Promoting change within a group could help shed light on the oppression or discrimination of people with disabilities. Psychology could empower people to stand up for equal rights to promote positive change.
An explanation of the relevance of this topic to the field of psychology and the role and responsibilities of psychology concerning the issue
Individuals with a disability have experienced some shame in the world. Non-disabled people are unsure of how to handle a person’s physical or mental impairment. Psychology explore the data about physical or psychological impairment and way to treat the impairment. The field of psychology’s responsibilities should be to support and discover where the hitches are and try to shed light on the issue with the group, legislature, and community to increase the quality of life for those with disabilities.
The American Psychological Association (2013) defines clinical psychology as “a clinical discipline that involves the provision of diagnostic, assessment, treatment plan, treatment, prevention, and consultative services to patients of the emergency room, inpatient units, and clinics of hospitals.” The American Psychological Association (2013) says Clinical psychology combines “science, theory, and practice to understand, forecast and alleviate maladjustment, disabilities, and discomfort as well as to promote human adaptation, adjustment, and personal development.” Psychology concentrates on the intellectual, emotional, biological, psychological, social, and behavioral characteristics of a human role in diverse societies and at all socioeconomic levels.
Publishing Site and Reasoning
For this blog, I am choosing to launch it on the blog site Tumblr. Tumblr is a place where people of different backgrounds and points of view can express themselves, discover themselves, and find new perspectives. It is where your interests connect you with your people. This platform is very user-friendly and has been available since 2007. Using Tumblr, I can reach academics that are casually looking for more psychology-related content and a younger audience that may find comfort in reading information on disabilities and ways social change can be implemented for this social problem. Tumblr is an excellent platform to help facilitate an academic conversation because Tumblr is easily accessible and can be seen from any smart device.
References
American Psychological Association. (2017). Ethical Principles of Psychologists and Code of Conduct. Retrieved from http://www.apa.org/ethics/code/
American Psychological Association. (2013). Guidelines for psychological practice in health care delivery systems. Retrieved from http://www.apa.org/pubs/journals/features/deliverysystems.pdf
Chang, T. E., Weiss, A. P., Marques, L., Baer, L., Vogeli, C., Trinh, N. T., … Yeung, A. S. (2014). Race/Ethnicity and Other Social Determinants of Psychological Well-being and Functioning in Mental Health Clinics. Journal of Health Care for the Poor and Underserved, 25(3), 1418-1431. doi:10.1353/hpu.2014.0138
Crethar, H. C., & Ratts, M. J. (2008). Why social justice is a counseling concern. Counseling Today. Retrieved from https://www.txca.org/images/tca/Template/TXCSJ/Why_social_justice_is_a_counseling _concern.pdf
De la Sablonnière, R. (2017). Toward a Psychology of Social Change: A Typology of Social Change. Frontiers in Psychology, 8. doi:10.3389/fpsyg.2017.00397
Hays, D. G., Arredondo, P., Gladding, S. T., & Toporek, R. L. (2010). Integrating Social Justice in Group Work: The Next Decade. The Journal for Specialists in Group Work, 35(2), 177-206. doi:10.1080/01933921003706022
Kinderman, P. (2013). The role of the psychologist in social change. International Journal of Social Psychiatry, 60(4), 403-405. doi:10.1177/0020764013491741
Louis, W. R., Mavor, K. I., La Macchia, S. T., & Amiot, C. E. (2014). Social justice and psychology: What is, and what should be. Journal of Theoretical and Philosophical Psychology, 34(1), 14-27. doi:10.1037/a0033033
Rosenthal, L. (2016). Incorporating intersectionality into psychology: An opportunity to promote social justice and equity. American Psychologist, 71(6), 474-485.
Wasserman, D. (2016). Disability: Health, Well-Being, and Personal Relationships (Stanford Encyclopedia of Philosophy). Retrieved from https://plato.stanford.edu/entries/disability-health/
0 notes
tembakikanonline1 · 2 months ago
Link
Champions League semi-final draw in full as Chelsea discover opponents and Man City through  Football.London
Chelsea into Champions League semis for first time since 2014 - The Jakarta Post  Jakarta Post
Champions League hits & misses: Jude Bellingham, Man City snap hoodoo, professional Chelsea  Sky Sports
Champions League semi-finals: Paris vs Man. City, Real Madrid vs Chelsea  UEFA.com
Matchday LIVE: Porto stunner not enough vs Chelsea, Neymar unlucky not to score as PSG progress to UCL semis  Goal.com
View Full coverage on Google News
via Top stories - Google News
0 notes
clovertongue40 · 2 months ago
Text
Just How To Know If Youve Been Blacklisted And What You Can Do
The importance of "patch management" is huge considering that it can minimize greater than 80 percent of cyber hazards. Yet C-Suite "leaders" and Company Supervisors seem to think a "if it's working, don't upgrade/ spot" attitude. Vulnerabilities are expanding each year and also out of the made use of vulnerabilities in 2015, 99 percent of them had Typical Vulnerabilities as well as Exposures (CVE's) published and had patches readily available. Kerr clamed, "It was to obtain a larger summary regarding what was being said concerning the building and construction market. While Kerr rejected personally having any authorities contact, he verified that there was intermediary in between the building bosses and the polices. Validating what rank as well as data electricians have argued, Kerr claimed that companies subscribed to the Consulting Association had actually gone over the ongoing multi-million extra pound Crossrail project. Cullum McAlpine, a director of a number of Sir Robert McAlpine Ltd firms, was the beginning chair of the Consulting Organization. That consisted of the price of acquiring a blacklist--" copyright"-- from the Economic League. Kerr was fined ₤ 5,000 in July 2009 for breaching the Information Security Act by running the blacklist. Sir Robert McAlpine Ltd paid the fine "on the basis that I place myself at the front, took the flak if you like for it, so they would not be attracted into all of this, however they would remain surprise," he told the committee. Safeguarding and also reinforcing our rights at the office is at the heart of what it indicates to be Labour. Back in 2009, the Details Commissioner exposed information of a large surveillance procedure run by a company called The Consulting Association. This firm looked at documents on thousands of building workers as well as marketed the information to 44 building firms. One more blacklisting company called Caprim Ltd was set up by the previous handling director of the Economic League. According to Kerr, "Director basic Stan Hardy as well as the director of details and study Jack Winder" established up Caprim for the objectives of examining employees' Curricula vitae. He agreed that the Consulting Association's "primary get in touches with" had actually communicated with police over the blacklist. These "main contacts" were the supervisors of building and construction firms. One guy is repeated calling his ex-girlfriend, she desires the business to stop this customer from getting through. Ian Kerr benefited the Economic League from 1969, penetrating meetings and compiling blacklists. The Economic League was a shadowy organisation set up in 1919 to fight Bolshevism. He said, "I would certainly have had a documents on the Socialist Workers Celebration. Any kind of organisation that seemed to be raising and also down about building and construction, it was my duty to maintain tabs. Kerr responded, "Yes I did, the League had a pro-free enterprise position. Trotskyists were anti-capitalism and also firms were interested to understand what was being planned and considered as strategies to attempt as well as bring a business to its knees, need even more cash, or whatever reason. From the above, Operation Sandwich called a minimum of 2 individuals in connection with the files on Frank and Lisa. The very first (in para. 11.4.21) was a serving officer in 2014 as well as specifies that conferences were held at which the TCA were potentially existing. The ramification of the last sentence because paragraph is that personal material was being shared at such conferences per se-- something the Op. Frank Smith was a bricklayer as well as socialist in London that was politically involved in Militant Labour, Young People Against Racism in Europe and anti-fascist marketing. Throughout the late 1990s he remained in a partnership with an American woman, Lisa Teuscher, who was additionally energetic with YRE though not associated with the building and construction industry. The Operation Sandwich record drops a small bit of light on the authorities side of things. The Blacklist Support Group issue named two particular concerns as highlighting material in The Consulting Organization data which can just have originated from police. It took a sample of just twenty out of the more than 3 thousand names to look at, less than 0.5% of the total list. Twelve names came from the Information Commissioner that had highlighted them since particular passion. The closer the construction workers analyzed their files, the more they grew worried that particular material in those files had not simply originate from Unique Branch however had really come from undercovers such as Francis and Jenner. He was likewise associated with trade union advocacy, concentrating on building union UCATT, where he attended conferences and pickets. Especially, a number of individuals he was close to were on The Consulting Organization blacklist. In April 2012, the Blacklist Support system sent a protest to the Metropolitan Authorities declaring collusion in between Special Branch as well as building and construction business. They do not attend to at all that the information is in terms that mirror the passions of Special Branch. Much of the conversation around dates of data are false trails, as is somewhat, whether or not Peter Francis is the original source of the Unique Branch material. The actual question is that would certainly have recognized of Lisa and Frank's relationships and also the accusations around Lisa's marital condition, and why it would certainly have been of interest to The Consulting Association. This would certainly need a process to guarantee that when an IP address is reassigned, it is gotten rid of from the black listing data sources. High Court activity is currently being taken against a few of the companies involved in blacklisting as well as the Scottish Affairs Committee is holding a query right into the method. Justin Bowden, GMB nationwide policeman, claimed blacklisting had a massive effect on people's lives and the public should have to understand the truth regarding the method as well as those liable ought to be held to account. GMB protestors were joined by UCATT members outside Cleveland Bridge Ltd in Darlington today in demonstration versus a workers director, Lynne Day, they say was responsible for blacklisting 36 employees. ' Blacklisting is a scandalous technique that has no place in a modern-day economic situation. It causes torment for those on the blacklist and also jeopardizes lots of countless building and construction employees that really feel not able to elevate safety and security problems, in among the country's most dangerous sectors, for concern of losing their incomes. That's not going to be possible, because the blacklisting is nothing to do with Plusnet, and also someone could be assigned several IP addresses in a day if they experience lots of disconnections. The IP address appointed to your connection isn't showing as blacklisted for spam. The mistake you're getting due to the fact that the IP is vibrant or domestic is proper, undoubtedly. World Examine states that it takes robust steps to guarantee that information is secured which the Information Protection Act is not breached. The Globe Inspect terms and conditions require the many hundreds of subscribers who pay large sums for its solution to keep secret the reality that the person gets on a listing. Globe Examine insurance claims that its list is used by 10,000 business, consisting of a huge bulk of the world's major financial institutions and also financial institutions. https://lizily.herokuapp.com/ is divided into groups which include sanctioned entities, cash launderers, terrorists, as well as scammers. Clearly these are individuals or organisations to be avoided by risk-averse financial institutions, legal representatives, and also banks, yet on what proof is their inclusion based? P.S. If you can not recuperate your funds or obtain your phone off the blacklists, you might use it as a VoIP phone, media gamer or house automation remote. We describe other popular choices in our article on uses for old smartphones. Some used phone sites-- such as Cellswapper and also TradeMyCellular-- enable sellers to include the remainder of their contract with the phone. Globe Inspect insurance claims that the underlying details is looked at from reliable open source product and also federal government and also regulatory info. However, scientists as well as plaintiffs have actually found otherwise-- details can be outdated, sourced from islamophobic or politically determined blogs or various other outer reaches of the online neighborhood. That product belonged to a multitude of files not confiscated by the Information Commissioner. Kerr confessed to attending left wing as well as union conferences, as well as to holding files on specific unions and on the Socialist Workers Party as an organisation. Along with spying on building and construction workers, Kerr's job included snooping on the left. He informed the committee, "I visited a lot of the radical bookshops in London in Charing Cross, Caledonian Roadway, to pick up the kind of magazines that would certainly not typically be found in WH Smiths or a typical bookstand. 8 hours Northumberland Area Council is marketing for a building and construction service provider to construct 6 new railway terminals. The Unite union has also sent out documents to the Information Commissioners Office, concerning the way in which at least some companies on the Crossrail project have disseminated details of any person demonstrating outside their sites. However also if the government totally commits to it coming to be a monetary centre and also obtains it off the blacklist, doing so could come at a steep cost as it could wind up rising costs for fund managers. " One must not mark down the importance of politics behind-the-scenes to several of these problems. The mindset to IFCs is still antagonistic in numerous quarters and also evidently half of the government in Mauritius does not sustain the vision of it coming to be a financialised state," according to the report. It states it stays certain that Mauritius will be gotten rid of from the blacklist, as well as very soon-- potentially by the end of this year or February 2021 by the latest.
1 note · View note
islamreligionguardian · 2 months ago
Text
‘Sister Wives’ star Kody Brown says his four wives passed him around ‘like a rag doll’ during the pandemic
New Post has been published on https://www.islamreligionguardian.com/sister-wives-star-kody-brown-says-his-four-wives-passed-him-around-like-a-rag-doll-during-the-pandemic/
‘Sister Wives’ star Kody Brown says his four wives passed him around ‘like a rag doll’ during the pandemic
Kody Brown and his four wives have a combined 18 children
https://a57.foxnews.com/static.foxnews.com/foxnews.com/content/uploads/2021/02/1862/1048/GettyImages-492216862.jpg?ve=1&tl=1
By Stephanie Nolasco | Fox News
‘Sister Wives’ star Kody Brown, four spouses explain the motivation to chronicle their ‘plural marriage’ It’s tough having four wives during a pandemic – just ask Kody Brown.
Sunday’s episode of “Sister Wives” chronicled how the coronavirus pandemic impacted the United States, including Flagstaff, Arizona, where the plural family resides.
Brown’s wives – Christine, Janelle, Meri and Robyn – were all living in separate households to ensure social distancing, as well as to meet self-quarantining guidelines.
placeholder The exhausted patriarch said he was the only one going in-between homes.
‘SISTER WIVES’ STAR MERI BROWN SAYS MARRIAGE WITH KODY IS ‘DEAD’: ‘BEST TO LEAVE THE BALL IN HIS COURT’
Television personalities Kody Brown (C) and his wives, (L-R) Janelle Brown, Christine Brown, Meri Brown and Robyn Brown attend Hard Rock Cafe Las Vegas at Hard Rock Hotel’s 25th-anniversary celebration on October 10, 2015, in Las Vegas, Nevada.
Television personalities Kody Brown (C) and his wives, (L-R) Janelle Brown, Christine Brown, Meri Brown and Robyn Brown attend Hard Rock Cafe Las Vegas at Hard Rock Hotel’s 25th-anniversary celebration on October 10, 2015, in Las Vegas, Nevada. (Photo by Gabe Ginsberg/Getty Images)
“I guess right now my biggest worry really is if I would have to be isolated from members from my family long-term,” the 52-year-old told cameras, as quoted by People magazine on Monday.
“In my mind, part of the healing process when you’re sick is that love and nurturing you get from your loved ones,” he shared. “I’m not going to not care for a wife if she’s sick. I don’t want to not hug my kids.”
Brown has a combined 18 children with his wives.
The reality TV star admitted he was “the most dangerous person in the whole family when it comes to COVID-19 because I’m going from house to house – I could spread it from house to house.”
According to Brown, each wife runs her own household.
placeholder “There’s this sort of thing that happens in our relationships, that I guess is only fair in plural marriage – the mom, the household belongs to her,” he explained. “It just feels odd to me. ‘OK, this is what you’re going to do.’ Well, wait a second, do I have a say in this?”
‘SISTER WIVES’ STAR CHRISTINE SAYS SHE STILL GETS ‘SUPER JEALOUS’ OF HUSBAND KODY BROWN’S 3 OTHER SPOUSES
Kody Brown of Sister Wives visits Plymouth Beach on September 10, 2011, in Plymouth, Massachusetts. (Photo by Stephen J. Cohen/Getty Images)
The outlet shared that Janelle, 51, chose not to have Brown visit her home for an indefinite amount of time as they awaited more answers about the virus. The couple shares six children.
Brown said he wanted the wives to get on a conference call to discuss the topic. However, he said Janelle didn’t feel the other women needed to be involved in the conversation.
“The whole family’s got to be involved in this discussion,” he said. “You know, it’s just one of those times when maybe I wish I just told my wives what we’re going to do. But I am so confused by this whole thing that I don’t even know what to do.”
Brown and his wives eventually got participated in a conference call where he expressed his frustration.
“I feel like I’m being passed around like a rag doll now,” he said.
‘SISTER WIVES’ STAR MERI BROWN REFLECTS ON 30-YEAR MARRIAGE TO HUSBAND KODY: WE’RE ‘FIGURING OUT WHERE WE ARE’
TV personalities Meri Brwon, Janelle Brown, Kody Brown, Christine Brown and Robyn Brown speak during the ‘Sister Wives’ panel during the Discovery Communications portion of the 2010 Summer TCA press tour held at the Beverly Hilton Hotel on August 6, 2010, in Beverly Hills, California. (Photo by Frederick M. Brown/Getty Images)
https://a57.foxnews.com/static.foxnews.com/foxnews.com/content/uploads/2021/02/1862/1048/GettyImages-103270153.jpg?ve=1&tl=1
Brown later said he didn’t like being told what to do.
“My schedule is always a sensitive subject,” he said. “All my wives have a different opinion of what my schedule should be. But the issue is it’s a sensitive subject to me, and I don’t like them telling me what my schedule is.”
“Sister Wives” aims to show how Brown and his family navigate life in a world that seems to shun their lifestyle. The reality TV series has been airing since 2010.
Brown’s first and only legally recognized marriage was in 1990 to Meri, The New York Times previously reported. The pair originally met in 1989 through mutual friends and tied the knot six months later when she was 19 and he 22. Five years later, they welcomed their daughter Mariah. The newspaper shared that Brown’s second wife Janelle came in 1993, followed by wife Christine a year later.
Brown and Meri divorced in 2014, AZCentral.com reported. He legally married his fourth wife Robyn, so that he could adopt her children from a previous relationship. Brown has previously said he is “spiritually” married to Meri, Janelle and Christine.
‘Sister Wives’ has been airing since 2010. (Gabe Ginsberg/FilmMagic/Getty Images)
Being married to more than one person, or bigamy is illegal across the United States. The law in Mormon-heavy Utah is considered stricter because of a unique provision that bars married people from living with a second “spiritual spouse.”
The Church of Jesus Christ of Latter-day Saints abandoned polygamy in 1890 and strictly prohibits it today. The Browns consider themselves fundamentalist Mormons.
Back in 2019, Brown told Fox News that the family has agreed on not considering a fifth wife anytime soon.
“We really took the fifth wife thing off the table a long time ago,” said Brown. “And because we don’t want to snub the concept, we’ve always sort of been very casually dismissing it, and I think that’s one reason the question keeps coming up. But it’s technically been off the table as long as we’ve done the show.”
“Sister Wives” airs Sundays at 10 p.m. ET on TLC. The Associated Press contributed to this report.
source https://www.foxnews.com/entertainment/sister-wives-kody-brown-coronavirus-tlc
Like this:
Like Loading…
Related
0 notes