#i tried to search tumblr for other posts like this | Explore Tumblr Posts and Blogs

Visit Blog

Explore Tumblr blogs with no restrictions, modern design and the best experience.

Fun Fact

Tumblr Inc. is funded by 13 investors.

#i tried to search tumblr for other posts like this

aurevell · 6 months

Text

Returning the Favor Sterek | 5k | T

Stiles pays a nighttime visit to his boyfriend in secret, or so he thinks. Unfortunately, the Hale family has keener ears than he realizes.

It’s late when Derek hears the noise at the side of the house. A creak of siding that cuts through the backdrop of cricket song. Just one lone sound, but there’s something cautious about it. Probing.

He lowers the book he’s reading, but no other sounds follow. Derek has been lying sprawled across his bed, drowsy and warm and comfortable, sweatpant-clad legs resting against the wall—but now that he’s conscious of the sound, his focus sharpening, he thinks he’s been hearing quiet noises grow nearer for some time without quite comprehending them. A wild animal outside, maybe, creeping slowly around the foundation of the house. Something large enough that the mulch in the flower bed crunches beneath its weight.

It’s not often that a solitary animal grows bold enough to venture this close to a werewolf pack—the scent always scares them off first. They don’t even get raccoons out here, especially not with the cold this time of year. It could always be their cousin Warren, who’s always thought it funny to startle his relatives with unexpected visits in the dead of night. Or any one of the nasty things in Uncle Peter’s wild stories, supernatural things that creep into the house come dark.

Derek glances at the window, book still resting on his chest, but the house is still.

Maybe it’s gone. That’s just as well: he’s too comfortable to drag himself over to the window to look.

And then another sound comes, an unmistakable creak. Heavy weight settling into place.

Downstairs, his mother sighs. “What was that?” she demands, her voice faint with distance. She and his dad are likely out on the porch swing at this time of evening, even though it’s nearly winter, lunatics that they are. “If Laura and Cora are at it again—”

“I’m sure they aren’t, Tal,” Derek’s father replies, sounding amused. “You put the fear of god in them.”

Mom scoffs. “If we have to repair another door, it’s coming out of their pockets.”

“Not everything is my fault, Mom,” Cora mutters pointedly from down the hall. There’s heavy metal coming from the vicinity of Laura’s bedroom, just low enough to be blasting from her headphones, and she doesn’t pipe up to defend herself.

The thing hasn’t gone away. Metal squeaks a moment later, and then the scrabbling returns, punctuated by a thump and a muffled grunt.

Annoyed, Derek tosses the book aside and clambers to his feet, crossing over to the window. When he hoists up the sash, letting the night chill waft in, he peers down into the dark and finds that the source is worse than anything he could have imagined.

It’s his boyfriend, scaling the side of the house like some deranged cat burglar.

Stiles is hanging onto the drainpipe, having managed to hoist himself several feet off the ground. He’s leaning against the metal awning over the kitchen window, one foot atop the shutter and the other scrabbling for purchase against the siding. At the clatter of Derek’s opening window, he looks up, startled, and nearly loses his balance.

“What are you doing here?” Derek hisses.

“Just returning the favor.” With a moment to catch himself against the awning, Stiles gets his bearing and grins. “What? Don’t make that face. C’mon, you can show up at all hours of the night, but turnabout isn’t fair play?”

With that, he sticks his tongue between his teeth, which he sometimes does unconsciously when something demands his full attention. And the perilous task of climbing should get his full attention, given how often he stumbles when both of his feet are on the ground. God, Derek is about to witness his idiot boyfriend fall to his death or something.

Stiles heaves himself mostly onto the awning, clawing for purchase with a grunt. When he reaches for the window, he loses his grip, nearly sliding backward onto the grass; in a flash of panic, Derek grabs him by his shirt and yanks him forward.

“Are you trying to get yourself killed?” he demands, aware of their volume and even more aware of their audience.

The awning rattles as Stiles draws up his long legs to slip inside the window feet first, ducking under the sash. He’s panting a little as he pulls himself upright, though he bats his eyes sweetly in the face of Derek’s scowl. “Oh, please. I knew you’d catch me. ‘My hero,’ and all that.”

“Should have let you fall and die,” Derek retorts, shutting the window.

“Probably. Oh man, that was so athletic. Sometimes, I amaze myself.”

Derek doesn’t have anything smart to say to that. He’s only half paying attention, too busy bracing for the discussion sure to follow.

He and Stiles may as well have stomped up and down the stairs blowing air horns as far as the rest of the house goes. Everyone will have heard. Derek is absolutely sure because you can hear a pin drop, like no one’s even moving, like everyone’s waiting with bated breath—either gleeful or judgmental or both—to hear what comes next. Even Laura’s deafening headphones have gone silent. Fuck.

Worst of all…Stiles doesn’t know any of this. He doesn’t yet know about the secret the Hale family hides, or how keenly they can hear, or that every word he says will be seized up and cheerfully dissected and gossiped about in real time.

Read the rest on AO3

#sterek #sterek fic #mine #vaguely inspired by a tumblr post i have been unable to find after multiple searches in the month+ it took me to write this #i think it was a pic of two cats falling off a roof??#and whoever posted it was basically like 'haha this is stiles-coded after he tries to climb derek's window and pulls derek down with him'#i'm pretty sure i even reblogged it and yet where is it??#if you know what i'm talking about let me know lmao #anyway #this is only a little bit about stiles struggling through the window #mostly it's about how i think werewolf hearing would upgrade the sibling-on-sibling crime possibilities in any given household #and the fact that you could not get away with ANYTHING noisy without every other person in the house knowing about it #so having blabbermouth stiles stilinski pop into said household while being totally ignorant of the existence of werewolves...#let's just say 'poor derek' and leave it at that lmao

82 notes · View notes

jaggedwolf · 2 years

Text

Okay, so yesterday some friends and I got distracted by the math behind constructing a speed-dating event that has at least one person in each of the following demographics: (A) straight women (B) straight men (C) bi woman (D) bi men (E) gay women (F) gay men.

The requirements are

every person meets every possible match for them

no one spends a round idle, but it’s okay for them to be sent home before other people

We over-complicated it at first but we eventually landed on the obvious smallest workable example.

Say we have 1 person in every demographic. For the first round, the pairs are

the straight woman with the straight man

the gay woman with the bi woman

the gay man with the bi man

The gay folks go home, and the second round is:

the straight woman with the bi man

the straight man with the bi woman

The straight folks go home, and the third (and final) round is:

the bi woman with the bi man

And we’re done in 3 rounds. Does this extend if we have n people for each demographic, where n > 1? Let’s see.

For the first n rounds, the following pairs can be dealt with

every straight woman meets every straight man

every gay woman meets every bi woman

every gay man meets every bi man

For the next n rounds, the following pairs can meet

every straight woman meets every bi man

every straight man meets every bi woman

every gay women has met each other and leaves a round before this cycle ends

every gay man has met each other and leaves a round before this cycle ends

Note that we run into a new requirement to meet our second constraint: If n > 1, n must be even. I.E If we had 3 gay men, we’d have a round where 2 of them met but the 3rd would be idle and unable to go home yet, because he hasn’t met either of them. (I don’t think this is resolvable by picking a different order of matches but I’m too lazy to properly prove it at the moment.)

For the last two bullet points, a quick aside on pairs and rounds for a group of size n solely consisting of gay women or solely consisting of gay men. The number of possible pairs is n choose 2, or n(n − 1)/2, and in a given round we tackle n/2 of those pairs, so it only takes n − 1 rounds for all pairs to meet.

You can see this clearly with n=4 - each straight/bi woman/man has 4 candidates to meet in this set of rounds, while each gay woman/man has 3, and so the latter will be putting on their coats as the last round for the former occurs.

Okay, so both the gay and straight folks go home. We then have 2n bi folk left, none of whom have met each other, so in the next 2n − 1 rounds,

every bi woman/man meets every other bi woman/man

And we’re done in 4n-1 rounds.

The follow-up question is of course how much can the numbers for each demographic vary wrt to each other while still satisfying the two constraints we started with, as opposed to assuming the same number for each.

At that point it might be useful to look at the overall number of matches for each demo as opposed to immediately iterating through them. Like if we let there be a straight women, b straight men, so on and so forth, the number of possible matches for each member of each demo is as follows:

(A) Straight woman: b + d

(B) Straight men: a + c

(D) Bi men: a + c + (d − 1) + f

(E) Gay women: c + (e − 1)

(F) Gay men: d + (f − 1)

And you can probably extract some equalities/inequalities out of this? At least you’d know the number of rounds for a workable set would be max(matches(C), matches(D)).

#look this is like that post about bruce wayne being named after springsteen #where else can i post this other than tumblr #math #i guess???#i tried doing a weaksauce search on the internet and scholar to see if I could find an existing elucidation of this but i failed #it's probably out there #mine

6 notes · View notes

hellsitegenetics · 2 months

Text

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

#hellsitegenetics #faq #intro post #flowers #plants #requests #birds of paradise #asks #remember to keep checking back!

1K notes · View notes

ao3commentoftheday · 4 months

Text

what is an RSS feed and why does AO3 have them?

RSS stands for Really Simple Syndication, and the word syndication here is referring to broadcasting or transferring or otherwise sharing information. I first encountered it as a way to aggregate all of the news sites and blogs I wanted to read that were scattered all over the internet.

You might already be familiar with tumblr blogs that start with ao3feed - these are automated blogs that create a new post every time a work is posted in the feed(s) that they track. You can follow those tumblr blogs and learn about new works that way. They've subscribed to the RSS feed so that you don't have to.

If you wish that you could get push notifications from AO3 on your phone instead? The RSS feed will allow you to do that. You just need to get an account with an RSS reader first. Here are a few that are free:

Feedly

NewsBlur

Inoreader

They each have slightly different features, so depending on the search and filter options you want or how you like your information displayed, you might like one better than the others. All three work on the web, on iOS, and on Android.

Once you have a feed reader, tap on the RSS Feed button at the top of the tag results page that you want to get notifications for and open up the XML file. If it downloads instead, try opening in a new tab or just copying the link address. You'll want to grab a url that looks like this: https://archiveofourown.org/tags/9835/feed.atom (this is the url for Kirk/Spock, if you're curious)

That feed.atom ending on the url is what you're looking for. When you open your RSS reader and create a new feed, you can use that url to set it up.

Once it's set up, you'll be able to see everything currently available in that tab, listed out in your reader. Just like the ao3feed tumblr blogs, the reader will show you the title, author, summary and tags for each fic, and then it will provide you with a link to read the work on AO3.

It will also notify you every time a new work is posted to that tag. You can adjust your notifications to suit you.

Not every tag on AO3 has an RSS feed, but it's worth checking out if you've never tried it before.

Editing to add: the AO3 FAQ also talks about these feeds

#how to ao3 #it's also how to get the tag ID number #but that's a separate post

1K notes · View notes

vacayisland · 4 months

Text

@!; Meet the Wifie JD / Female! Reader

"Summary"! You had always heard about JD's brothers, but you had never met them before as you had gotten with JD after the band had broken up. Yet, while on a mission to save Floyd, you were slowly introduced to his brothers, each in their own silly yet loving ways. "Tags"! Fluff? Idk somehow a fight almost breaks with between the Reader and poor Clay. Also tumblr is being weird so praying this posts this way.

@storydays @chamille-trash @valvalentine69 @gtdkibf6jshhshjd

@!; Branch and Poppy would be the first to know the truth about JD; A truth he might have forgotten to tell his brothers back in the band days, and something he even forgot to tell Branch and Poppy before they rode in Rhonda for the first time. It wasn't like he was trying to keep secrets, far from it; JD was more than proud of this little secret he has managed to cheek, yet in the flurry of re-meeting Branch and meeting Poppy and getting them both down to help save Floyd, he might have forgotten this tiny detail. "Branch! You never told me you guys has a sister!" Poppy exclaimed as she bounced into Rhonda, beaming from ear to ear as she noticed another Troll inside; they were looking over a few scattered papers, receipts, post cards, anything that she's been able to dig up. Yet her attention was caught away from her search and study when three Trolls entered the little RV, even more so calling her JD's brother. She tried to explain to Poppy that she wasn't JD's sister, that she was in fact his girlfriend, yet JD stopped her before she could; raising a hand in her direction as soon as he saw her open her mouth. He playfully wiggled a finger at Poppy, "That's the wifie!" "You're married?!" Poppy exclaimed with excitement, while Branch seemed taken aback instantly; his attention filtered from you to JD, a silent question engulfing his eyes as he tried to fathom a world where someone would have interest in his older brother. "Well, uh, not technically?" JD rubbed the back of his neck and chuckled with nerves; While you chuckled, a bit more sweetly, along side of him. Poppy tilted her head in confusion, her arms dropping to the side as she tried to think of how JD called you his 'wife' but you guys weren't married. Branch stood next to Poppy, still trying to fathom this whole situation. Wondering how you, someone who seemed so... not JD, ended up with someone like his older brother. As in given example, you were careful to stand up and walk around all the evidence you had dug up from boxes of old things that JD had kept since his band days. While JD, while turning around to reach for your waist, almost stepped and step a whole stack of papers flying to the floor! You had stopped him before he did so, thankfully, playfully smacking his leg away from the stack so he would yelp but realize his mistake and draw his leg back. "Hi, it's so very nice to meet you two." You would extend your hand towards Branch and Poppy; In which, Poppy grabbed your hand first and shook it enthusiastically. "Hello! It's so very nice to meet you!" Exclaimed Poppy as she almost made your arm fall off with how vigorously she was shaking it, "I'm Branch's, JD's younger brother, girlfriend. And can I say, you have very lovely hair." You smiled at Poppy, though were glad to be able to pull your hand away when she finished the hand shake. With your other hand, you grabbed onto the closest hand JD had to you, interlocking your fingers.

"Well, it's very nice to meet you both. I expect you both know what's happening?" You received a nod from Poppy, while Branch just kept his eyes square on JD; who tried to play it cool, but you noticed the tiniest sweat drop rolling down his forehead. "Well then, Poppy, would you like to help me search for clues? I'm trying to find where Spruce is-" You didn't even have to finish before Poppy bounded over, grabbing your hand and rushed over to the pile of documents and files you had pulled out. It genuinely shocked you how much energy she had. But you were not going to let that scare you! What you and Poppy didn't notice, as you were sorting and shuffling around clues, was the 'I'm watching you' fingers that Branch gave to JD. In which JD just extended his arms, wondering what Branch was going on about. Branch, in response, glanced over at you and then back to JD with a cock of his eyebrow. Confused, JD turned towards you and Poppy and then back at Branch wondering what he was getting on about. But Branch wasn't going to say his thoughts out loud, not yet.

@!; Bruce would be the second one to meet you, and much like Branch he was confused on how this even happened. Unlike Branch, he was happy that JD finally had someone who could tolerate him and his bossy ways; That's not to say that Branch was unhappy for you or JD, he was just a little jealous and sour that after all this time JD had changed yet he couldn't have been there for Branch when he needed it. Those feelings shifted from time to time the more Branch saw you and JD interact, and he couldn't help but slowly feel guilty; Yet, still standing the fact that it wasn't all that fair. Either way, Bruce met you when Poppy, Bruce, and Branch came back to Rhonda after a successful mission and a dance number about Brozone being back. You were sat in the driver's seat, mindlessly shuffling a deck of cards; You had been asked if you would like to join the three, mostly by Poppy and JD, but you had declined as you weren't much of a people person. It's what drew you to JD at first, when you heard he was going solo around the globe in a 'soul-searching' journey. You asked more about it and slowly the two of you had grown closer than you ever thought would be possible. As such, you always tended to miss him dearly when he stepped off Rhonda. And, subsequently, is why you bounded onto your feet when you heard the door open. You didn't even mind that the deck of cards had spilt all over the floor as you heard your boyfriends all too familiar voice shout, "Honey, we're home!" Which was followed by a confused new voice, "Honey?" "You'll get used to it." And Branch's snarky comeback. They had managed to grab Spruce, no doubt, thanks to the post card. Yet, before JD could introduce you both, he had to take care of the loving and attentive girlfriend that had appeared right in front of him; Grabbing both his hands and welcoming him back with a big smile, while also accidentally stopping those from behind JD; Who had to awkwardly shuffle around the two of you. "What did you do?" JD quipped, smirking down at you with a curious look. He hadn't notice the stack of playing cards that had been left on the ground yet, which Poppy had began to pick up out of habit. "Nothing! I just missed you." Branch, standing next to Bruce, could swear he could see the definition of heart eyes in your eyes. He wasn't sure if he was actually happy for his brother, or a little grossed out, or jealous, or all the above with some plausible explanation for his emotions that he didn't feel like going into. JD, having forgotten that you two had company over, was quick to scoop you up into his arms, as he usually did when you greeted him back home. His arms rested under your thighs, supporting you as you sat on his forearms, and as you wrapped your arms around his neck while your legs wrapped around his waist. There was something always so peaceful yet exciting being this close to JD; Being able to clearly see his eyes, as you cupped his cheeks and leaned down to connect your foreheads. You were able to smell his cologne, which you swore you could get drunk off of. You could just feel his warmth and be able to take a moment to stop and breath and remember that he's here and he isn't going anywhere. You could just, be; Be here with JD and not have to worry about anything. And the way that JD tightened his hold, the way he looked back up at you with adoration... you knew he wouldn't have it any other way. Even if you almost kicked him out of his own bus one time because he was being a pain in your ass. A cough from Branch, and awing from Poppy, snapped you both out of your love-drunk dazes. Causing you to sit up properly and glance over at the company, all the while you kept JD's cheeks cupped with your hands and he couldn't really tilt his head to see everyone. "You both are!... adorable!" Poppy shouted, bouncing on her toes as she held onto Branch's arm. You couldn't help but laugh as her reaction, noticing that she was refraining from shaking Branch with all her might.

"Yeah, very cute." Sarcasm leaked out of Branch, "But have you both realized we've been standing here for a minute? We need to go out and look for Clay so we can save Floyd!- Yet, Bruce only patted Branch on the shoulder, "Calm down, Bitty B! I wanna meet JD's partner." Along with giving you both a smile as you slide out of JD's arms and onto the floor. At least, you were attempting to do so, but JD only tightened his hold. "Bruce, meet the wifie; Wifie, meet Bruce one of my younger brothers. Good, there you guys meet. Now if you excuse us," And, though Bruce seemed to have wanted to met more, he simply walked away with you still in his arms. Which caused you to flush but laugh, playfully smacking his shoulder and asking what has gotten into him! But, then again, this was your boyfriend and he was usually this selfish with you.

@!; Clay met you in Putt-Putt Village, where you had been convinced by JD to come out with everyone else. He had claimed that it was simply too dark and spooky to let you stay home alone and he couldn't make sure you were properly safe in Rhonda. You tried arguing saying that he's left you in worse conditions, which seemed to get a rile out of Bruce who questioned him what you had meant. It was funny to watch JD sputtering out reasons and excuses and examples, but in the end you decided to join them. It would do you good to get some fresh air after so many hours of basically non-stop traveling. To say you regretted your choice as soon as the clown-head started talking would be an understatement. To say you weren't about to kill JD when gulf balls began to animate and roll around you, was an understatement. To say that you then didn't smack JD behind the head when everything turned out to be alright was... actually, that's not an understatement because that's exactly what you had done. "And you said I wouldn't be safe in Rhonda! When has she ever let me get surrounded by gulf-balls that actually turned out to be Trolls." You had 'scolded' JD as you smacked him behind the head. It wasn't anything hard, just a small one-two to see if he still had some sort of brain in there. JD jerked towards you with the most betrayed look you've every seen him give, "Babe!" JD sputtered, not knowing how to respond to you assault! "I'm about to go back to the trailer." You muttered, a little salty. Crossing your arms you turned away from JD and towards Viva, who was screaming about how the new guests needed friends and milkshakes; Which the other Trolls in the village jumped onto getting. "If you go back I might have to follow you to correct this attituded we're having." JD snirked slyly, crossing his arms as he flashed me a knowing glance. Wiggling his eyebrows and winking playfully, leaving you slightly baffled at his boldness in front of everyone. "JOHN D-" You started, yet was quickly cut off as you hadn't noticed Clay's sudden appearance; or how he had rushed over to say hello to baby Branch and Bruce, giving a lack luster response to JD. That itched you wrong. Sure, you knew JD hadn't been the best to his brothers in their band days but that still gave him no right to look and act like that towards JD. You momentarily forgot JD's comment, or the fact that he probably almost killed you earlier (to which he would rightly remind you about your flare for dramatics, and how much he loved them) and marched over to where Poppy, Branch, and Bruce where. Poppy was attempting to introduce herself to Clay, who stood in front of them, yet you pushed past them and stood as a barrier between the three and Clay; Who gave you a weird look, and was slightly taken a back by your forwardness. "Hel-" Clay tried, but didn't get very far in his greeting. "I'm sorry, I didn't know that you had a stick up your ass that someone needs to remove, Cupcakes." You spat at him as you crossed your arms, shooting him the nastiest glare you could fathom at this point. Which was nasty enough to get both Bruce and Poppy to back up a little, and Poppy to slowly inch Branch away from you and Clay.

Though Branch didn't seem to enjoy the way you were talking to his third eldest brother. He opened his mouth to say something, yet you cut him off, "Furthermore, is that how you're really going to greet your brother after all these years? With plain favoritism to the others despite everything he's had to go through and is trying to actively change because of everything that went wrong, huh?" "Oooh'kay, Babe," JD carefully walked over to you, knowing you were a little on the edge; That and you had smacked him behind the head earlier and he wasn't looking for another one of those. "How about we take a step back and go calm down-" "Nah, Imma beat his ass!" It wasn't the best first meeting you could have had with one of JD's brother, and it also put a little sour kick into the two you had met before, yet it was eventful, that was for sure. Who wouldn't find it eventful for having their older brother's spunky girlfriend almost beat their ass over a few choice words and actions towards him? Yeah... you were going to have to do a little bit of work to mend that with Clay.

@!; You officially, without the fear of him dying or any of the other brothers for that fact, met Floyd before the KISMET and BroZone concert backstage. You were there to support JD, and in turn his brothers. Sure, you had seen and heard all about Floyd before this moment but you weren't exactly sure what to expect from him. Especially since you knew that Clay or at least Bruce or Branch had told Floyd about the whole Clay fiasco on the way back. "You're (Y/N), right?" Floyd's voice from behind you caught your attention despite the current list of groceries you were writing. "Huh?" You muttered at first, having been caught off guard by Floyd's sudden approach. You couldn't help but wonder if he was here for some other reason than first greetings. "Yeah.. that's me... and you're Floyd, right?" Floyd would nod as you set down your pad and pencil on your lap, which was cross-crossed as you sat on the floor. Floyd, still a little worn down from all the talent that was taken from him, joined you on the floor and had decided to sit next to you. You weren't sure why, nor did you completely understand the sudden nerves that had struck in your body. You weren't this nervous when you met any of JD's other brothers; So, how come you were nervous now? Floyd seemed to notice this. His eyebrows frowned up as he smiled softly at you, placing a comforting hand on your shoulder. "Hey, I'm not here to scold you if that's what you're expecting." There was a hint of laughter in his voice, "I mean, I know what happened when you first met Clay but that's in the past, yeah? Plus, you were only trying to stand up for JD... which is sweet, I appreciated it." You jerked your head up to look at Floyd, a little baffled that he was so different from his other brothers. Before, you had been nervously fiddling with your notepad and pencil, unable to form a word to say to him. Yet, he seemed to somehow calm your nerves. Not instantly, like JD had always managed to do, but slowly with a firm reassurance. "Oh," You mouthed, before smiling, "Yeah, I still don't think I've made that up to Clay yet. I mean," You paused for a second, "I did kind of almost attack him just because he rolled his eyes at JD. It struck a wrong cord with me." Floyd chuckled, "Hey, don't worry, I get it. I always get that icky feeling whenever my brothers fight, but that's just how they are." "A ragtag team of brothers who both love yet hate each other at the exact same time?" You joked, cocking up an eyebrow. "And yet, we wouldn't have it any other way." Floyd replied with a smile, turning to look at his other brothers, who were all warming up and stretching. You glanced down at your notepad, reading the list of groceries you would need to get for the bus when JD and you set off again. There wasn't many placed to stop and get food on the road, unless you and JD gathered and hunted. "Hey, I don't know if anyone has told you this.." Floyd snapped you out of your thoughts again, "But thank you." You were baffled, "Thank you?" "Thank you," Floyd shrugged his shoulders, but his smile was so genuine and sweet. "For being there for John Dory when we weren't. For helping him at his lowest. You know, he talks a lot about you when you're not around and I don't think I would want any other Troll to be with JD than you. Welcome to the family, Sister-in-law." Floyd held out a fist bump, though knew you might need a minute by the tears welling in your eyes.

You had told yourself many, many years ago (when you first got with JD and heard about his band days) that you would never pick a favorite brother of his; Just incase it would cause some sort of family drama to arise. You didn't exactly have siblings, so you didn't really know what they fought about and what they didn't. So you told yourself if you ever met the brothers you would do your best to quell anything that came up. Yet, Floyd was making this very difficult right now... "JOHN DORY FLOYD IS MY FAVORITE BROTHER!" You rushed out, snagging Floyd's wrist and shoving it up in the air; To which he yelped, not having expected such a sudden reaction. John Dory, peaking in front backstage, stared for a moment. He hadn't fully heard you, but was able to quickly piece together what you had said: "WHAT?! BABE I'M MEANT TO BE YOUR FAVORITE!" "I don't make the rules JD, maybe you shouldn't have almost killed me!" "IT WAS ONE TIME AND NOTHING HAPPENED!" "Should have let me stay with Rhonda." You playfully shook your head towards your boyfriend, who stood in the doorway completely baffled and a little butt hurt. But, you couldn't help but laugh as his goofy expression, absolutely loving every part of him; His grumpy sides, his loving sides, and even his down-right baffled and confused sides.

.ᐟ this work is published and owned by @vacayisland. please do not plagiarize, copy, or steal this work; like, reblogs, and saves are appreciated :D

#brozone x reader #john dory headcanons #john dory x reader #john dory trolls #trolls #dreamworks trolls #trolls band together #trolls dreamworks #trolls 3 #brozone #clay trolls #trolls fandom #floyd trolls #spruce trolls #bruce trolls #branch trolls #poppy trolls #broppy

1K notes · View notes

queenimmadolla · 1 year

Note

I need a part in the penny verse where the whole Eddie telling baby bump penny that her mom is going to be a MILF comes into play.

Like one we day the reader is picking up penny from school and maybe another kids dad flirts with her or like a new neighbor of theirs does and maybe Eddie’s reaction to that

Not even gonna front with you, I've been sitting on this for a min because I wrote it and then freaking forgot about it. I did take some creative liberties, but I think you'll like what I got for ya. Ps, ‘baby bump penny’ had my heart throwing up, I always forget that we get her in different phases of her existence and she was once in reader’s belly 🥹💘

to everyone else, sorry, I can't link shit but this is a follow up to a ton of other pennyverse entries so you can search that on my tumblr until the links work again. and i'm trying the keep reading cut again, let me know if it fucks up the post.

(dad!eddie munson x mom!reader)

Summary: Something's been bothering you these last couple of weeks and you won't tell Eddie what it is. Like that'll stop him, he's determined to figure it out.

warnings: a creepy (and freaking terrible) dad hits on reader, implied unwelcome advances, crude comments about reader and the female body (eddie sets this fucker straight), protective!eddie :)

Eddie knew you. He knew every fiber of your being, every marker in your past, all the ways you liked to style your hair, how you decided on what makeup to put on that day—if you even wore any—,the different types of silence you’d sink into and what they meant, your body (god, he was intimately in tune with it), and every different smile you wore. Eddie knew you.

He just didn’t know exactly what went on in that beautiful head of yours. Eddie was positive he had a sixth sense catered only to you, it’d let him know whenever there was something wrong, something bothering you. It prompted him to approach you, watch you even more than he already did. Putting himself metaphorically in your shoes usually helped him figure it out the rest of the way, but for this particular occurrence, he had nothing to go on.

For the past couple of weeks, since Penny had started preschool, you’d moved your work schedule around to go in earlier so you’d be out in time to pick Penny up from school and snag the baby from Maude and Wayne, who watched him while you and Eddie were at work.

Eddie noticed a change in you. It was minor at first, a little frazzled when he’d get home, but you hid it well. Now, you looked bothered. Always zoned out, with a frown on your face. You never left the house like that, always gave him and the kids kisses before you went on your merry way (well, as happy as you could be going to a desk job), so it had to be something that happened after you left home that bothered you.

It wasn’t work, you’d rant to Eddie about it if you had a bad day but you liked to leave work problems at your desk when you left it, something about not being paid to worry or think about work after hours.

It bugged the fuck out of him. He’d tried to approach the subject before, leaving you openings to tell him what was going on but you always shrugged it off and went on about your day as if you hadn’t been upset over something. You couldn’t hide it completely, though. Not from Eddie, he could still see those split seconds where your mind wandered off and the corners of your lips twitched down.

Given how stubborn you were, Eddie decided he’d need to take a more hands on approach. Since he suspected something was happening after you left home in the mornings and before he got home from work, he’d have to be present for that timeframe.

He’d left work around lunchtime, Norm was understanding about it and didn't really care all that much since it was a relatively slow day for business.

His son had been delighted when he picked him up from his Grandpa and (grandma) Maude’s, squirming and wiggling in her hold until Eddie got a hold of him. Baby Wayne had immediately placed his hands on Eddie’s jaw, urging his dad to bend his head so he could rest his forehead against his own, those big eyes of his fluttering shut the moment they connected and soft coos of dada mumbled in between them, unlike Penny had, Wayne caught onto the baby babble of mama and dada. Penny hadn’t because one of you was always helicoptering around her so Princess Penny hadn’t felt the need.

Eddie would never get over how much his baby seemed to love cuddling with his parents, everytime baby Wayne was affectionate, he turned into goo, melting in his chubby hands. They lingered in the trailer for a couple of minutes while Eddie and big Wayne discussed how things were going in the apartment, though it had been more than a year since they’d moved in. Naturally, Wayne had asked why he was stopping by so early to pick up the baby so your change in demeanor came up in conversation.

“Mmm, I been noticin’ ‘er actin’ odd whenever she comes to pick up little man. Seems fine when she gets ‘ere. ‘S when she leaves, she seems a little…”

“Hesitant?” Eddie supplied and Wayne nodded, mouth pressed in a firm line.

It was then that Maude Maple spoke up, something the widow rarely did in the presence of anyone other than Wayne, and it was with great hesitance.

“She—she mentioned something once, about the pick up at Penny’s preschool. She didn’t go into too much detail, I think she’s bothered by it.”

“Looks like I’m on pick-up duty today.”

After leaving Wayne and Maude’s and asking the latter to give you a call at work to let you know he picked the baby up, Eddie spent the rest of the afternoon with baby Wayne. It involved a food fight—yes, Eddie flung some back at him, he had it coming, when Wayne had decided he was done being fed and done with food that wasn’t coming from your boob so he’d thrown the macaroni at his dad’s face—a shared shower to rid evidence of said food fight, jamming out (terribly) on toy musical instruments before Eddie gave him a bottle and some cuddles while he put Wayne down for his nap. . . And fell asleep with him.

You came home to a suspiciously quiet apartment, a little too clean, save for a couple of toys in the living room. You found your boys in Wayne’s nursery, both of them in the crib.

It was a heartwarming and comical sight, Eddie’s legs were dangling outside of the crib and the baby was curled up on his chest, though he stirred at the sound of the door opening, pushing himself up off his dad as he blinked lazily at you, mouth parting to reveal a couple of little white nubs in his gummy smile, teeth coming in.

He cooed softly, once. When you didn’t immediately go pick him up, he let out a stream of coos, loud and demanding but still loving as he tried to entice you over. When you still stood there giggling, he got mad, seemingly joining you in your laughter with his fake and very forced sounding baby laugh which quickly morphed into fake cries as he pushed himself to his feet and stood on Eddie’s chest, clinging to the bars of his crib as though he were a locked up criminal.

Eddie groaned, hands moving to grab your son and you finally made your way over, picking Wayne up—much to his utter delight—to relieve Eddie of his weight.

“Ouch, dude. You can’t just stand on people like that, it’s rude.” He croaked out, as his son’s weight was lifted off of his chest.

Eddie couldn’t even be annoyed, not when he could see Wayne scrambling eagerly in your arms, face rubbing into your neck, chest, cheek, anywhere the little guy could reach in his desperation and excitement to be as close as he could to his mama.

After giving Wayne’s tummy some tickles, amplifying his excited wiggles with a few ‘so excited, so excited’s, you leaned over so the both of you could stare down at Eddie, amusement cloaking your pretty features.

“I think it might be time to get you a big boy bed.”

Eddie huffed out a laugh and then groaned once more as he tried to sit up as much as he could, which wasn’t a whole lot given the fact half of him was hanging out of the crib.

“This is gonna be fun,” he mumbled, but eventually he was able to maneuver himself out of it without breaking it. He placed his hands on his lower back, arching until it gave away to a satisfying pop.

“Oh, yeah. That’s good.”

“Daddy’s so silly, huh?” You asked your son, bouncing him in your arms as you placed a kiss on his curly head before directing your next question to Eddie, “Is everything okay, baby?”

“Just peachy, honey.” He was definitely gonna have to ask you to rub his back tonight. “Wanted to have some one-on-one time with him, even if he regularly abandons me the moment you’re in sight.”

Eddie reached a finger out to tickle Wayne’s stomach, smirking when he laughed and tried to hide further in your hold.

You smiled at their interaction, though the joy quickly flitted from your expression, “Do you want to watch him? While I go pick up Penny?”

Another obvious tell something was wrong: you’d chosen to come home, put an intentional stop between getting off of work and picking up Penny. It was almost as though you needed time to prepare yourself, which was a giant freaking red flag to Eddie considering you used to drive straight over to her school and wait for her.

“Why don’t you stay with him? I can go pick her up.”

The light returned to your eyes.

“Really? I mean—I don’t mind, I don’t want to get in the way of your bonding time.”

“He’s clearly over me,” The sentence was whispered at his son with fake aggression, which left Wayne a giggling mess once more, Eddie chuckled and gave his son’s chin an affectionate squeeze and wiggle, “I’ll pick up Princess Penelope, she loves the disapproving looks people give me.”

“Shut up!” You laughed, leaning up to give him a kiss before he snatched his keys off the counter.

“I’ll see you soon, beautiful.”

“Say bye-bye to daddy!” You encouraged your baby, bouncing him a little against your hip. “Buh-buh.” He waved his chunky little hand, smiling wide for his dad.

When Eddie collapsed into the door, hand clenched over his heart, you added, “Blow daddy a kiss!” Baby Wayne lifted his palm to his mouth briefly before extending his arm out in Eddie’s direction, “Mah!” Eddie pretended to catch it, smacked the invisible kiss over his mouth and blew one right back at his baby before he forced himself out the door.

His kid was so cute, it was a federal offense. The drive to Penny’s preschool was short, thanks to living close by. Eddie hopped out of the van–he and a couple of the guys from the shop installed a backseat prior to Penny’s birth–and made his way to the waiting area. Eddie had never gone to a preschool as a kid so he couldn’t exactly judge the pick up and drop off routine, but Penny’s preschool rarely allowed anyone in. They simply walked up to one of the entrance doors, rang a special doorbell attached to the building, and one of the teachers or aides or whatever would verify the adult picking them up if they didn’t recognize them and then bring the kid out.

Which meant Eddie had to stand around with other adults. There’d been a couple of them already waiting when he’d arrived, so he’d made himself comfortable on a nearby column as he waited, mind once more preoccupied with reasons as to why you didn’t seem to enjoy picking Penny up anymore. You liked Penny’s teacher, could it be one of the aides giving you a hard time? No. That’s something you would have told him.

Eddie was so distracted, he hadn’t noticed another body settle against the wall across from him.

“You a new dad? Haven’t seen you around before.”

“What?” Eddie blinked, roused from his thoughts. The guy across from him looked like he was in his mid thirties, dressed in a skeezy suit that looked like it belonged on a car lot rather than an office, and had really big, overly white teeth he couldn’t seem to put away.

“Not a new dad, a new dad to this school. Although, you do look a little young.” The stranger clarified with a shrug.

There was something about him that Eddie immediately disliked. He could tell this was not only their first interaction, it would also be their last.

“No, I usually do the drop off.” Eddie stuffed his hands into the pockets of his jacket, eyes flashing back to the entrance door just in time to make eye contact with one of the aides, he saw the recognition in her eyes before she closed the door again and felt less annoyed with the situation knowing she’d be retrieving Penny.

He hadn’t really left room for conversation, but the guy still continued.

“Gotcha, gotcha.” His head bobbed around, Eddie thought if he listened carefully enough, he could hear his brain rattling in there, “I used to be on drop off duty myself, but I hated getting the kids ready. I’ve got four of those little monsters, every little task takes goddamn near twenty minutes.” Oh, no. This guy didn’t say it with annoyance, no, he seemed contemptuous when he talked about his kids. Eddie didn’t like that.

“Wouldn’t be so bad if my wife could just get a grip on them,” Maybe she could if she had help, you’re clearly useless, “Name’s Neil, by the way.” Eddie just raised his chin in acknowledgement. One would think ol’ Neil would catch on to Eddie not wanting to talk to him, but one would be wrong. “Yup. ‘S why I’m not on drop off duty. Sure, the pick up has its faults, kids always smell like a stale fart from all that running around and they’re babbling non-stop the whole ride, but I think you’ll find you’ll like being on pick-up duty,” Then he leaned in, like he was telling a secret and whispered out, “Most of the hot moms do the pick-ups.”

That sixth sense Eddie had for you? Yeah, it was on freaking fire, hot red and jumping around. He was positive he now knew the reason behind your discomfort with picking Penny up.

Some fucking creep wouldn’t leave you alone. Eddie’s jaw ticked, hands clenched into fists from the insides of his pockets. He didn’t say anything, but that wasn’t necessary with this guy.

“Man, you should see some of them. You gotta wonder why they only have one kid, I’d be all over that.” He gave a low whistle before he let out the most unflattering of cackles.

“You missed most of the show, but there’s this one mom–god, the body on this one. . .and she’s always done up, think she works in an office or something, but she’s a sight for sore eyes. A real MILF. She’s only got one kid, too. Little girl she picks up, so you know she’s tight.”

Eddie would be committing a crime, because he knew he was talking about you. He was going to murder this asshole. He was gonna strangle Neil with his own intestines and get rid of the body in the town dump where he belonged.

He must have not noticed the crazed glint in Eddie’s eyes because the idiot kept going, “I know what you’re thinking, I’m not actively planning on doing anything. Haven’t seen her in a couple of days, pretty sure she’s working late or something because she’s gotta be snatching this kid up late. Heard she’s married to some greasy mechanic and a pretty little thing like that coming to pick up her kid with these dads around? Shit, I wouldn’t be letting her out of the house. He’s signing her up for this. You gotta wonder if she likes the attention. She’s got this shy thing going on, though. Always so meek when I’m chatting her up. Not like my wife.” Neil’s face contorted in disdain, “Four fucking kids, man.” Okay, Eddie would be murdering him on behalf of you, and his wife. And the rest of the human population. He’d had enough, it was time to make sure this shit wouldn’t be continuing. “You got any pictures?” Eddie asked, feigning interest for the first time since he’d come up to him. Neil scoffed and dug around in his pocket, “Wife won’t let me go anywhere without them, you know how it is. Constant reminders and all that, like she doesn’t trust me to not forget.”

Eddie tried not to snatch the photo out of his slimy hands, frown deepening when he realized Neil’s story about having a wife and kids was not in fact made up. Four beaming little faces stared back up at Eddie, with a pretty fifth smile in the picture. She was severely out of her husband’s league, seemingly juggling all the responsibilities on her own, all of them underappreciated and unfortunately stuck with him.

“Beautiful family,” He commented, eyes flashing to the door just as it opened to reveal Penny and the aide. He returned the photo and pulled out his wallet from his pocket by its chain. Eddie flashed the photo inside to Neil, who immediately looked like he was going to shit himself. The photo was of you sitting on the couch, Wayne sitting between your legs and Penny standing on the cushion next to you, clutching your shoulder as you all smiled for him.

Eddie slipped the wallet back into his pocket, and just as Penny began to run over, he leaned in to whisper like Neil had earlier, “Here’s what’s gonna happen: you're not ever gonna talk to my wife again or I’ll fuck you up. If you so much as look in her direction, I’ll kill you. If you think about her, I’ll beat you 'til the bones of my knuckles break through the skin. I’ll make sure you experience pain like you’ve never felt before. Bones can heal, but I promise you they don’t grow back, you pathetic fucking worm. You don’t deserve your wife, who gave you four fucking beautiful children, and you don’t deserve your kids, either. If I ever see her in public, I’m gonna tell her that so you’d better start appreciating her now. I’ve got a friend who wants a ton of kids and I’m sure he wouldn’t mind me sending him their way. Got it?” Neil, good ol’ clammy, pale faced Neil swallowed hard and silently nodded as Penny finally reached him, arms already outstretched. Eddie swooped her up before she ran into him, relishing in the way her arms wrapped tightly around him in a hug. And this fucker was annoyed to have four little people who gave him these.

“Hi, sweet pea! Daddy’s just gonna finish up this conversation with Neil here and we’ll head home to mama, okay?”

Penny nodded eagerly, turning her head to stare inquisitively at the man she knew was her friend Izzy’s dad.

Eddie took Penny’s backpack off of her with her help and slid it over his free arm, “I’m glad we understand each other, Neil. And if we don’t, my buddy Steve’s on speed dial.”

He smirked as he walked away, leaving Neil both dumbstruck and terror stricken. Eddie didn’t even stop when he recalled a small inaccuracy Neil had mentioned, calling over his shoulder, “And we have two kids!”

What a jerk.

“Tell me about your day?” Eddie asked as he slid open the backseat door and leaned forward so Penny could climb into her booster seat. “Oh, boy, daddy! It was long! First, teacher said we were gonna draw with crayons but she change-ed her mind and we got to paint with our fingers instead!” She displayed her clean, paint free fingers for him as Eddie buckled her in, “Oh, yeah? Did you paint me a picture?” “Yeah, ‘s in my pack pack. But we only gotted to paint for a little while ‘cause Stanley tried to eat it.” “Not again, Stanley.” “I know!” Penny filled him in the rest of the drive home, while he got her out of her seat, the entire walk into the apartment building, only stopping when he opened the door for her and she caught sight of you. “MOMMY!” She let go of Eddie’s hand to run into your waiting arms. “Hi, baby! Did you have a good day at school?” You asked after you’d gotten in a good cuddle squeeze. “Uh huh! I painted with my fingers!” Penny ran back to Eddie and dug around in the backpack now dangling at his side until she retrieved a very poorly folded piece of thick paper. “I gotta show Waynie, first!” She bypassed you and ran straight for her baby brother, who was clutching the seat cushion of the couch and bobbing up and down. He’d be walking any day now. Eddie set Penny’s yellow backpack down on the counter as he closed the distance between you, arms wrapping around your middle to pull you flush up against him. “I don’t know how you do it, they make you wait forever.” He groaned, pressing his forehead to yours as you laughed. “It’s not that bad!”

“Yeah, well, regardless, you should be having a much easier time picking her up.”

It was easy for you to read between the lines and pick up his real meaning. Your eyes widened in surprise for a moment before they softened, and you leaned further into him, hands resting on Eddie’s shoulders. “Thank you.” You’d been afraid to mention the invasive and unwelcome attention you’d gained from one of the dads. Ashamed. He’d been vulgar, blatant and creepy. Even on the days he wouldn't approach you, you could still feel his eyes on you, on your body. It made you feel gross and cheap, even though you hadn’t done anything wrong. You’d politely tried to get away from him when you’d find yourself in that situation, but where you went, he followed. Soon, you’d begun waiting in your parked car until Neil left, and when that wasn’t good enough, you’d either go home and wait until just before they closed–which you hated because you didn’t like to keep Penny waiting there when she could be at home–or wait in the parking lot at work until you’d make it when all the other kids were mostly gone. It was draining, and made you dread the end of the work day.

“You never have to thank me,” Eddie leaned down just as you leaned up to kiss him, mouths mingling a little more on the wet side since you knew neither of your kids’ attention was on you. When you finally broke away, Eddie licked his lips and sighed. “Seriously, though. I don’t know how you do it. Men are gross and creepy, I wanted to deck him before he even really said anything. And what he did say–ugh. Let me know if you see his head turn in your direction, honey, ‘cause I made a promise I’m eager to not break.” You hummed appreciatively as you leaned up for more kisses, “My hero.”

3K notes · View notes

genshinluvr · 9 months

Text

Final Moments

Pairings: Various Honkai Star Rail Men x Isekai'd!Reader

Summary: You're somewhere alone, bleeding, and on the verge of death. Everyone is scrambling to reach out to you, but you're not picking up your phone, and no one knows where you are. Not even Nanook knows your whereabouts. You didn't think you could die in a universe you didn't belong to, but you were wrong. At least you were able to hear their voices in your final moments, right?

Note: I haven't written angst in so long. This is probably not the best angst I've written. This is an answer to an ask I received not long ago. I'm not sure how I feel about this mini-fic, but I think something sad happening for once is somewhat good for a fanfic one-shot series. To be really honest, it doesn't feel like angst to me. Idk if it's because I wrote it or if it's because it's not sad enough. Who knows. I don't post anywhere else but on Tumblr (Genshinluvr) and on AO3 (Aaliah_exo).

Warnings: Major character death, blood, probably my worst angst

Word Count: 3.9k

Your connection with Nanook has been severed. Whenever you sleep, you and Nanook communicate while you’re asleep. When you’re unconscious due to being knocked out by a flying prosthetic arm, Nanook is there— while you’re physically unconscious. You and Nanook have always been connected through body and mind since your arrival to their— Nanook, your Astral Express, Stellaron Hunter, Xianzhou Luofu, and Jarilo-VI companions— universe. However, this is the first time you realize you and Nanook are no longer connected to each other.

In the state of unconsciousness, you’re in the void. Only this void is different from the one where Nanook is covering the sun and sky. This abyss you’re in is pitch black, and you’re the only living being in the endless darkness. There’s no sky, no sun, no stars to light a path along the way in the void. At first, you’re uncertain whether you’re physically in this void or if you’re just unconscious.

That is until you hear ringing in your ears, and light starts flooding in. You gasp aloud as if you finally made it to the surface after being underwater for more than you can handle. Your lungs hurt, and so does your head. As a matter of fact, now that you have regained consciousness, your entire body aches, and you’re tired. So tired. Your eyelids threaten to shut, but you’re trying your best not to lose consciousness again.

Where are you?

What happened?

You push yourself upward and slump against the wall, choking out a gasp and breathing heavily. Your heart hurts— you didn’t think it was possible for you to feel your heart hurting to the point where you want to cry. Your vision is blurry, and you try to rub your eyes, but you can’t feel your arms. Exhaustion soon overtakes your body, and you fall unconscious.

Meanwhile, on the Astral Express, everyone is crowding around on the Parlor Car, their phones facing upward on the table. Everyone has been trying to call you, only for them to get a voicemail, or the call would fail to go through. The monotonous beep haunts their minds as everyone frantically tries to reach out to you.

“Are you sure the signal is good? Maybe we can’t call them because of the awful signal on the Astral Express,” Caelus comments, chewing on his nails.

March ignores Caelus’ comment. She presses her phone against her ears, listening to the ringing. If the signal was terrible, then how come the phone call was going through for her? The ringing stopped briefly, making March gasp, startling everyone on the Astral Express.

“Hi, this is [Y/N]! Sorry, I can’t come to the phone right now—”

March groans, ending the call. “Never mind. I thought they answered my call, but I was wrong,” March sighs in defeat, sliding her phone on the table.

The lights on the Astral Express flicker, and the door slams open. Nanook steps into the Parlor Car, his gold eyes scanning the Parlor Car, searching for your face. Nanook sighs and stays close to the entrance, running his hands through his hair. Just as Nanook feared: you’re not on the Astral Express either.

Welt furrows his eyebrows at the Aeon of Destruction. “Nanook. Your presence is sudden,” says Welt.

“Where is [Y/N]? Are they not on the Astral Express?” Nanook asks, crossing his arms over his chest.

“Unfortunately, they’re not on the Astral Express. We,” Jing Yuan gestures to him, Blade, Luocha, Luka, Sampo, and Gepard, “were contacted by the Astral Express in hopes that [Y/N] is on the Xianzhou Luofu or Jarilo-VI. To everyone’s disappointment, they are nowhere to be found.”

After hearing Jing Yuan’s explanation, Nanook starts to visibly panic. The Aeon of Destruction paces back and forth, taking deep breaths and muttering something under his breath. Everyone on the Astral Express gazes at Nanook worriedly. This is the first time they see him act this way. Nanook has always had this cool, calm, and collected exterior. Nothing can phase him, and only you can get a reaction out of him.

Sampo raises a finger. “Hold up. Why are you asking us where [Y/N] is? Aren’t you the one who can communicate with [Y/N] inside their dreams?” Sampo asks, crossing his arms over his chest and raising his eyebrows at the Aeon.

“Nanook, have you been able to contact them by any chance? We’ve been hitting countless dead ends, and we’re really worried about them,” Gepard says, looking at Nanook pleadingly.

Nanook sighs and stops pacing. He looks at the people on the Astral Express with a deep frown. While Sampo is correct about him being able to communicate with you through your dreams, the people on the Astral Express, Xianzhou Luofu, and Jarilo-VI aren’t the only ones whose struggling to get into contact with you.

Nanook wasn’t able to contact you through your dreams prior to your disappearance. When Nanook brought you into this universe, Nanook made sure to form this connection with you— this unbreakable bond between you and him. But despite creating this unbreakable bond, it somehow severed, and he can no longer contact you through your dreams and unconscious state.

This bond is supposed to be a way for him to track you anywhere in this universe. No matter how out of reach you are from him. Whether you’re in the Astral Express, on Jarilo-VI, the Xianzhou Luofu, the void, etc., Nanook should be able to feel your presence somewhere throughout the universe. Nanook mutters something, closing his eyes and pulling at the roots of his hair with frustration.

“What’s Nanook saying?” Himeko whispers, not taking her eyes off the anguish Aeon.

Luka whispers, “He’s muttering something about [Y/N] and the bond between them. I can’t hear what Nanook is saying, but those are the things I can pick out.”

Dan Heng stares at his phone intently, staring at your contact picture while listening to the monotonous ring. This is the fourth attempt. The fourth time he’s tried to call you, only for there to be a voicemail or just constant beeping that’s shaking him to his core. You can be anywhere in the universe, and finding your precise location without you telling them where you’re at will be the most challenging thing they deal with.

“Are they still not answering their phone, Dan Heng?” Luocha asks, approaching the black-haired man.

Dan Heng sighs, ending the call when he hears your voicemail through the speakers. “No,” Dan Heng mutters, shaking his head.

Blade stares at the panicking Nanook, frowning deeply. Blade sighs, rubbing his temples with shaky hands. As much as Blade wishes he was mishearing the things Nanook was muttering to himself, the more Blade thinks about it, the more it makes sense. Nanook is the one that brought you into this universe— he should know your exact location no matter what planet and fleet you’re on. Nanook should be able to communicate with you through your dreams or unconscious state, and because Nanook is visibly panicking and stressing out over your whereabouts, Blade concludes that—

“Your connection with [Y/N] has been severed, isn’t it?” Blade asks, breaking the tense silence in the Astral Express and bringing Nanook out of his thoughts.

Nanook clenches his jaws, nodding. “It has been severed, unfortunately. I do not know how it happened, and I’m sure [Y/N] isn’t the one that severed it. There’s no way for them to sever the connection,” Nanook replies.

Everyone stares at Nanook in horror. If Nanook is unable to contact you, then it’s very unlikely they’ll be able to find you sooner. You, [Y/N]. The same person not from their universe, the same precious star everyone holds dear to their hearts— whether as a best friend, little sibling, or a small crush that developed into something bigger— the same star that shines the brightest in the universe. You’re somewhere out there in the universe, exposed to dangers you’re not used to handling. Heck, everyone didn’t plan on letting you be exposed to any hazards that exist in this universe, but now?

“So, you’re saying there’s no way for any of us to contact [Y/N]?” Welt asks, raising his eyebrows at Nanook.

While Welt looks calm on the outside, the man is freaking out internally. How did this happen in the first place? You were supposed to be safe and sound under his watch, but you suddenly disappeared without a trace, and no one was able to reach out to you or track you down. Not even the Aeon of Destruction is able to track you down, and the Aeon has connections with you— well, had a connection with you.

“What are we going to do now, Mr. Yang? Searching for [Y/N] seems impossible at this point,” Caelus says, plopping down on the chair and running his hands through his hair.

Jing Yuan shakes his head. “I’ll have Yanqing lead the Cloud Knights to search throughout the Xianzhou Luofu,” Jing Yuan says, taking his phone from the table and sending rapid texts to his blond retainer.

Gepard nods. “And I will have the Silvermane Guards patrol the Overworld and the Underworld. If they see [Y/N], their duty is to detain [Y/N] until we arrive to get them,” says Gepard as he grabs his phone to message Dunn.

“Whoa, whoa, whoa! Detain [Y/N]? As in, keep them in cuffs and behind bars?!” Sampo exclaims, propping his hands on his hips, and looks at Gepard with disbelief.

Gepard, Welt, Nanook, and Dan Heng sigh simultaneously, rubbing their temples and pinching the bridge of their noses after hearing Sampo’s question. March snorts, rolling her eyes. The door to the Parlor Car opens. Pom-Pom waddles into the room, his eyes scanning the Parlor Car for a familiar face other than the ones that are present.

Pom-Pom sighs with disappointment. “I see that none of you have found [Y/N],” Pom-Pom says, crossing his arms over his chest.

Himeko gives Pom-Pom a sympathetic look. “Sorry, Pom-Pom, but we still haven’t found them. They’re not answering our texts or phone calls, and not even Nanook can contact them,” Himeko replies.

Pom-Pom sighs and waddles to the Phonograph, pressing his forehead against the machine. A dark stormy cloud looms over Pom-Pom’s head as he lets out a string of whimpers and sniffles. Everyone on the Astral Express nearly forgot about how close you and Pom-Pom are. The closeness between you two is adorable, and Pom-Pom treats you like his favorite passenger on the Astral Express. Well, you are his favorite passenger. There’s no denying it. Sometimes, when everyone is asleep, you would keep Pom-Pom company and spoil him with his favorite snacks.

Of course, that was before Nanook became a passenger on the Express. Now you would keep Pom-Pom company on the nights you can’t sleep or when Nanook isn’t on the Astral Express due to his duty as the Aeon of Destruction.

“Pom-Pom?” March asks softly.

Pom-Pom turns to face them, his eyes blurred with tears. “How could all of you fail to protect someone that protected me!?” Pom-Pom wails, tears cascading down his cheeks. “What if we never see them again? They could be in danger!”

Everyone looks away, their shoulders slumping. Pom-Pom’s right. They did fail to protect you— this is the second time they failed to protect you, and they wish they could turn back time and prevent it from happening.

“There’s nothing to worry about. We’ll find [Y/N] and bring [Y/N] back to the Astral Express, alright?” Luka says, kneeling in front of Pom-Pom and patting the conductor’s head.

Pom-Pom whimpers. “But what if they’re injured?” Pom-Pom whispers.

“Then I will do everything in my power to heal them,” Luocha answers.

You’re rudely awoken by the sharp pain in your lower abdomen. You gasp and sit up, letting out a strained gasp and whimper. You look down at your body, now realizing the state you’re in. You don’t remember what exactly happened, but the more you look at your surroundings, the more you start piecing things together. You were attacked by the Mara-struck. It happened so fast that you weren’t able to comprehend what happened before it was too late.

And now you’re here, on Cloudford, bleeding out, going in and out of consciousness, with no cell signal to call or text your traveling companions. You can’t even contact Nanook due to the severed connection between you and the Aeon of Destruction. No matter how many times you lose consciousness, Nanook isn’t there— even if you scream his name, bloody murder. You will always be in the void, alone and searching for the Aeon that brought you into his universe.

You sprawl out on the ground, digging your phone from your pockets. Your vision blurs every few minutes, making it hard for you to do your task. You turn your phone on, attempting to call the first person on your contact list. Blade.

You tried to call Blade, but the call didn’t go through. You tried calling every person on your contact list, but the call continues not to go through. You push yourself off the ground, nearly slipping on the pool of blood beneath you. It’s a miracle that you manage to hold on for so long. The question is: how much longer can you hold on? Black dots dotting your vision, you’re extremely tired, your eyelids are threatening to close, and your legs and arms are tingling.

“I can do this, I can do this,” you chanted, limping as far away as you can. “I’ll be okay. I’ll be okay.”

You’re not sure if giving yourself a false sense of hope is going to do any better. Still, it’s better to do that than lay in your puddle of blood, watching the time tick away and your life slipping from your fingers. With each step you take, you feel your strength slipping away. You’re exhausted, and everything hurts. The Mara-struck did not go easy on you until they assumed you were dead.

As much as you wanted to blame yourself for not being careful enough, there’s no one else to blame. Not even yourself. People will blame you for not being careful and watching your surroundings, but is it really your fault? The Mara-struck are ruthless, and they’ll attack anyone and anything that is alive and not Mara-struck like them.

You’re brought out of your thoughts and self-pity when your foot gets caught over the other, sending you to the ground with a loud thump. You let out a screech of pain and remain on the ground as every part of your body is stinging and throbbing with pain. The small cuts on your body reopen as fresh blood oozes from the wounds, spilling to the ground.

“Please, just end my misery,” you whisper, tears rolling down your bloodstained cheeks as you slowly drift in and out of consciousness.

The faint sound of buzzing coming from your phone wakes you up. You gingerly turn your head to see the screen of your phone lighting up and vibrating. You reach for your phone and roll over on your side to see Blade calling you. You swipe to the green button and hear a faint scream and frantic voices coming from the other end of the call.

“Blade?” You croak, wincing when you feel how dry your throat feels.

Blade sighs in relief on the other side of the call. “Thank the Aeons, you’re okay. Where are you? Are you safe?” Blade asks.

You chuckle bitterly, close your eyes and continue to lie on the ground. At least you’ll be able to hear their voices one last time, right? It’s better to listen to their voice before…. Someone calls your name, grabbing your attention.

“Huh? Sorry, I didn’t catch onto what you were saying,” you mumble, squeezing your eyes shut and fighting back a whimper that’s crawling up your throat.

“[Y/N], please tell us where you are. We’re very worried about you,” Dan Heng says.

You sniffle. The pain is beginning to feel unbearable. Everything hurts so much, and you want someone or something to end your pain and suffering already. You shouldn’t have played dead when the Mara-struck attacked you for who knows how long. You should’ve let them end you right then and there so you wouldn’t have to continue to suffer like how you are right now.

“[Y/N]? Are you still with us?” Caelus asks, his voice crackling through the speakers.

Fuck. Is the connection starting to act up?

“Yeah, yeah. I’m still here,” you reply, black dots dotting your vision. Is it normal to see a small burst of stars in your eyes each time you blink? “Sorry, I’m not feeling well right now.”

The other end of the call falls silent after hearing your response. As of now, Jing Yuan and Gepard haven’t received any reports from the Silvermane Guards and Cloud Knights about finding you.

The General of the Xianzhou Luofu and the Captain of the Silvermane Gaurds text their trusted companions regarding the search, only for Dunn and Yanqing to reply that they have yet to find out despite the number of Cloud Knights and Silvermane Guards scrambling to find you.

Mr. Yang walks over to Blade and takes the phone from his hands. “Sweetheart, can you look at your surroundings and tell us where you are? Even if you don’t know the precise location, do you know whether you’re on the Xianzhou Luofu or Jarilo-VI?” Mr. Yang asks.

“I’m on, uh, the Xianzhou Luofu. The Mara-struck…” you trail off, closing your eyes. Your hands are shaking— you don’t think you can hold your phone up any longer. Your arms feel awfully weak, and your phone feels heavy.

Jing Yuan’s voice crackles over the speakers. “What happened with the Mara-struck?”

Jing Yuan sounds frantic.

You shrug, completely forgetting that the others can’t see you. “They attacked me out of nowhere. They left me for dead, and there’s blood. So much blood,” you whisper, cracking your eyes open and looking at your surrounding.

“[Y/N], can you turn on the video call so we can see where you are?” Gepard asks, his voice crackling in the speakers.

You sigh, gritting your teeth as you turn on the video call. Your face appears on the screen— if you weren’t bleeding out and losing consciousness every few minutes, you would be gasping in horror at the sight of your reflection. Dear Aeons, you look horrendous. You blindly show your surroundings for the men to see where you’re at, but you don’t think you’re doing it correctly. Your arm soon grew tired, and your arms collapsed beside you.

“I’m really sleepy, guys,” you whisper, swallowing the lump in your throat. You nearly gagged when you tasted a mouthful of blood. You don’t know how much more you can hold on until they find you.

“Does anyone recognize that area? We’re not from the Xianzhou Luofu— nothing looks familiar for us,” Sampo mutters, gazing at the others worriedly.

Luocha steps forward and takes Blade’s phone from Mr. Yang’s grasp. “I know this is going to be complicated for you, but do not fall asleep, alright? Keep your eyes open and try to stop the bleeding. We’ll be right there soon,” Luocha instructs.

The men hear and see nothing coming from Blade’s phone. The camera is pointed to the sky of the Xianzhou Luofu— they see the color of your hair peeking in the corner. You rub your eyes and press your hands against the deep gash on your abdomen. You lift your head to see various cuts on your body. All are bleeding.

You whisper, “Which ones do I cover? There’s too many,” you mumble, gazing at the gashes with bleary eyes.

You let your head fall back on the ground, attempting to cover up as many as you can. How much longer are you going to hold on? You can hear a commotion coming through Blade’s phone as you lie on the ground, your phone lying beside your head. You didn’t think you could die in a universe you didn’t belong to.

“Stay on the phone with us, alright? We’ll be there soon, we promise,” you hear Blade say through the phone.

You can’t tell if Blade is panicking or not. He sounds so far away, no matter how close your phone is to your ears. How could this have happened anyway? It was all your fault, wasn’t it? Were you reckless like last time? No, no. Last time, the Astral Express was under attack. But this time, you left the Astral Express and ended up getting attacked by the Mara-struck. And now look at you, bleeding out on the Xianzhou Luofu while trying to stay conscious.

“You’re not mad at me, are you?” You whisper, staring at the clear blue sky above you.

Luka grunts. “We’re not mad at you, [Y/N]. We’re very worried about you,” Luka replies.

Luka is trying his best to remain calm, but his heart is racing against his chest to the point he fears it might burst.

You close your eyes, feeling nausea hitting you. “Is Nanook mad at me?” you ask weakly.

Dan Heng looks at Nanook from the corner of his eyes as they run through Cloudford, searching for you. It’s just them racing against the clock to get to where you are— racing against the clock to save you. But will they make it on time before you lose consciousness?

Dan Heng shakes his head. “I’m sure he’s not mad at you, [Y/N]. Why do you think that?”

You crack a smile. “I… Nanook and I aren’t connected with each other anymore. Did I do something wrong for him to sever that tie between us?” You whisper, tears blurring your vision. “If I did something to upset him, please let him know that I’m sorry for whatever it is that I have done to upset him.”

Nanook snatches the phone and gazes into the camera, his gold eyes searching for your face. “I’m not mad at you, little one. However, if you lose consciousness, I will be upset with you,” Nanook states.

You laugh weakly, tears rolling down the side of your face. “I’m sorry, everyone. I’m sorry for not being strong enough,” you whisper.

Just when you lose consciousness, you feel someone cradle you in their arms. Your vision slowly turns black as the voices around you fade away— almost sounding like you’re underwater, sinking deeper into the depths.

“No, no, no, no! Please don’t leave me,” Nanook whispers, pressing you against his chest.

Your head lolls back, laying limp in his arms as blood continues to pour out of your wounds. Luocha kneels before you and Nanook, frantically trying to heal the cuts and deep gashes on your body. Sampo, March, and Himeko look nauseous at the sight of the pool of blood below you and Nanook.

March looked away, closing her eyes as a stray tear made its way down her cheeks. “Please tell me [Y/N]’s going to be okay, please,” March pleads.

Nanook presses his index and middle finger against the side of your neck, frantically searching for a pulse. Nanook buries his face into your neck, his body wracking with sobs as he holds onto you tighter. You can’t be gone. Please, please, please, please. Luocha’s hands fall to his side, and he looks away.

“Well?” Dan Heng demands, his chest rising and falling with heavy breaths.

Luocha shakes his head, tears rolling down his flushed cheeks. Luocha grabs your cold hand and presses a kiss on your knuckles. Maybe in another lifetime, you will meet them again. But for now, stars don’t live on forever.

Note: Just because this is angst with death doesn't mean it impacts the overall HSR isekai series. This is a mini-fic, and to make it up to all of you, I will make a Nanook smut for this upcoming week! Yes, smut is finally here! Nanook got the majority of votes. Therefore Nanook is the first HSR male character to be getting smut! As I have stated in my Genshin Isekai fics, the fics in the series are like my multi-verse. Anything can happen in these fics, but it will not significantly impact the overall series. So, even if something traumatic happened to the reader in one fic, the next fic, it never happened to the reader. Some things will impact the story, but others won't be mentioned in other fics. For those who want to be on the taglist, here is the [Google Form]. For those who want to join the Discord server but weren't able to, here is the new temporary link to [Zhongli's Abode]! Please make sure to read the server rules— you can lurk, chat and hang out on the server if you'd like! If you don't vibe with the server, you can leave whenever you want ^^ To my new and/or returning readers, please keep in mind that I ONLY post on my Tumblr (Genshinluvr) and my AO3 (Aaliah_exo)! Nowhere else except Tumblr and AO3!

Taglist for the HSR one-shot series: @mompt2, @elegantnightblaze, @lunavixia, @jadedist, @reversearrowhead, @pinksaiyans, @aurelia-xyt, @lilliansstuff, @ssunset0, @starrry-angel, @kaoyamamegami, @kodzuvk, @for3very0urs, @a-cosmicdawn, @g3n0dtt, @theblades, @raaawwwr, @immahuman, @irisxiel, @siaracarroll, @crazydreamcat, @sagekun, @orichalcumthief, @dyingsweetmackerel, @rosiesareblue, @ichikanu, @hispasian-otaku, @asoulsreverie (Accounts that I was unable to tag are not tagged in this fic. Those who do not want to be tagged in a specific fic are not tagged. Remember to check your settings to see if you're allowing people to mention you/tag you in posts or not)

Read more of my works on my Masterlist / Masterlist 2 | Maybe support me by tipping me on Ko-Fi or by reblogging my fanfics! ^^ I will also be posting exclusive fanfics on Ko-Fi as well very soon! I might post all of my stories on there too, but who knows. You can also tip me on Tumblr if you'd like as a way to show support! ^^

#Honkai Star Rail x reader #Honkai Star Rail imagine #Honkai Star rail fanfiction #Honkai Star Rail fanfic #HSR x reader #HSR imagine #HSR fanfiction #HSR fanfic #Dan Heng x reader #Gepard Landau x reader #Sampo Koski x reader #Welt Yang x reader #Blade x reader #Jing Yuan x reader #Luocha x reader #Caelus x reader #Nanook x reader #Luka x reader #genshinluvr

971 notes · View notes

lilliumrorum · 3 months

Text

What does he have that I don't? (Part Two)

<<Previous | Masterlist | Next>>

Synopsis: After getting comfortable in your captain's dwelling, you experience a dream involving him, intensifying your desire for the man.

WC: 3k

Content/Warnings: 18+, MDNI, Soft Price, fluff, Cheating, kind of pining?, Wet dreams, Masturbation.

Notes: Sorry this took so long to post, I've had lots of fucking issues with tumblr and I am proper pissed off. Exams have been kicking my ass too, but I'll make sure to write an extra long chapter next time!

In this situation, unlike others, you wouldn't yearn for Simon's touch. The absence of affection from him for months has built a resistance to missing that once addictive sensation. Tears welled up once more as you reflected on the abuse endured just to cling to the shattered fragments of your 'relationship'. Desiring a different reality, you found yourself in a challenging situation, torn between lingering feelings for your lost love and developing admiration for your captain.

Concluding the scorching shower, the realization struck that a towel was forgotten. Cheeks burning with embarrassment, you pondered how such a simple thing could be overlooked. An uneasy hope lingered that the captain remained undisturbed in his slumber, as a preemptive guilt surfaced. The idea of waking him up intensified that internal conflict, leaving you in a contemplative state after the steam had dissipated. Standing there, damp and hesitant, you grappled with the consequences of a neglected towel and the possibility of disrupting your captain's peace.

Your hand unlocked the door, cracking it open just a bit.

"John?"

"Mm?" His deep voice echoed from the couch.

You felt a sense of relief upon realizing he wasn't in bed yet.

"I… may have forgotten to grab a towel," you admitted with a nervous tone.

You heard his soft footsteps moving down the hall and passing by the bathroom. As soon they approached the room you made sure to narrow the crack of the open door, ensuring you wouldn't accidentally flash him. A sturdy silhouette stood behind it, holding a towel. Cautiously peeking around, you gently retrieve it from his grasp.

He stared at you for a moment, gazing at your damp hair and shoulders before seemingly snapping out of it.

"Don't make my floor too wet, Sergeant." He said with a breath before trekking back to the couch.

You slowly closed the door, releasing a heavy breath you didn't realize you were holding. It felt as if butterflies had been swirling around in your stomach, cheeks burning like fire as you tried to comprehend what had just happened. The butterflies were nothing novel; in fact, they were a constant presence. Every time you worked near him your heart fluttered.

The salt-and-pepper mustache that quirked up when he smiled made your heart do flips. His hands, aged yet firm, with thick fingers calloused from years of service made you fantasize about what they would feel like inside you. The quick waves you received when he walked past you, his combat pants fitting him just right made for an easy distraction. Doing paperwork with him late at night presented itself a challenge. Your brain was constantly fuzzy whenever you looked at him.

At this point, you couldn't distinguish whether it was him making you shudder or your own nakedness. The stark contrast in temperature from your shower to the chilling air heightened your eagerness to get dressed. The towel rubbing against your skin brought a soothing sensation to your mind, interrupting your thoughts about him.

"You did so good f'me, lovie. Such a good fucking girl." He praised, slowly pulling out of your fluttering cunt.

You whimpered at the feeling of being empty after being stuffed full for so long.

"I love you, Simon." you whispered breathlessly.

He gazed at you, searching your eyes for some sort of hidden plan, or trickery. He found nothing but adoration.

"I love you too." He whispered as he got up, searching for the towel he had placed somewhere, you reached out and gently wrapped your hand around as much of his toned arm as you could before he moved too far.

He glanced at you, his expression filled with curiosity.

"Si, can you promise me something?"

"What is it doll?"

"Don't leave me."

"What kinda promise is that? I'm never gonna leave you. Hell, I'm stuck on you."

You smiled at his words.

But he broke that promise. He left you, a ghost in his place.

"Captain, is it alright if I get dressed in the bedroom?" You uttered your words with a delicate tone as you stepped out into the hall.

His head shifted in the direction of your voice, his attention lingering on your legs briefly before his gaze ascended to meet your face. He stared at you for what seemed like an eternity. Your posture started to shift as nervousness crept in, especially with his eyes on your barely covered body. He seemed to take notice, offering a smile before he spoke.

"Of course dove, that's where you're sleeping anyway." He spoke with a tone that held weariness.

"Oh no you don't ha-" as soon as you spoke you were interrupted.

"I said that's where you're sleepin' and that's that. Don't argue with me, sergeant." He commanded.

You raised your hands in the air, signaling surrender, before letting out a laugh and walking back to his bedroom.

The scent of everything was reminiscent of him, when you opened his closet, the aroma of cinnamon and pine struck you instantly. You breathed in his scent and felt a bit more at ease. Why did everything about him have to evoke such a strong sense of comfort and familiarity?

If you didn't move past this childlike crush soon, you'd end up with more issues than you're already grappling with. He could be your father for Christ's sake!

You shook your head, as if the thought would dissipate, while grabbing some pajama shorts and a tank top. The clothes were rather revealing, but John would surely understand if he saw them. Your intention was to return home to Simon, not to him. When you left, there was no time to retrieve your clothes, as you aimed to escape the situation as smoothly as possible.

Your body ached for sleep, going without it for what seemed like ages.

Turning the light off and slipping into bed, a subtle shift occurred in your thoughts, and the image of John began to weave its way into your consciousness like a gentle melody. In the calm moments preceding sleep, his laughter echoed, and the warmth of his gaze painted the canvas of your contemplations. The memory of John intertwined seamlessly with the comforting embrace of his sheets, creating a space where the lines between reality and the fanciful dance of imagination became hazy. With each closing of your eyes, dreams unfolded, casting John as the silent protagonist in the tales that quietly unfolded in the realm of your weary mind.

In the silent corners of your thoughts, dreams took shape, painting a picture where you were romantically involved with John. Scenes of stolen glances and hidden meetings unfolded, with the forbidden nature of it all adding an exhilarating edge to the fantasy. In these vivid dreams, shared moments created a connection that surpassed the ordinary reality surrounding you. However, these fantasies were kept as a personal refuge—a brief escape within the private chambers of your mind, where the blurred lines of possibility flirted with the edges of longing.

"Tell me what you want, dove. What do you need from me?" he breathed in a solaced whisper.

His rugged hands worked at your body, roaming across your naked form as you tried your hardest to utter a word, mumbling nonsense. He hadn't taken your panties off yet, the cloth becoming more and more wet by the second.

"Words, sweetheart. I need to know what you want from me." His fingers teasing your clit in soft, circular motions.

"John- Oh shit! I need them inside! Please!" You practically sobbed.

Everything in this moment completed you. His waist was stationed between your legs as he continued his ministrations on your cunt. At this point you were a whining mess for him. You were too distracted with your pleasure to realize he had pulled your panties to the side, thick fingers lined up with your sopping hole.

"God, you're perfect."

The captain's eyes snapped open upon hearing sounds emanating from the bedroom. Initially thinking it might be crying, he knocked on the door once.

With no response, he opened the door to investigate, finding you helplessly whimpering and pressing your thighs together in your sleep.

He was well Aware that intruding was not right, but he lingered a little longer, drawn by the sweet serenade of your voice. Going back to bed at this moment seemed impossible for him. His cock straining against his pants as discomfort grew, urging him to address it promptly.

He treaded back to the couch, every step carrying an enduring strain to his crotch. Fuck, those noises were driving him wild.

He knows it's not right, yet he pulled out his erection anyway. He needed relief, blood rushing to the tip as it sprung out of his pants. His arousal was yearning for a momentary reprieve.

He groaned as he started fisting his cock, guttural groans coming from his chest as he chased his release. His eyes fluttered closed, Imagining you spread out for him, begging for whatever he could give you. Your pretty body writhing underneath him while you worked in sync to reach that peak. Nails scratching at his back with each forceful thrust of his hips. He tried to stay as silent as he could, listening to the melody of your sounds. He tried to savor your sounds, prolonging his orgasm to the best of his ability. He couldn't hold it any longer, somewhat embarrassed at how fast he was going to finish.

The familiar feeling of his climax began to reach him, his lower abdomen flexing harshly with each stroke.

"Fuck"

His sticky cum flowed over him fingers as it spilled out from his twitching tip.

This was wrong, but god did it feel so fucking right.

Throughout the night, Simon couldn't shake the image of your shocked and saddened expression from his thoughts. All he longed for was to have you back with him at home. Who the fuck were you with anyway?

As the minutes stretched into hours, Simon's chest tightened with an unsettling jealousy. The anticipation of your return became a weighty burden, and the quiet emptiness of the house echoed his longing. He had watched you leave, hope clinging to the belief that you would soon walk back through the door. However, as the night wore on and you failed to return, that hope transformed into a bitter ache. Each passing moment fueled the jealousy that churned within him, a mix of fear and insecurity. The empty house seemed to mock his unspoken yearning, amplifying the silence that enveloped him in a suffocating embrace.

The air hung heavy with tension when Johnny left the house, the weight of your discovery lingering in the strained atmosphere. The revelation of the affair had cast a pall over the once-shared space, leaving behind a palpable sense of betrayal. The door closed with a hollow finality, echoing the rupture in trust that now defined the relationship. He laid there in your empty bed, the aftermath of your revelation settling like dust in the room, and the emptiness of the departing footsteps mirrored the void that now consumed the once-shared moments with Johnny. The silence that followed was deafening, amplifying your absence.

When you left he was still pent up with arousal, so him and Johnny went a couple rounds, but he soon had to leave to get enough rest before the sun rose. With both of you no longer present, he truly began to realize he was alone.

Jealousy gnawed at Simon as he grappled with the unsettling uncertainty of your whereabouts. Each passing moment fueled his imagination, and he found himself consumed by thoughts of who you might be staying with. The unanswered questions echoed in his mind, creating a symphony of doubt and insecurity. The image of someone else occupying the space meant for him sparked a surge of possessiveness, leaving him yearning for the reassurance that you were still his. The silent house became a canvas for his anxious thoughts, and the suspense of not knowing intensified the monster within him, clouding his emotions with a turbulent mix of suspicion and anger.

Just who the fuck did you think you were, leaving like that?

He felt his jaw clench, thinking of you with someone other than him.

Every thought of someone else near you ignited a primal instinct to claim and protect what he considered his own. The mere idea of sharing your presence with another set off a storm of dominance, intensifying his need to assert his presence in your life. It was as if an invisible tether bound him to you, and the thought of anyone encroaching upon that connection stirred a fierce determination to safeguard what he considered rightfully his.

Sleep eluded him, elusive as his thoughts were ensnared in a web of restlessness. The weight of emotions, a mix of envy, dominance, and yearning, kept him tossing and turning in the dim silence of his bedroom. The shadows on the walls seemed to dance to the rhythm of his unsettled mind, casting a surreal atmosphere that mirrored the turmoil within. The bed, usually a sanctuary, became a battleground for his inner struggles. The clock's ticking echoed like a constant reminder of the sleep he desperately sought but remained just out of reach. The night stretched on, a canvas painted with the shades of his unquiet thoughts, as he wrestled with the myriad emotions that held him captive in the wake of the events that unfolded.

Awakening to the robust aroma of tea wafting into your nose, you stretched out your well-rested limbs before swinging your legs over the side of the captain's bed. The lingering remnants of the dream from the night before clouded your thoughts, creating a palpable tension in the air. As you pondered how to navigate the interaction with him, uncertainty hung like a veil. The simple act of rising from the bed felt like stepping onto uncharted territory, and the fragrant tea served as a reminder of the shared space that had witnessed the intimate contours of your dreams. The challenge ahead lay in reconciling the vivid images of the night with the reality of the morning, as you grappled with the aftermath of the subconscious journey that now lingered between you and the captain.

You approached the bedroom door, turning the handle and stepping into the hallway that led to the kitchen. The journey down the corridor felt like a deliberate exploration, each step carrying a subtle anticipation. As you entered the kitchen, a captivating sight awaited you – the captain, turned away, engrossed in some task involving the kettle. The play of muscles beneath his skin was a spectacle, every inch defined and visible, yet soft. His silhouette painted a picture of strength and concentration, a moment frozen in time that captured the essence of his physicality. The air in the kitchen seemed charged with an energy that transcended the simple act of making tea, as you silently observed, feeling both a sense of intimacy and a respectful distance in the presence of this private moment.

"Good morning, Sergeant. thought I'd get some tea ready for ya."

You listened intently, and there was a warmth in the captain's voice as he completed the tea-making ritual. Even though you couldn't see his face, the audible smile in his words painted a vivid picture. The sound carried a gentle resonance, echoing the pleasure he took in the simple act of preparing tea. It was a melody of contentment, and the timbre of his voice conveyed a subtle joy that surpassed the mundane task. As you stood there, the audible smile became a shared moment in the quiet kitchen, a connection forged through the familiar sounds of morning rituals and the understanding that lingered between you and the captain.

"Thank you, Captain. For all of this. I owe you one."

The dual impact of your words and the vivid recollection combined to color his complexion with a subtle embarrassment. It was as if the mere mention of his title held a key to unlock a realm of thoughts he hadn't anticipated sharing. The involuntary flush revealed a vulnerability, a momentary glimpse into a private mental landscape stirred by arousal that lingered beyond the confines of last night. In that fleeting blush, a complex interplay of emotions unfolded, creating a connection between now and what he had done last night that had left its mark on the captain's waking thoughts.

"You owe me nothin', dove. Hush up and drink your tea." He uttered, handing you a partially hot cup of the chamomile beverage.

"Anything planned for today?" You asked while softly blowing on your tea.

"PT, but It's going to be different today, so don't you worry about lieutenant."

His words had the exact opposite effect on you. You were most definitely worrying about Simon.

Taglist: @ttsbaby01 @waves-against-a-cliff @konigslittleliebling @imjustheretofightforlove @beebeechaos @mikimumiki @splaterparty0-0

#cod mw2 #john soap mactavish #soap x reader #simon ghost riley #soapghost #ghost angst #ghost x reader #john price #john price x reader #john price smut #ghost smut #ghoap x reader #john price fluff

453 notes · View notes

oneecheri · 2 months

Text

Late night confessions with Mattheo Riddle

Genre: Fluff, mild language. ( with a smoking problem )

Ship: Mattheo x Reader, no usage of name.

Word count: 884 words.

Song: Shameless

Notes: Please do provide me with feedback, how can I improve my writing and/or if you like the story or not. I originally wanted to post my writings on TikTok but at the end decided to open a tumblr page so I’m new. Pls give me some love babes. Also, the pictures are from Pinterest but the writing is mine. Enjoy!

“I am sorry Y/N.” Mattheo breathed out a puff of smoke as his gaze was fixed on the stars. You were a little far from him, both leaning against the cold walls of the astronomy tower.

“I had no right to ruin your studies with that guy.” He then turned to you and met your cold gaze meant for him.

“Please don’t look at me like that… say something… your silence is killing me.” His searching gaze wandered between your eyes, nose and lips. He lowered his head, taking another deep puff from his smoke.

“Yes, you had no right to do that Riddle…you humiliated me….” you let out and got closer to him, your voice cold as ice sending him uncomfortable shivers.

“Under which title…for which reason?”

He let out a chuckle turning his body towards yours. “As a friend?”

You shook your head and put your manicured fingers on your hips, urging him to continue.

“Acquaintances?”

Your heart beat rapidly increased due to his warm brown orbs never leaving yours.

So you were glad that it was the night time.

He couldn’t see the blush creeping up your cheeks.

“Fuck… House mates?” He tried harshly itching his neck.

“But I, hell sure, am not regretting that.” He spat out while searching for some sort of feeling in your eyes. His gaze accidentally dropping to your pursed shiny lips.

“You got detention because of that…plus he had a girlfriend, so your jealousy was good for nothing, dear.” You smirked trying to get on his nerves.

He tsked and threw his finished cigarette down, crushing it with the tip of his shoe.

“I am - I was not…” He looked at you and felt his chest tighten from all the love within.

“Okay you win baby, I was jealous as hell.” He admitted tipping closer to where you were leaning towards the wall.

“I had no title and no right to punch that guy too, I know.” He continued getting closer to you his right hand fisted and a few veins popping on his neck.

“But he was too close, too close.” He stood tall over you, making you look up through your lashes.

“I am sorry that I made you mad, dear.” He gently touched your chin, slowly moving your head higher, and your bodies closer.

“Mattheo…” you whispered, closing your eyes.

Hearing your alluring whisper, he seemed to get out of the trance he had in your captivating eyes.

He whispered some curses, hardly pulling himself away from you. His fisted hand seemed to open by itself, trying to get himself a new cigarette from his jacket in a rush.

You gently stepped closer to where he had moved, and held his hand.

“Mattheo…” he looked at your hand holding his and gulped lowering his head.

“Yeah?”

“Don’t… it’s going to be too many for a day. You’ve had a lot…cigarettes… today.”

The thought of you paying attention to him, let alone counting the amount of cigarettes he had, made his heart flutter, suddenly butterflies erupting.

“Why?” He whispered.

“It’s gonna be too much.” He held your hand suddenly his eyes going wide. Your hands were freezing. He gently took both your hands into his large palms, puffing out hot air, trying to warm them up. You couldn’t stop the smile that found its way on your face and mouthed him a ‘thank you.’ Your eyes not leaving each other for a few seconds.

“I…” he started, suddenly feeling short on air.

“I’m not the best dude out there.” He tilted his head up, staring at the stars, not meeting your gaze. “I like fighting, cigarettes. I like cuts and bruises that show my victory on others. I like fast cars and parties…” he breathed out, his eyes closing in a flood of mixed feelings.

“Yet you…” he opened his eyes, directing them at you. “You’re the most gentle, calm and loving person I have ever seen in my entire life.” You smiled which made him smile in return. You noticed his hands stop shaking and mentally noted to hold his hands whenever he seemed to go overdose with his smoking.

“You hate fighting and you’re afraid of blood. You always put plasters on my victory medals…”

“I guess you mean cuts and bruises all over your face!” You scoffed making him let out a dry chuckle. “I guess.”

“Look I am sorry for everything.”

“What?”

“I won’t ever do something like this and humiliate you…”

“Mattheo…”

“I will keep myself away from you…” he gulped and stepped away from you. His eyes getting blurry and body almost loosing balance.

“You are so stupid!” You yell, tears suddenly settling on your eyes.

“What…” he whispered, stopping and turning back to face you again.

“Yeah…” He let his eyes close as you stepped closer to him, your hands landing on his chest and hit him.

“You’re so dumb!” You yelled again, a single tear escaping your eyes.

“You can’t feel my love.”

“No.” He whispered and held your wrists, pressing soft kisses on each.

“Really…” He cupped your face and brought his forehead against yours.

“I love you, Y/N”

“I love you too Mattheo.” And with that, he wiped your tears making you feel back alive that midnight.

206 notes · View notes

raythekiller · 10 months

Note

nsfw headcanons for masky, toby and jeff please! :)

🗒 ❛ NSFW Headcanons ༉‧₊˚✧

Featuring: Jeff The Killer, Ticci Toby, Masky

#Notes: finally i can be horny on main

pronouns used: none, gn! reader

˗ˏˋ back to navigation ´ˎ˗

꒰⸝⸝₊⛓┊Jeff The Killer

I'm gonna be honest, this motherfucker is selfish. He'll be mostly searching for his own climax and will stop once he's satisfied, you having finished or not. However, if you call him out on it, it'll hurt his man ego™ and he'll suddenly become very invested in your pleasure. Might even overstimulate you, who knows.

That being said, let's go over some of his kinks. Degradation is a pretty big one, and he gets mean with it. Definitely into knife and bloodplay, just loves pressing up his knife against your throat as he pounds into you, even better if you're covered in blood (yours or someone else's, he doesn't care). He's absolutely dominant and has a thing for ownership, definitely tried talking you into allowing him to carve his name on your thigh. Also, marking. Just as a little reminder to others that you already belong to someone.

꒰⸝⸝₊⛓┊Ticci Toby

Now this guy is a gigantic sub. Loves being ordered around and told what to do. Completely opposite to Jeff, his main concern is your pleasure; he doesn't even cares if he gets to cum or not as long as you feel good. Please, for the love of god, praise him, that'll send him over the edge in seconds, it's embarrassing how quickly he comes after you call him a good boy or say that he's doing a good job fucking you.

Absolutely has a mommy/daddy kink. Also, he cums very fast in general, but makes up for it by how many times he can do it in a row. It's like never gets tired. Super into giving oral, just loves the feeling of you in his mouth and your hands grabbing his hair, guiding his head along your sex (if you're afab, please sit on his face).

꒰⸝⸝₊⛓┊Masky

If we're being for real here, Tim is a freak. Has so many kinks I can't even fit into a single tumblr post, so let's focus on the main ones. First of all, domination or slave/master dynamics. He wants you to surrender to him completely, doing anything he tells you to without questioning. Speaking of which, here's another one: humiliation. Will make you do things such as kiss his boot or crawl around on all fours, and if you resist he will not take it easy on the punishment.

Spanking is another big one. Normally with his belt or even a paddle, but he doesn't mind using his hands, either. Your ass glowing red after he's done is one of his favorite things to see. Also huge on degradation, though it's normally laced with some praise as well (the good old "Who's my pretty little slut?").

696 notes · View notes

chi-the-idiot · 4 months

Text

For a while now I've wanted to draw my interpretation of the voices, until I realized how EXCRUCIATINGLY DIFFICULT drawing anthropomorphic birds actually was (my most sincere respects go to the artists who were able to put foward their visions).

But then I thought "wait, they don't have physical bodies, they are voices inside the protagonist's head".

SO BOOM, THE VOICES ARE SHADOWY SHILOUETTES BABYYY (part 1, probably)

The Cold was the first design I made, so he doesn't really have much thought process behind him except "make him creepy".

That's why he has that very prim and handsome smile almost none of his other companions have. Come on, zoom in on it, I know you want to feel its warmth radiate through the screen.

What I also did was leave him wing-less. Full disclosure, this idea originally came from another user here on tumblr who posted their designs for the voices, but I tried to search for the post again and couldn't find it (if anyone remembers the username or the post I'm talking about, please send it to me so I may tag them accordingly, i will continue to look for it in my liked posts). Although I do not remember why they chose to leave him wing-less, this did spark the idea of all of the voices having their wings damaged or fractured in some shape or form, either due to their own nature or due to their separation. This is also why he has those scars in his back, chest and face.

The Paranoid was next, and I already had a much clearer idea of what I wanted to do. His wings are not damaged because of the separation, but rather his own anxious nature led him to pull out most of his feathers, and making him even more of a shivering mess.

His scars are my favourite ones, as again they don't only stem from the fracture. Rather, they come from his encounter with the nightmare. Remember that she seems to have some sort of electric power, so I decided to make his scars originate from her touch, and leave marks similar to those a lightning ray would make.

I have to say that The Hunted is my favourite tho. I made him more corvid instead of humanoid, to really pinpoint his more animalistic nature. His fracture is more similar to that of a mirror, and with that I wanted to make a connection with the Narrator as well, sort of hiding their relation to one another in the design. Im still not sure if that one was caused by the beast or the fracturing, but I really like him.

Finally, a scale, for you to witness how absolutely minimal the hunted is, because I love that about him. Birb boy.

Anygays, thats me for tonight, byebye

#slay the princess #stp #slay the princess voices #stp voices #voice of the paranoid #voice of the cold #voice of the hunted #character design

322 notes · View notes

enhafilthandfiction · 1 year

Note

i love ur fics so much 💗 can I request a fic were ur wearing a revealing outfit and he gets super turned on about and starts to take off ur clothes 🤧

In the Kitchen - Yang Jungwon

Hello Anons!! I decided to kinda add these three together because they would make a perfect fic omg 🤭 jealous, tipsy fwb Jungwon that gets jealous when other men look at your revealing outfit and makes out with you 😍 so I hope y'all don't mind :))

*Also, disclaimer* : Jungwon is now 20 in Korea, so he is an fully grown man adult. Please stop hating on me and my posts, all I'm doing is writing and fulfilling asks willingly. The 'block tumblr' feature exists and you can just block me or just stop babying Jungwon.

If your're not comfortable reading, don't press the 'keep reading" tab

Summary : Your tipsy fwb Jungwon gets jealous when you wear a revealing outfit and decides to teach you who you belong to.

Pairing : Fwb!Jungwon X Fem!Reader

Warnings : Mentions of parties and slight drinking, revealing outfit on reader, friends with benefits, Jungwon being slightly drunk and jealous which leads to him being slightly possessive (kinda), makeouts, grinding, marking, love bites, neck kissing, Jungwon touching reader (but no fingering mentioned).

Word Count : 1123 words

Masterlist

It was already Friday which meant that frat boy's party was today. You were invited of course, your friends dragging you along. You knew Jungwon, your fuck buddy, would be there and you weren't going to hold back tonight, putting on your most revealing outfit, just to tease him.

What you didn't expect though, guys swarming around you, grinding up against you and even groping you too. Their eyes wouldn't leave your barely covered body, a thin piece of clothing covering you up.

You didn't even see him until you went to the kitchen, partly to get away for those pervs and also to get yourself a drink. As you searched for something to drink, you didn't see him in the dim lights, eyeing your figure.

He was resting against one of the counters nonchalantly, waiting for you to notice him. Until you did. He was wearing a black button up shirt along with some dark pants to match. His hair was ruffled, his messy fringe falling over his pretty eyes like always. His eyes had some sort of glint in them. Perhaps they were a little more sharper than usual.

You snapped out of your thoughts when he spoke to you "You should've taken a picture, it would've lasted longer" he says in a tone filled with fake pity, pursing his lips in a thin line. It was his turn to eye you up and down now, having a lot to see since the cloth did nothing to cover you up.

"I like your outfit" he compliments with an annoyed tone "but I should be the only one seeing you in it" he leans closer to you, "isn't that right doll?" Whispering into your ear. You shudder at his sudden closeness, breathing out softly. "Jungwon, we just fuck around that's it" you tried to reply firmly, but your tone wasn't so sure either.

Ever since you and him became friends with benefits, you had placed rules, but the main one was to : never catch feelings for each other. You're just fuck buddies, you're only supposed to fuck around and that's it. "Don't ever think about dating" he had told you, but it was becoming impossible every time you met him, especially with the mixed signs he was sending you way.

He seemed protective of you in some way, like tonight. It's not the first time he had hated the way you flirted with other guys, but he haven't told you anything about it, just to be careful of guys you've just met. Even though what he meant was to not get involved with other guys.

He just wanted you for himself, which was very selfish of him, especially since he was the one to forbid dating at all costs. But today was different. You could see it by just looking into his eyes. Maybe it was the alcohol he had just drank? You didn't know, but he seemed way more confident than before;

His hands immediately found your waist, and as his lips met yours, there was no going back. He pushed you against the counter in a second, his body engulfing you, and his tongue prodding against your lips. You had already got used to this by now, his tongue always found a way to sneak into your mouth, desperately twirling his wet muscle with yours.

As his hands trailed higher to grope your breasts, his knee made it's way between your legs, bucking it up against your core, making you whine out his name. You desperately grinded against his knee, your clit itching for friction, as his hands played with your chest and his mouth massaged against yours.

He pulled his face away from yours and leant down, attaching his lips with your neck. "Jungwon, more" you breathed between kisses as his teeth nip your skin and his tongue runs over the love bite, almost like a sorry.

He sucks your neck until he's marked it, marking you as his. "You're mine Y/n, got it?" he states, his lips returning to your neck. His hands guide your hips harder on his knee, your arousal already wetting you panties.

"Jungwon, please, need more" you whine out of need, making him raise an eyebrow at you. "Such a needy girl, aren't you y/n-ssi?" He shames, twitching his knee for emphasis.

"Who do you belong to huh?" he asks you, stopping his movements and waiting for your answer. "Y-you Jungwon" you reply, wondering what's gotten into him. He did empty a few bottles of soju tonight but this is not the alcohol speaking.

The revealing outfit definitely worked something inside him, arousing him more than he would think. "How about we take this off, huh?" he smiles sweetly at you, showing you his bunny teeth.

"In some dude's kitchen?" You question unbelievably.

"It's fine baby, the door's closed, and besides, if someone walks in, its not like they haven't already seen enough with this little outfit doing little to cover you up" he explains, lingering his fingers on the thin fabric, waiting for your to allow give him the green light.

"Fine" As soon as the word leaves your lips, he's tugging down the clothing covering your lower body, leaving you in just your panties. You're still covered at the top, but that doesn't make you feel less naked.

His hands snake down to your crotch, his fingers rubbing you though the fabric. You moaned in relief when he added a little pressure to your clit, the fabric of your underwear adding to the friction.

His fingers move lower, feeling the wet spot seeping through you underwear. "Fuck, you're really wet for me" he breathes out, a smirk playing on his lips.

His warm hands sneak past the elastic band of your panties, that way he could rub your clit better. "How makes you this wet, huh?" He asks, rubbing quicker and harsher when you don't reply, making you whimper out.

"You! Jungwon, you!" you almost scream out, the pleasure being overwhelming. He smiles gladly and rubs your clit in tighter circles, bringing you to an orgasm in return.

"Ahh, Jungwon, c-cumming" you moan out, your hips twitching as you release around nothing. His finger proudly leave slide out of your underwear, his lips kissing your cheek as you calm down.

He leans down to grab your bottom half of the revealing outfit, dressing you back in it. "From now on, I'm the only one who can see you in slutty fits, yeah?" he confirms, connecting your lips in a chaste kiss.

Just as he's about to pull away, the door swings open, revealing your spent figure and his composed one. He looks at your flushed face "We were just getting out of here"

Hi thankyou for reading this post! I hope it didn't upset anyone and please keep in mind that Jungwon is now an adult. I have been receiving a lot of Jungwon requests lately, so more Jungwon fics on their way!

Thankyou for all the love and support y'all have been showing me, it is honestly over whelming and I appreciate it since it helps motivating me against haters and create new fics for y'all :))

If you enjoyed this post, you can help support my blog by tipping me here! Anything is highly appreciated!

1K notes · View notes

missrosegold · 3 months

Text

I've got a blood trail red in the blue

Synopsis: Vampire!AU You moved to the quiet, costal town to escape from your ex, only to find yourself entangled with a man with fiery blue eyes, and a grin that’s slightly too sharp.

He may or may not be an immortal gang leader to a bunch of other blood-sucking degenerates, but you’ll worry about that later.

Word count: 20k

Pairing: Dabi x Reader (fem!reader)

Warnings: Mentions of murder, Blood and gore, Smut, Mentioned past toxic relationships, Smoking, Smut and additional warnings listed below so Minors or Ageless blogs please DNI. This is rated 18+

Playlist: Take Me To The Sun - D4VD + The Summoning (the ending. if you know, you know) - Sleep Token

For @kimkaelyn Thank you for all of the encouragement you’ve shown me when I needed it most – this one’s for you. Also, thank you for making this beautiful banner for me!! It looks so good!!

Title is from The Summoning by Sleep Token

Inspired by The Lost boys

Happy Birthday Dabi - I'm so pleased I was able to finish this for his birthday. He deserves all good things.

**You can read it on A03 here if the formatting on Tumblr is throwing you off! I cross-post all my works to my A03 account!

Tagging: @vambirezz @dabisqueen @little-red-insomniac @sunaraii @touyasprettydoll @touyas-back-lover @cloudsz04 @faetheral @impulsivethoughtsat2am @whitemochabunnie

You sigh loudly as you move the last box of your things into your new bedroom.

Dusting off your hands, you stand up and look around the small room, giving it an approving once over, before heading out into the living room to continue putting the rest of your things away in your new apartment.

Opting to take a quick break, you crack open the sliding glass doors leading out onto your small patio and step outside into the evening air. Closing your eyes, you breathe in the balmy, salt laced air, as a cool breeze combs through your hair, sending pleasant chills down your spine. You stay like that for a moment, before the sound of seagulls cawing overhead draws your attention to the surrounding view.

The sight of the small costal town spread out before your balcony greets you, as you look outward. You’d just moved to the town of Ashikita a few days ago, leaving your life in the busy city of Tokyo behind you. You scowl even thinking about the place.

You’d loved your life in Tokyo. It was the person you shared your life with there you’d hated.

You purse your lips as your thoughts trail back to your ex-boyfriend, despite your best efforts. He was the sole reason you’d moved all the way out to this small town in the first place. Your relationship had been on a downwards spiral for a while, and had gradually become unhealthier the longer you’d stayed with him. He had become progressively more controlling and manipulative whenever you’d tried to leave your shared apartment for anything else aside for work, and his behavior had only become worse by the day.

Eventually, things came to a boiling point when he decided to try and lock you in the bathroom when you’d told him that you were going out to see a friend, and that had been your breaking point. You had packed your things up when he’d left to go to work, and that had been that. You had taken up residence at your parent’s place for a few months while you’d searched for a new apartment and a new job, far away from your ex’s grasp, all the while dodging his incessant calling, before blocking him all together.

You had settled in Ashikita, a small costal town in Kyushu, known for its attractive beaches and coastlines. It was also quiet during the off season, deeming it the perfect place for someone who was trying to escape from the city.

Perfect for someone who didn’t wish to be found.

You allow your gaze to sweep through the sights spread out below your balcony. Your apartment was located near the coastline, and had a nice view of the nearby beach and wooden boardwalk that wrapped around it, much to your inner delight. The twinkling of lights from the few carnival rides you can see on the old wooden platform catches your attention, and you can’t help but smile to yourself as you recall old childhood memories of when your parents used to take you to the small country fair that used to come by your hometown in the summer.

You sigh as the multicolored lights gradually become brighter as the sun slowly sinks behind the watery horizon in the distance. Glancing back into your dark apartment, you decided to go down to check out the boardwalk after night falls – not wanting to spend more time in your lonely apartment then necessary.

You slowly slink back inside, and force yourself to continue to unpacking as the outside becomes darker. Once your apartment looks somewhat like your own space, you quickly change into something a little warmer to explore the boardwalk, before making your way out of your apartment.

The boardwalk, as you discover, is only a ten-minute walk away from your building, and you use the time to lightly explore the surrounding area as you make your way towards the beach. The distant crashing of the ocean waves against the shore makes your heart pound excitedly in your chest, and the sounds of the boardwalk rides echoes through the air around you, only adding to your growing excitement.

You make your way onto the old wooden boardwalk and look around at the rides and other various vendors set up on both sides of the platform. You slowly make your way around the brightly lit area with the crowds of other people taking in the sights and sounds like you, before a gentle musical chime accompanied by soft twinkling lights in the coroner of your eye catches your attention.

Turning to your left, you gasp in delight as you find yourself looking at a vintage merry go round. It’s old, older than you by probably several decades, but it’s no less charming than it would’ve been when it was brand new. You can’t remember the last time you’ve been on one, and before you can think about what you’re doing, you’re in the short line to buy a ticket.

The teen running the ride looks entirely uninterested as he takes your money before passing you a ticket and waving you on. You slowly make your way around the merry go round, taking in all of the old wooden animals – most of their paint old and dull – before settling on a sleek black horse wearing a blue saddle and bridle.

Not long after choosing your mount, the voice of the teen operating the ride crackles to life over the loud speaker and announces the ride was starting, before the squealing of gears and the hum of hidden electronics signals the start of the ride. You grip the pole as your horse slowly moves up and down, giggling in spite of yourself.

The world spins around you slowly and you lose yourself in the tinny sounds of music blaring out of the ancient speakers scattered around the ride. As you glance out at the boardwalk outside of the merry go round, something catches your attention.

No, not something, someone.

You catch a fleeting glimpse of a tall man dressed in various shades of dark blue and black, standing just outside of the fence blocking off the ride. You have to wait for the ride to do another full circle before you see him again, this time in clearer detail.

He’s standing still as a statue, allowing you to get a better look at him as you come around once again. He’s imposing looking, with his dark attire, save for a white shirt draped loosely around his gangly frame. He’s wearing a long dark blue duster and stitched pants, tucked into black combat boots – a strange choice of clothing considering the warm weather. He’s tall and lean, but you can tell he’s well-built underneath the loose clothes he wears; but his unique choice of clothing isn’t what draws your attention to him.

He is without a doubt, one of the most handsome men you’ve ever seen.

His spiky black hair is as dark as night, and his skin is pale and flawless, drawing attention to his high cheekbones but you notice a slight roundness to his cheeks, giving a gentle softness to his otherwise edgy features.

As you pass him once more, you lock eyes with the intriguing stranger and your breath hitches in your throat. His eyes are as blue as the surrounding ocean. You don’t think you’ve ever seen any one with eyes that particular shade of blue before.

As you slowly pass him again, he smirks at you, and you feel your heart flutter in your chest involuntarily.

The crackling sounds from the old loudspeakers snap you out of your trance as the teen from before announces the ride was over, and to leave at the nearest exit point. You slide off your horse and make your way to the exit, speed walking back to where you first saw the dark-haired man, only to find he’d seemingly vanished.

You look around the area, confused as to how he could’ve disappeared so fast, only to hear deep laughter echoing a little further down the boardwalk. You turn in the direction of the laughter, only to see the dark-haired man standing in the middle of a group of four other men.

They’re an interesting looking group if you’ve ever seen one: a silvery, white-haired man with vibrant red eyes is standing next to your handsome stranger, snickering at something he said, drawing your attention to the odd amount of scarring under his eyes and around his mouth. Beside him, a man with what you can only assume is box-dyed pink hair, dressed in a black hoodie is leaning slightly on him, listening intently to what he’s saying. On the other side of the ravenette; a taller, slightly older looking blonde-haired man with a long scar running down his forehead, is smoking a cigarette, and beside him, a well-dressed brunette who looked to be about the same age as his scarred companion, is fixing his tie, smiling and nodding with whatever was being discussed.

You smile to yourself as you take in the group. As much as you would’ve liked to talk to the dark-haired man, you didn’t want to interrupt his time with his friends. You turn around, ready to make your leave, only to feel a sudden weight draped around your shoulders. Startled, you whirl around only to find yourself staring up into the deep blue eyes of handsome stranger from before.

Now that he’s up close and personal, you find yourself unable to look away from the unique blue of his eyes. There’s something about them that has you completely entranced, and suddenly, the rest of your surroundings seem to fade away until it’s just you and him. You’re stuck in his orbit and he’s pulling you in simply by looking at you, pinning you in place where you stand. The stranger suddenly blinks, and just like that; he releases you from whatever hold he had you in, abruptly snapping you back to reality.

You don’t even have time to wonder how the hell he was able to catch up to you so fast, before you feel your throat dry up and close up involuntarily as he shoots you a dark smirk.

“’Sup sweetheart?”

His deep voice startles you. It’s smooth, with a slight rasp to it, sounding like he’d smoked recently. He’s warm as well – it’s almost shocking how hot he is, as you feel the heat from his body leaching into your side through the barrier your clothes provide.

You struggle to come up with a response to his greeting, and you can tell by the way his grin grows slightly, he enjoys the effect he has on you. He squeezes your shoulders again, almost teasingly.

“What’s the matter? Don’t tell me you’re getting all shy on me now? I saw you checking me out on the merry go round. Thought you wanted to say hello.”

“You saw that?” you ask before you can stop yourself, fighting to keep the flush you feel creeping up your neck under control, as the man throws his head back and laughs, allowing you to catch sight of clean white teeth that seemed slightly sharper than the average person’s.

“Yeah, I saw. Gotta say, I’m flattered. Haven’t seen a cute thing like you around here for a while. You new here?”

“I… Yeah.” You finally manage to sputter out, “I just moved here.” causing him to grin again.

“Yeah? Where are you from?”

“Tokyo. I got a new job down here. It’s a lot different than the city. Nice though.”

The dark-haired man nodded. “I bet. Why did you move here? This isn’t exactly a major city. I’m surprised you’d want to come here of all places.”

You freeze. Memories of your ex come flooding back, and you chew on your lip as you struggle to figure out what to tell the handsome man. You didn’t want to divulge your shitty dating history to a total stranger, when you yourself were trying to move on. Thankfully, the longer you remain silent, the more the grin seemed to slide off his lips, seemingly understanding what you were thinking, without you having to say a word.

“Someone there made you want to leave?”

You nod soundlessly, causing the man to kiss the back of his teeth.

“Well, that’s a shame. Dunno who the jackass is who made you feel the need to come to a remote shithole like this, but fuck ‘em.”

His brunt comment makes you snort in spite of yourself. You turn in his hold so you’re facing him more directly, offering him a half smile. “I don’t even know your name. What is it?”

The man grins salaciously at you as he stoops down to your level. “Dabi. And you, gorgeous?”

You know there’s not a chance in hell that’s his real name, but you decide not to press him on it. Maybe you’ll ask him about it later, if you ever run into him again.

You tell him your name, and he straightens back up, rolling your name off his tongue, causing you to flush gently under the intensity of his piercing blue gaze, He jerks his thumb back at the group of young men behind him. “The guys and I were just hanging around the boardwalk. Wanna walk with me pretty girl?”

You look over his shoulder to see the other four men staring you down intently. There something about the way they’re looking at you that makes you uneasy, but you can’t place what about it makes you uncomfortable. Instead, you smile up at him and shake your head.

“That’s okay, I don’t want to interrupt your time with your friends. I just wanted to explore a little bit. I’m still unpacking my apartment, so I should probably get back to doing that.”

“You wouldn’t be intruding.” Dabi sends you another grin, teeth glinting like knives in the carnival lights. “I’m sure you’d be better company then those jokers always.”

“I’m good.” You tell him, gently removing his arm from around your shoulders, watching as his smirk falls slightly at your gesture. “Maybe next time, if you’re around.”

“My boys and I live close to the area. I’m sure we’ll meet up at some point.” Dabi takes a step back from you, shoving his hands into his pockets, and sends you another smoldering grin that makes your heart speed up to dangerous levels.

“See you later sweetheart.”

“Bye.” You tell him with a timid wave, watching as he sends you a knowing wink, before turning on his heel and making his way back to his friends, who are already at his throat.

“What the hell was that, Dabi? Thought you were going to bring her back for sure.”

“Dude, I can’t believe you didn’t take her out. You always manage to pull—”

“Shut the hell up you psychos.”

Your roll your eyes as at their conversation as you shift your purse on your shoulder and walk in the opposite direction, away from the interesting group and back towards your apartment. The sound of the roaring ocean overtakes the sounds of the boardwalk as you make the trek back to your apartment alone.

You wake up the next morning to the sound of your phone alarm going off.

You get up with a groan, and slowly begin your morning routine. You shuffle around your apartment as you get ready to start your new office job. You pack your lunch with what meager items you have in your fridge, before heading downstairs to where your car is parked. Hopping in, you quickly plug the coordinates into your car’s nav system, and make the twenty-minute drive to your new office.

It’s small building, and your job is an entrée level position, but it pays decently well and is still more than enough to cover your living expenses – it’s part of the reason you took the job in the first place, since you’ll have to pay the entirety of your rent by yourself now.

Still, you’d much rather struggle by yourself then crawl back to your ex.

You day is uneventful, and you spend the majority of your day filling out new employee paperwork and getting to know the rest of your new colleagues. They’re nice and seemingly keep mostly to themselves, something you’re not used to after working in Tokyo for the last several years.

Still though, you can’t complain. Honestly, you think it might be good to keep your head down for a while as you get settled in. There’d be plenty of time to get to know the rest of your new coworkers later.

Your day passes quickly, and before you know it, you’re pulling into your parking space at your apartment building. Soon enough, you find yourself shutting the door to your apartment with a sigh as you kick your shoes off, before heading into your bedroom to change out of your work clothes and into something more comfortable.

As you make your way back out into your small living room, you’re hit with how bland your new apartment looks in comparison to your old one, and suddenly you don’t want to be in your tiny apartment. You glance out the living room window that’s pointed towards the beach and you know where you want to go.

Grabbing your keys, you find yourself making the short walk to the beach as the sun sinks lower in the sky, casting golden reflections on the water’s choppy service. You spend an hour on the beach, relaxing and breathing in the salty air, before getting up and making your way over to the boardwalk where several food vendors are setting up.

After paying for some cotton candy, you walk around the darkening boardwalk, nibbling mindlessly on your food as you explore several areas you hadn’t been able to look at the night before. As the numerous strings of fairy lights decorating the rides gradually get brighter as the sky grows darker, you decide you head back to your apartment before it get’s too late.

Before you can turn around to make your way back to your home, you feel a presence behind you and a sudden heat washes over you.

“Didn’t expect to see you back here so soon sweetheart.”

You whirl around at the familiar voice, only to see the dark-haired man from the night before standing behind you with a sharp grin. You note he’s wearing the same clothes from the night before, but he’s switched out his long duster for a shorter leather jacket with a ripped collar, adding to his intrigue.

“Oh hey! Dabi, right?” you ask him, prompting him to nod with a wicked smirk.

“Sounds nice, coming from you.”

You roll your eyes at his flirtatious comment, instead asking what you wanted to ask him last night. “That’s not your real name, is it?”

Dabi’s smirk only grows wider at your question, his bright blue eyes seemingly growing brighter. “No.”

“You ever going to tell me what it is?”

The dark-haired man clicks his tongue against his teeth. “Maybe later, if you stick around long enough.”

You shrug, not seeing any point in pushing it further. “Do you live around here?”

Dabi nods after a moment. “Yeah, I rent a place near here with a few guys. They’re tolerable.”

“Oh, your friends from last night?” you ask, thinking back to the group of men with him last night. You can’t help but grin as the man’s handsome face twists into a grimace at your comment.

“Wouldn’t go as far as to call them my friends, but we’ll go with that.” His dry response causes you to laugh.

“So, you’re more of a lone wolf, huh?”

Dabi snorts, the hint of a smile gracing his lips. “Absolutely. Up until those idiots wormed their way into my life years ago, I was fine with being on my own.”

You laugh at his comment before asking: “Have you lived here long?”

At your question, Dabi seems to pause. You watch as he chews on his bottom lip before carefully responding.

“I’ve been here a while, yeah.”

You nod, “Well, it seems nice here from what I’ve seen so far. It’s a lot different from Tokyo, but in a good way, I think.”

Dabi snorts, shoving his hands into his pockets as he looks away from you. “If you’re saying that, then you clearly don’t know what actually goes on around here.”

You frown at his cryptic reply, not sure how to feel about what he’s telling you. “What’s that supposed to mean?”

Dabi only gestures for you to follow him, and you do without much resistance. He ends up taking you further down the boardwalk to a spot you hadn’t yet been to, and stops in front of a large bulletin board plastered with several layers of white filers.

He taps the board. “Welcome to the missing person’s capitol of Japan.” He tells you flatly, allowing you to get a closer look at the papers rustling in the breeze.

You feel your heart sink into your stomach as you take in the layers upon layers of printed paper faces and their basic information printed out under them. From what you can see, some of the missing person fliers are months old, and others are as recent as a week ago. The missing people seem to be of every age and ethnicity, but the number of people plastered on the bulletin board is shocking.

You turn to Dabi, flabbergasted. “What the hell is this?”

Dabi shrugs nonchalantly. “An open secret.”

“I checked out the area before I moved here. All the websites I looked at painted this place as quiet and safe. I never saw anything like this.” You protested, causing the dark-haired man to nod.

“That’s because the authorities do whatever they can to cover it up. This has been going on for a long time. Years, honestly. These are the most recent ones.”

“The most recent?!”

“Like I said, years, babe. Didn’t you ever wonder why the rent around here was so cheap?”

“I—well, I mean, yeah, but—” You run a hand through your hair nervously. “I came here to escape from the chaos – not get involved in a different kind.”

Dabi pulls out a pack of cigarettes from his jacket pocket and puts one in his mouth, but doesn’t light it, instead opting to nudge your shoulder gently. “You’ll be fine during the day. No one’s going to steal you away sweetheart. It’s night time you have to be worried about. Just keep your head down and don’t go looking for trouble, you’ll be fine.”

You hum in response, but you must not look very convinced, because he sighs around his cigarette, taking it out of his mouth and flicking it into a nearby trashcan. “Tell you what; how about I walk you back to your building. Will that make you feel better?”

“I don’t want to inconvenience you—”

“You’re not.” Dabi interrupts you as he brushes past you gently, his abnormally warm fingers ghost the skin of your arm as he passes you. “Come on. I’ll take you back home. Can’t have someone snatching you away now, can we?”

He winks at you, laughing lightly as your face flushes against your will, yet you find yourself tailing after him, leading him back to your apartment. Normally you’d be very against allowing a near perfect stranger to know where you live, but the news of the missing people has shaken you more then you’d like to admit, and right now having some extra company doesn’t seem like a bad idea.

You walk slowly back to your apartment side by side with him, and in that time, you end up talking about anything and everything. Conversation seems to come naturally with him, and your guard slowly drops. The more you talk to him, the more he seems to loosen up in turn, though he keeps a polite distance when you try and find out more about him, instead, re-directing the conversation back to you.

“So, you never told me why you left Tokyo.” he drawls, heavily lidded eyes finding your own. “This isn’t exactly near there. I’m just trying to understand why you’d wanna leave your family behind to come here. You don’t strike me as the type who likes being alone for long periods of time.”

You stop short and mull over his question in your head. As much as you didn’t want to get into it, the raven-haired man was the closest thing you had to a friend here, and if you continued talking to him as you were, the question was bound to come up eventually. Instead, you exhale loudly through your nose before answering.

“Your original guess wasn’t far off.” You admit quietly, watching as his dark brows rise slightly at your subdued response.

You elaborate. “I left Tokyo to escape from my ex. The relationship had been bad for a while, and I should’ve left sooner then I did, but it was really hard. He was so possessive at the end, I felt like I was suffocating. It never got physical between us, but it probably would’ve if I stayed longer.”

You look up at your companion, only to see that his normally bright eyes are dark, and there’s a prominent tick in his jaw that hadn’t been there earlier. Dabi catches you staring at him, and sighs.

“Does he know where you are?” You shake your head.

“Not that I know of. I didn’t tell many people I was moving here aside from my parents. Most of my friends know I moved, but don’t know where to. I wanted to keep it quiet since he’s still trying to find ways to contact me. I don’t want him knowing where I am.”

Dabi hums in agreement as you approach your building. “So, you don’t have any friends out here, huh?”

You shake your head as you approach the main entrance. “I’m all by myself.”

You both stop a few feet from the door, and to your surprise (and relief), Dabi makes no move to invite himself in. You were worried he’d insist on walking you to your actual apartment, and as handsome as he was; you weren’t sure you wanted him knowing what apartment was yours… yet.

You’re just about to bid him goodnight before he suddenly speaks up, catching you off guard.

“What are you doing tomorrow night?”

“No plans as far as I know. Just working during the day. I should be free past six. Why?” You sputter, not expecting him to ask.

Dabi shrugs, sending you a relaxed grin, and once again you note how his teeth are oddly sharp. “It’s Friday night. If you’re not busy and you want to make some new friends, the guys I room with are having a night in. If you want to join, you can. Our place isn’t far from here.”

You’re slightly shocked at his offer. He doesn’t seem like the type who enjoys more people hanging around him then necessary, but then again, you’ve been wrong about people before, and now that he’s offered, he’s right: you don’t have any friends out here, and you are becoming lonely. Maybe meeting some new people wouldn’t be a terrible thing.

Before you can think about it any longer, you hear yourself agreeing. “Sure, that sounds great.”

Dabi smirks at you, broadcasting his pearly canines. “Excellent. I’ll let them know you’re coming. I’ll come pick you up back here when the sun drops. My place is about twenty minutes by car.”

You nod with a small smile. “That sounds good. Thanks again for walking me back Dabi.”

He only waves you off. “It’s nothing, I’ll see you tomorrow.”

“Yeah, bye.” You tell him as you open the door to your building, watching as he shoves his hands back into his jacket pockets and heads back in the direction of the boardwalk without another word. You watch him leave until he’s all but swallowed up by the surrounding darkness, before smiling to yourself and heading inside.

Dabi sinks his fangs into the man’s neck faster than he can scream for help. He holds him locked in a death embrace until the man’s frantic thrashing grows weaker, before completely stilling as his body grows limp in his hold.

It’s only when the man’s colour pallet has gone a deathly white does Dabi finally release his grip on the man, letting him collapse onto the sandy ground underneath the boardwalk. He wipes his bloodied mouth on the back of his sleeve with a grimace as he stares down at his victim.

Sour. Too sour for his liking. Clearly the man wasn’t in the best health before he got his hands on him, but beggers couldn’t be choosers, and he was hungry.

That’s the biggest downside to being what he is: the insatiable thirst for blood couldn’t be ignored for long. He would know. He’s tried to fight against his unsavory appetite in the past, but the end results are always the same, and he not about to starve just so a few lost souls could be spared. He’s no saint – in fact, he’s damn near the opposite of one.

Vampire.

The title is branded into him, even if only he can see it. He has to feed regularly in order to keep his more monstrous tendencies at bay, but he can go a few days without a meal. Any longer than that, and the real him becomes visible to all. The last thing he needs is anyone finding out what he really is.

Dabi feels his fangs slowly retract into his gums as he cooly observes his latest kill. It wasn’t anything personal, he didn’t even know the guy’s name. Just like the rest of his victims, he prefers not to know anything about them – it makes draining their blood harder later on. The body laying before him was just some random man he’d seen wandering the boardwalk by himself half drunk, making him an ideal target. It was all too easy to lure the man to a more secluded spot before jumping him, but he’s had years of practice perfecting his craft. He’s done it so many times he doesn’t feel much of anything anymore.

The missing person board can confirm that much.

Once he’s certain most of the evidence has been cleaned from his face, he snaps his fingers, and the corpse before him suddenly bursts into bright blue flames – consuming the unnamed man until there’s nothing left of him except for a pile of blackened ash, and the horrid smell of burnt meat.

Dabi sighs as he turns away from the remains and slowly trudges out from the wooden underbelly of the boardwalk above him, kicking at sand carelessly as his thoughts drift back to you.

You smell so good. Your blood practically sings to him. Walking you back to your apartment had been a challenge to him, as he had to fight every urge screaming at him to whisk you away and drain you dry, just like he’s planned to when he’d first laid eyes on you. But the more he talked to you, and the more you’d let him in on certain parts of your life, the less he wanted to do so.

You were… different. You stuck out from the other humans he’s forced to be around. You were sweet, if a bit withdrawn, but it added to your appeal. Your personality was refreshing, and it made him want to keep you around, and figure out just who you really are.

It helped that he found you to be rather… pretty, to say the least.

He wouldn’t bother trying to deny you were a good-looking girl. He’d seen the way you’d looked at him on the merry go round, and if that meant anything, then you found him to be just as attractive.

Well… at least you found his current face to be handsome. He’s not sure how you’d react to his real face, but he’d cross that bridge if and when he came to it.

He feels the corners of his lips upturn at the thought. Now the real test would be if you could handle him and his boys.

The next day is uneventful. You continue your training at the office, and slowly get to know some your co-workers past a first name basis. You finish up your work load at the end of the day and bid your co-workers good-bye, before making your way back home.

The sun is just starting to dip down in the sky by the time you get back into your apartment. You toss your keys onto your tiny kitchen table, taking a seat and scrolling through your phone mindlessly.

You respond to a few texts from your friends who know where you moved to, letting them know that you’re doing okay, and how you were going to meet with some of the locals later, before one of your friends texts out something that sends a chill down your spine.

Your ex had reached out to them asking them where you went.

Your friend assures you they didn’t tell him anything before you can ask, but you still feel a heavy weight building in your stomach. You end up putting your phone down after promising you’ll text them later, before getting up and moving into the living room, breathing heavily as you fight to control your nerves.

The sun has just sunk behind the horizon as you peer out your window, only to balk as you see a sleek black car parked beside yours in the parking lot, and a familiar man lounging on the hood, smoking a cigarette.

You swear to yourself as you grab your room key and bolt out of your apartment and down the staircase to the main floor. You make your way out into the parking lot, waving at the dark-haired man, who straightens up upon seeing you.

“Hey.” Dabi rasps, tossing down his cigarette and stomping it out.

“Hi.” You tell him with a slight smile. “I didn’t expect you to come by so soon.”

“I told you when the sun sinks.” The blue-eyed man retorts, but there’s no venom behind it. “You ready?”

“Let me get changed first.” You tell him, gesturing down to your work clothes. “You can come in and wait in my apartment if you want. I’d feel bad if I left you out here.”

Dabi looks hesitant at first, but he nods and follows you stiffly towards the entrance of your building. You wave him through, and he passes you with a slightly uncomfortable look on his face, before following you up the stairs to your front door. You open it and step in, expecting him to follow you, but he doesn’t. You shoot him a questioning look, and he cocks an eyebrow at you, giving you a tiny smirk.

“Gonna invite me in doll?”

“Oh, sorry, you can come in.” You laugh, and that seems to be the invitation he was waiting for, since he glides through your doorframe easily, shutting it behind him.

You can’t help by notice how glaringly out of place he seems in your minimalist apartment. He sticks out against the light colours like a sore thumb, and you have to bite back a giggle as you watch him take a seat on your small living room couch.

“Can I get you anything to drink?” you ask him as you make your way towards your room. Dabi only shakes his head as he leans back into your sofa.

“I’m good doll, thanks.”

“Okay, I’ll be out in just a second.” You tell him as you dip into your room, shutting your door behind you. You quickly throw on some casual but nice clothes and run a brush through your hair in an attempt to rid yourself of the tangles. You don’t know what kind of night you were in for with a bunch of men who looked to be in various stages of their twenties and early thirties, but you still wanted to look presentable. The last thing you wanted was to be accused that you were trying too hard, or turning Dabi’s invitation into something it wasn’t.

Once your satisfied with how you look, you make your way into your living room where Dabi is waiting for you. You don’t miss how he eyes you up and down as he stands up and makes his way over to you. “Ready?”

“All set.” You confirm, watching as his fiery blue eyes seem to light up as he grins at you. Twirling his car keys on his finger.

“I’ll drive.”

You follow him downstairs to his car, and surprisingly, he holds the door open for you. You slide into his passenger seat with a stammered thank you, allowing him to close the door behind you and get into the driver’s side, starting the car with a low roar. He puts the car in gear and pulls out of the apartment complex, before turning onto the road that leads back towards the beach, chatting you up all the while.

Your nerves about meeting the rest of his roommates slowly fade away as he assures you that his roommates where alright (even though he claimed they were still annoying), and while some of them were quieter than others, they meant well.

He steers the car past the boardwalk, causing you to raise an eyebrow at him. Dabi catches your look and chuckles. “I rent a house on the other side of town with a few guys. It’s more secluded.”

You nod as you watch the multi-coloured lights from the rides pass you by as Dabi continues on down the road. You learn very quickly he wasn’t kidding about his house being secluded, as he pulls off the main road and onto a dirt path leading into the trees that line the left side of the road. You can’t help but inwardly sweat at the change of scenery, but the passive look on Dabi’s face doesn’t change as he focuses on the road.

“You plan on murdering me or something?” You half joke, only for him to snicker.

“Naw doll, not tonight. You’re too pretty for that.”

He must see how flushed your face is reflected in the mirror, because he laughs openly at you and reaches over to squeeze your knee with a hot hand

“Kidding. Relax, we’re here. Probably should’ve told you I live in the middle of nowhere.” He chuckles as he pulls into an old driveway and puts the car in park. “Welcome to my house.”

You find yourself looking at a large traditional-styled home that looks like nothing’s been done to it since the turn of the past century. There’s moss and dead leaves littering the roof and front yard, and some of the white paint on the front of the house is cracked and pealing. If you had stumbled across the house on your own, you would’ve thought it was abandoned – if not for the two other cars parked on the other side of the driveway, signaling the house was inhabited.

Dabi must see your apprehensive look as he gets out to open your door again despite your protests. “I know, it looks like a bit of a dump.” He admits as he jerks a thumb towards the house. “That’s what happens when you have five guys who all work nights living under one roof. Rents cheap though. It’s why we’ve been here for so long.”

“You all work nights?” you ask as Dabi leads you towards the front door. He hums in agreement as he opens the door, exposing a dark inside interior.

The more you think about it, the more it makes since. You’ve never encountered him during the day, and every time you’ve run into him it was always near the boardwalk.

“What is it that you do?” you ask him as he flicks on a light near the door, illuminating an old mudroom and part of a dark hall. He shuts the door behind you as he kicks off his shoes, prompting you to do the same.

“I work near the docks.” He tells you vaguely as he gestures for you to follow him further into the house. “I do some operational work. Shipping and receiving. All that boring shit. It’s not very exciting.”

“What do the rest of your roommates do?” you ask him as he takes you towards a closed off room near the back of the house. You can hear different voices echoing behind the door as well as what sounds like a TV playing in the background. Dabi only shakes his head at you as he opens the door, exposing the room inside.

“You can ask them yourself.”

You step inside and are greeted to the sight of the four men from the boardwalk lounging around a large flatscreen TV. The man with the pink dye job and silver haired man with the odd scarring on his face are huddled around the screen playing a fighting game, while the two older looking gentlemen are sitting on the worn leather couch behind them, providing commentary. The blonde one with the scar running down the front of his face is smoking another cigarette, while the brunette dressed in well-tailored clothes is sitting on the other side of the couch, away from the smoke.

The pink haired man lets out huff of annoyance as his on-screen character dies. He turns around, only to freeze as he locks eyes with you.

“Oh shit.” He breathes, “She came.”

His comment causes the other men to turn around and stare at you, their facial relations ranging from a mixture of surprise to slight distrust. You don’t know why some of them are looking at you with slightly guarded expressions, but you don’t get to dwell on it for long, as Dabi comes in behind you and lightly drapes an arm across your shoulders.

“These are the guys.” He announces, nodding at each of them in turn. “The two idiots on the floor are Tomera and Iguchi. That’s Jin,” he nods to the blonde who breaks out into a grin, waving at you. “—and last but not least is Atsuhiro.” The aforementioned man stands up to greet you, giving you a polite handshake.

“I apologize for the mess.” He tells you, gesturing around the crowed room. “We seldom get guests. We weren’t sure if you were actually going to come.”

“That’s alright. I didn’t notice.” You tell him as Dabi steers you towards an empty couch to the side of the one Jin and Atsuhiro are sitting on. You notice he keeps his hand on your frame as you sit down with him, and he doesn’t remove it afterwards, almost as if he’s guarding you. It’s not uncomfortable, but you notice the same uneasy feeling you had when you first met him and his motley crew is back. There’s something about them that unnerves you, but for the life of you, you can’t place what it is.

They seem alright at first glance though. Tomura and Iguchi resume their game, but make a point to talk to you while they play, as Jin and Atsuhrio engage you in conversation, all the while Dabi observes you, not really adding anything to the conversations, and seems content just listening to you talk to his roommates.

You find out that Tomura and Iguchi are streamers – their online tags being Shigaraki and Spinner respectively – while Atsuhrio works as a street performer using the stage name Mr. Compress. Meanwhile Jin (who insists you call him Twice, for reasons he doesn’t get into), does deliveries around town during the evening, on top of working with Dabi at the docks when it’s slow, but has the night off tonight.

As you slowly start to relax, the conversations gradually become easier until you’re questioning why you felt so uneasy in the first place; that is, until Tomera makes an off-handed comment to you.

“M’surprised he brought you back here.” He jerks a thumb back at Dabi, not looking up from his game. “Most girls don’t last that long with him—”

“Tenko,” Dabi seethes out through gritted teeth beside you. “Shut. The fuck. Up.”

“Don’t call me by that name.” The red eyed man snaps suddenly, pausing the game to glare at the man beside you. “That name is dead, and you know I’m right.”

“Don’t be an ass.” Dabi snarls back as he pulls you towards him. “I told you to behave tonight while she’s over.”

“Fuck you, you’re not my father.”

“No, but I can torch your ass—”

“Alright, maybe we shouldn’t have this fight in front of her.” Iguchi suddenly speaks up, cutting them both off. “I don’t know about you guys, but I like her, and I want her to come back.”

“Thank you, Iguchi, I like you too.” You tell him sweetly, causing the tips of his ears to pinken, as he mumbles something intelligible under his breath and turns back towards the TV. Tomura rolls his eyes and resumes the game. Jin only chuckles as he turns towards you.

“I’m glad you’re here.” Jin tells you with a genuine smile. “Himiko’s going to love you.”

You shoot Dabi a questioning look, but he only rolls his eyes. “You’ll meet her shortly.”

“Her? But I thought only you guys lived here—”

Before you can get another word out, the distant slam of a door, accompanied by the sound of footsteps rushing towards the room interrupts you. As the light footsteps grow closer, you feel Dabi tense up beside you, as he leans over to whisper something to Atsuhiro that sounds suspiciously along the lines of, “I swear, if she’s just getting back in from one of her nightly rampages, we’re going to have a problem-“ Before a blonde girl who looked to be no older then eighteen, with two hair buns on either side of her head, bursts into the room with an almost manic grin on her face.

“Guys, you would not believe what I smelled coming back up here.” She cackles. “I think there’s a—” she cuts herself off as her abnormally golden eyes find yours. Before you can blink, she’s tossed herself over the couch that Jin and Atsuhrio are sitting on and plops herself down right in front of you.

“Hi! You’re really pretty! I’m Himiko Toga! Who are you?” she questions you with a smile that’s almost too wide for her face. You introduce yourself with a breathless laugh at her animated introduction, only to hear what sounds like a rumble coming from Dabi.

You turn to him only to see his insanely blue eyes are locked on the girl sitting in front of you and realize that he is, in fact growling at her.

“Back off Toga.” He warns her, but she ignores him.

“God I’m so happy another girl is here – I’m stuck here with these smelly boys every day and it get so boring! Do you know that you smell really, really good by the way—”

“Okay, enough.” Dabi hisses through gritted teeth. “Jesus, you don’t need to come onto her that fucking strong.”

Himiko gapes at him in mock shock. “Oh, come on. I could smell her all the way from outside the front door. You know she smells good. We all know!” She points around the room, but for some reason none of the other men meet her eye. In fact, they seem to be trying incredibly hard not to acknowledge what she’s saying.

Odd. You don’t remember putting on any perfume before you left.

“Thanks… I guess.” You tell her, unsure of what to say in response. Before the younger girl can respond, Dabi swiftly interrupts her.

“It’s not a bad thing. This psycho just doesn’t know how to give a compliment like a normal fucking person.” He shoots her a pointed look, but he’s not snarling at her anymore. Himiko seems to get the point, and sticks her tongue out at him, settling into the space between Jin and Atsuhrio, chatting excitedly with the older blonde, while occasionally sneaking glances at you.

The earlier tension fades away and you spend the next couple of hours with the odd group, chatting with each of them. Some of them have more to say then others such as Jin and Himiko, while Tomura and Iguchi are more on the quiet side, but still pleasant to talk to none the less. Dabi remains quiet for the most part next to you, never saying much, but you can tell he’s pleased with how you interact with his roommates.

Still, even as you grow more comfortable around them, there’s still a nagging feeling in the back of your mind that something is off about them. You have no proof to back up your unease though, so you try your best to ignore it, and focus on having a good time. After all, the seemingly mismatched group was the closest thing you had to actual friends here, and made you realize how badly you missed your group of friends back home.

You quickly end up losing track of time, and it’s only when Dabi checks his phone besides you, and muffles a curse under his breath, do you realize how late it is.

“Shit, it’s already five, I gotta take you home, sun will be up soon.” He mutters as he stands up, offering a hand to you, which you accept.

“Gotta keep up your sleep schedule?” you ask, hearing Tomura snort in the background at your comment. Dabi only nods as he heads towards the door.

“Something like that.”

You wave at the rest of the group. “It was really nice meeting you all.” You tell them sincerely. “Hopefully we can do this again sometime.”

“Come back anytime!” Himiko chirps, waving at you enthusiastically. “You better bring her back!” she crows at Dabi’s retreating from, and he waves at her without turning back around.

He leads you towards the front of the house where your shoes are, before walking out into the dewy morning air towards his car. Once again, he holds your door open for you, ignoring your protests, before getting in himself and starting the car, pulling out of the old driveway, and heading back down the dirt path towards the main road.

The sun is just starting to peak out from the horizon, painting the coastline in soft pinks and purples as Dabi steers the car past the old boardwalk, before you finally ask the question that had been on your mind for the last couple of hours.

“So, what’s the deal with Himiko?”

The dark-haired man only grunts. “You mean why is she so unhinged? Beats the hell outta me princess. “

“No, not that.” You wave him off, smacking his shoulder playfully at the nickname as he sends you a shit-eating grin in response. “I mean… you didn’t tell me about her initially, and I’ve never seen her with you before. Does she live with you too?”

Dabi mulls over your question for a moment, keeping a careful eye on the horizon which is slowly growing brighter, as he turns onto your street. After a moment he nods.

“Yeah, she does.” He confirms. “I know how it looks: one high school girl living with five guys in their twenties and thirties, but trust me, it’s not like that.” He’s quiet for a moment before elaborating.

“Toga has a shitty past. She ran away from her folks years ago – bad homelife from what she told us – and she had nowhere to go for a long time. I found her wandering the boardwalk one day and she never left after that. She took to Twice immediately, and she’s basically like his little sister. He’d do just about anything for her.” He exhales through his noes as he begrudgingly admits; “Hell, we all would.”

“Damn, how much did it hurt to admit that?” you tease him, prompting him groan.

“Shut up.” He grumbles as he pulls into your building’s parking lot. He parks the car and turns to you. “So, did we scare you off?”

“Not yet.” you tell him with a smile as you unbuckle your seat beat and open your door, posed to leave. “You guys are definitely interesting, I’ll give you that, but honestly; this was really nice. Thank you for inviting me over. I hope we can do it again sometime soon.”

Dabi shrugs his shoulders, “Well they seem to like you, especially Toga and Twice, so you’re welcome to come over again if you want. It’ll have to be during the evening though, since we all work at night.”

“Noted.” You tell him as you slide out of the car, only for him to suddenly grab your arm. You turn to stare at him quizzically, only for him to nod at your purse.

“Gimme me your phone for a second.”

You unlock it and pass it to him wordlessly, only to see him open a new contact in your phone and type something into it before passing it back to you. “My number.” He tells you before you can ask. “It’s easier to get a hold of me this way, rather than running into me at night at random.”

“Good call.” You agree, “I’ll text you later?”

“I’ll be waiting.” He sends you a knowing smirk. “I’ll see you later sweetheart.”

“Yeah… later.” You tell him, closing the door behind you. He waits until you’ve made it inside your building’s lobby, before peeling out of the parking lot and taking off towards his house like hell on wheels. You find it a little strange, but you loose track of your thoughts when you glance down at your phone, only to see he’s labeled himself as Dabi with a little flame emoji and a winky face next to his name in your contacts.

You feel yourself blush involuntarily as you stuff your phone back in your purse and climb the stairs to your apartment.

You definitely had a crush on him, you couldn’t deny it. Yet there was something off about him you just couldn’t place. There was something he wasn’t telling you – you just couldn’t figure out what it was.

The next several weeks come and go, and for the most part, they’re uneventful.

Work is going well, and you finally manage to find the time to finish personalizing your apartment so it looks more like home. Your friends still message you occasionally, giving you updates about what’s going on back home, and your ex pops up in conversation with them once or twice on how he’s still asking about you, much to your dismay. Aside from that, everything in your life is shockingly normal.

It feels almost odd being able to say it out loud. This is the most at ease you’ve felt since breaking up with your ex. Being on your own, away from him and his obsessive tendencies, makes you question why you didn’t do it sooner.

It feels nice, being able to breathe for the first time in almost two years since calling it off with him. Your life is calmer, maybe a bit slower than you’re used to, but it’s peaceful and stable. You’re happy.

The only major thing that’s changed recently is how you’re spending a lot more time around Dabi now.

Ever since he gave you his number, you’ve been texting back and forth frequently. You’ve gotten to know him better in that time (even though he still refused to tell you his real name), and you can safely say; he has his quirks.

For starters; he only messages you at night. He’s radio silent during the day, and only texts you back once the sun has set, or whenever he gets up. You’d blame it on him working nights, but he’s always quick to respond to your texts late at night, and always seems to be free whenever you message him asking if he wanted to get together, making you wonder what kind of work schedule he runs on.

Another thing you find peculiar is how you don’t think you’ve ever seen him eat before. You’ve offered to make him dinner a few times or to go into town to get something, but he always waves you off politely, telling you he’s already eaten, or giving you some other reason why he doesn’t want to get food with you. It’s not a deal-breaker by any means, and he doesn’t strike you as the type to have issues with food, but you leave it be just in case.

He's also weird about coming into your apartment even though he’s been in it multiple times by now. You’d initially thought he was uncomfortable being in your space, but it seems to be more of a politeness thing than anything else. He’s definitely not as stiff about entering like he was when he first came to visit, but he still makes a show about you inviting him in, even though he claims he could waltz right into your unit if he wanted to, but he never does.

Finally, you’ve noticed he isn’t particularly well-liked by the locals. In fact; none of the people in his house seem to be, but it’s especially bad with him.

It’s glaringly obvious. He’s taken you into town a handful of times so you can walk around together, only for people to glare pointedly at him and start whispering as soon as you were both out of ear-shot. If it bothers him, he doesn’t let it show, but you know from how his jaw tenses up, he’s aware that people are talking behind his back.

You tried to ask him about it once, but he shrugged you off, saying something about how there was some bad blood between him and some of the older locals, but refused to dive into it, stating how it was old news, but some people didn’t like to forget the past. His tone had given you the impression he wasn’t going to tell you any more than that, so you’d left it alone, not wanting to get into it.

There were somethings people didn’t feel comfortable sharing. You could relate; your rocky relationship with your ex was one of those topics for you.

To his credit, Dabi doesn’t pry into it, but it’s come up a few times – it’s inevitable, you knew it would eventually – but he doesn’t force you to say more then what you want to tell him. You don’t think you’d have to say much anyways; he seems to be able to piece together what happened in your past relationship on his own, without you having to say much of anything.

“Guy’s a dick.” He’d told you bluntly one night as you were taking an evening stroll around the boardwalk. “Seriously, he sounds like a tool. You should be glad you got out of there when you did. I wouldn’t waste your time crying over someone like him.”

“Easy to say that now – it wasn’t so easy when I was living with him.” You’d told him calmly. “We had joint banking. It’s hard to get out when you have to pay rent and buy groceries. I saved up enough to move out and get my place here eventually, but it took time.”

He’d fallen quiet at that, shifting his piercing blue orbs from your figure to the wooden boards beneath his feet, before nodding and muttering mostly to himself; “Yeah. I get that.”

For some reason, your heart had swelled in your chest upon seeing him vulnerable for a moment – a far cry from his usual fiery and cocky self.

In that moment you knew you were screwed; you were down bad for a man whose real name you still didn’t know. Somewhere along the lines, he had wormed his way into your heart without you noticing, and made a place from himself there.

Yet, you couldn’t say you minded. He was different from anyone you’d ever met, but in a way you found refreshing.

Currently, you find yourself walking with him on the boardwalk once again, admiring the blinking strings of fairy lights. Dabi doesn’t hold your hand, but he walks stride for stride with you, your shoulders bumping occasionally at the close proximity. Suddenly, a loud wail interrupts the usual fair noises permeating the warm evening air around you.

You both turn in the direction of the cry, only to see two middle-aged women standing in front of the massive missing person’s board. One of the ladies is sobbing unconsolably, while the other one is trying to console her.

Ah yes, you’d been so wrapped up with moving into your place and hanging out with Dabi on top of work, you’d almost completely forgotten about the town’s dark underbelly.

You can see Dabi’s lips pull downwards slightly as he takes them in, and he reaches out to try and steer you away from the scene, muttering under his breath about not wanting to get involved, but you gently pull your arm away from his grasp as you take a hesitant step towards the ladies who are slowly moving away from the old wooden board. You manage to overhear the last bit of their conversation as they leave, and older woman’s cry’s pull at your heart.

“—I don’t understand, where could he have gone? I saw him that morning, but he never came back home!”

“—We’ll find him dear. Maybe he’s visiting your friends on the other side of town.”

“—He would’ve called! It’s been three days! Three days since I’ve heard any word from my husband!”

You creep closer to the old corkscrew board and feel your heart sink in your chest as you find yourself looking at a fresh photo of a middle-aged man, presumably the woman’s missing husband. Now that you can see the board in its entirety, you notice there’s several new fliers posted among the sea of other missing faces, presumably never found.

You hear the heavy tread of Dabi’s combat boots behind you. “There’s more.” You tell him sadly without turning around. You hear him exhale loudly through his nose.

“Told you there would be. I wasn’t lying. This place is the missing person’s capitol of Japan.”

“I don’t understand.” You turn to face him, only to see that he has a blank expression on his face, giving nothing away. “I’ve never seen anything suspicious when we’ve gone out at night, and you told me that’s when this stuff usually happens.”

“The difference is; you don’t go out looking for trouble.” Dabi tells you smoothly, his insanely blue irises meeting yours, locking you in place. “Trust me, these people probably went out of their way to stumble across something they weren’t supposed to see, and they paid the price for it. Bad things happen all the time sweetheart, whether you see them or not.”

“You seem pretty confident about that.” You murmur finally, holding his gaze. “Had some experience with trouble in the past?”

For once, Dabi doesn’t have anything to say to you. Finally, he sighs and rakes a hand through his inky spikes. “Maybe.”

You want to ask him what he means, but in that moment, you feel your phone vibrate from inside your purse. You fish it out, only to see a text appear on screen that has your blood turning to ice in your veins.

???

Found you.

There’s no name attached to the text, only a random number you don’t recognize, but you think you already know who it’s from.

It has to be him. There’s only one other person you can think of who would text you something so innocent but so sinister, and it has you feeling like you want to puke.

Your ex-boyfriend.

Your eyes dart around the packed boardwalk wildly, trying to see if you could spot the familiar face of your ex in the crowd, but thankfully, you don’t see him anywhere.

How in the hell did he find you? There were only a few friends aside from your parents who knew where you’d moved to, and you highly doubt any of them would tell him where you’d gone. It was possible he’d simply gotten a new number and found a way to text you just to scare you, and if that’s what he wanted, he had accomplished his goal.

Your panic must be written across your face clear as day, because the next thing you know, Dabi has a hand underneath your chin, lifting your face up to meet his concerned expression.

“—I asked if you were okay doll. I’ve been calling you, but you didn’t respond to me.” He tells you. He glances down at your phone, a frown pulling at his lips. “What’s that?”

“I don’t know.” You tell him truthfully, shoving your phone back into your bag. “A really sick joke, I hope.”

His eyes narrow, the fire burning in them shines brightly, even though they’re more lidded then usual as he narrows his eyes at you. “What’s going on sweetheart?”

“Nothing—I—” You croak. You can’t stop looking around, hoping, praying, you don’t see the one person you were trying to escape from staring back at you. “—I gotta go.”

A look of concern passes over Dabi’s face, and you feel a flash of guilt for lying to him, but you don’t want to get him involved. You don’t want to bring anyone else into your mess. It’s not fair.

“If this was about earlier, I can—”

“It’s not!” you cut him off, already backing away from him. “I’ll text you later. I just—I just gotta go. I’m sorry.”

You don’t give him time to respond, before you pivot on your heel and book it down the boardwalk, away from the blinding lights, and away from him.

You don’t look back, and you don’t stop running until you’re in your tiny apartment – slamming the door behind you and locking it – even though it feels suffocating. It feels like the walls are closing in on you, and you’re finding it hard to breathe as you collapse onto your bed and cry.

You don’t know what to do.

You awake to the sound of furious pounding on your door.

You don’t know when you passed out; probably sometime after you managed to calm down slightly, but you can feel the dried tear tracks covering your cheeks as you slowly sit up and shuffle hesitantly towards your front door. The pounding continues, and you can’t help but wonder what time it is, and if you were going to receive a noise complaint from one of your neighbors, before you hear a horribly familiar voice just outside your door:

“I know you’re in there. You better open up right now or I’ll get your whole building involved!”

Your blood turns to ice in your veins as you hear the unmistakable sound of your ex-boyfriend’s voice snarl threateningly from the other side. You feel like someone’s dumped a bucket of freezing water on you as you start to panic. Tears flood your eyes involuntarily as you try to process what’s happening, but nothing’s making sense.

You have no doubt he’d wake the rest of your apartment building to get at you – if he hadn’t already woken up your neighbors. You know what he’s like better than anyone. Your ex has always been a big guy, and once he has his mind set on something (or someone), he’ll stop at nothing until he’s gotten it.

You have no idea how he got in the building in the first place, or how he figured out what apartment was yours, but that doesn’t matter as you watch your doorknob start twisting violently. You bolt forward and grab it with both hands, trying to keep it from unlocking as you listen to your ex-boyfriend grunt outside the door, no doubt trying to pick the lock from the outside.

After a few moments of back and forth struggling with the door; you hear the tell-take click of the door unlocking. You don’t stick around to watch it swing open – you know you won’t be able to hold it closed against him for long if he tries to force it open – and you sprint to your bedroom, slamming the flimsy door shut and locking it behind you.

You can’t calm down; you hear him in your kitchen, treading around the tiny space, calling for you, before his heavy footsteps slowly make their way towards your bedroom door.

You have limited options; if your apartment was closer to the ground, you’d consider escaping out your bedroom window, but you’re several stories up and you don’t want to do something that may cause you to break your leg, putting you at even more of a disadvantage against your ex-boyfriend. You have no idea what he wants from you, but if he’s so desperate that he’s willing to stalk you and break into your apartment, it can’t be good.

The police will take too long to get to you, you already know this. In the past, they hadn’t been helpful in these kind of situations – you know from experience. You can’t call them… but there is someone you can call.

You dive for your purse and pull out your phone just as your ex starts pounding on your bedroom door. Your finger hovers over Dabi’s contact in your phone, as he starts yelling at you through the door. You don’t want to involve Dabi in your personal troubles, you really don’t… but right now, you don’t have a choice.

Even though you don’t want to call him… you know he’ll help you.

Before you can second-guess yourself, you’ve hit the call button, and scoot yourself into the farthest corner of your room from the door, as you listen to the phone ring. It only rings twice before he picks up.

“It’s three in the morning sweetheart, what’s going on? Are you okay—”

“Dabi please help me!” you interrupt him, whispering frantically as your ex starts to rattle your doorknob. “I’m in trouble. I don’t know what to do!”

“What’s wrong? Where are you?” Immediately, his voice deepens, and you can tell he’s on high alert. You can’t see him, but you can hear rustling on the other end, and the tell-tale jingling of keys in the background.

“I’m in my apartment—it’s my ex—I don’t know how, but he found me. He broke in, and now he’s outside my door!” You hate that you’ve starting crying again, but you’re terrified, and Dabi can tell.

“Is he in the room with you?” Dabi rasps on the other line. “I can hear shouting in the background, that him?”

“Yeah, that’s him, and no he’s not, but he’s trying to force his way in!”

Dabi hums and you hear a door slam in the distance, followed by the sound of what you assume is his car starting.

“I’ll be there in less then ten. Just stay on the line with me. Everything’s going to be okay doll, I promise. I don’t know what he wants, but he’s not going to hurt you, I promise—”

At that moment, your bedroom door flies inward, causing you to scream and drop your phone, ending the call, as your ex rushes towards you. A surge of pure adrenaline hits you, and you drive your foot into his stomach and kick him back, giving you enough time to push yourself to your feet and make a mad dash for your door, only for him to grab you around the middle, and throw you down onto your bed, climbing on top of you and pinning your hands before you can recover.

“Get off me you freak!” you screech as you thrash in his hold. You manage to knee him in the sternum, briefly knocking the wind of out him, but it only serves to make him angrier, as he presses his knees into your thighs, and grips your wrists so tightly you know you’ll have handshape bruises adorning your arms for days after.

“Hell no, I finally found you, you little bitch—there’s no way in hell I’m letting you go again.” Your ex seethes above you. “It took me weeks to track you down. Your friends were no help, so took me longer than expected to find you.”

“I didn’t want you to find me, that was the point of me moving here!” you wail as you desperately try to free your legs. “I never want to see you again! What part of that is so hard for you to understand?!”

“Bullshit. You and I aren’t done until I say we’re done.” Your ex snaps. He looks around your bedroom and scoffs.

“I see you’re trying so hard to build a new life without me. Ungrateful brat. You moved on fast.”

“What the fuck is that supposed to mean—”

“Don’t lie to me!” Your ex-boyfriend dips down so your noses are almost touching. “I saw you on the boardwalk with that guy earlier. Who the hell is he? Your fuck-buddy? Your new boy toy?”

“He’s not my boyfriend, but he’s on his way here so I suggest you leave before he makes you!”

At your threat, your ex throws his head back and laughs. “I know what he looks like. He’s not even half my body weight. I’m not fucking scared of him—”

The abrupt sound of your front door being kicked in aggressively stops him mid-sentence, and the sound of heavy boots stomping towards your bedroom causes him to freeze. Your ex shifts so he’s more upright and looks behind him, giving you a clear view of your doorframe; only to see Dabi standing in it, looking absolutely feral.

His dark hair is wilder then usual, obsidian spikes sticking up every which way, and he has on the dark, torn duster you’d first seen him in over his usual dark pants and white tee-shirt, giving him a an almost deranged look. He has a mean glint in his eyes you’ve never seen before, and he looks almost predatory as your bedroom casts odd shadows across his face. You’ve never seen him this pissed before, and all of your instincts are screaming at you to run as you take in his disheveled appearance.

“You’re not scared of me, huh?” Dabi chuckles, but there’s no humor to it. His voice is as cold as ice, but his eyes are like blue fire, and are locked on your ex.

“You should be.”

It’s the only warning you get before he lunges at your ex. The sudden tackle rips him off of you and Dabi wastes no time taking him to the floor as you bolt upright. You look on in shock as both men wrestle on the floor before it turns into an all-out slug fest between them. You leap out of the way as they make their way off the floor and crash into your walls, never once taking their hands off of each other as they yell obesities and filth that you’re certain your next-door neighbor can hear through your shared wall.

Honestly, you’re shocked at how well Dabi is handling himself – you didn’t think he was weak, but he’s much leaner then your ex and not as tall – yet, he’s clearly got the upper hand as he cracks your ex across the face in rapid succession. You freeze as his nose explodes into a mess of scarlet, splattering across his face and your wall as he yells out in pain, taking his hands off of Dabi to hold his nose in a pathetic attempt to stanch the bleeding. The sudden display of gore has the opposite effect on Dabi.

He stares at the blood flowing from your ex’s nose like a faucet, before shooting you an almost apologetic look.

“Sorry you have to see this doll.”

You don’t have time to ask him what he means before he seems to shift right before your eyes. The shadows of your room seem to warp and twist around him, and you think it’s just a trick of the moonlight streaming in from your window; until you watch his obsidian hair turn stark white.

You feel your eyes widen as his form shifts – you ex is too busy trying to keep his nose together to pay attention to what’s happening in front of him – but you notice a horrible burning smell wafting through the room as his once pale, flawless skin morphs into a patchwork mess of dusky, wrinkled burns, held together to the few patches of visible healthy skin by what looks like silver surgical staples glinting wickedly in the pale moonlight.

You have no idea what’s happening to him or who or what he is, but you feel your knees give out as he flashes you a nasty looking grin, giving you a full view of the wicked sharp fangs sliding down past his burnt lower lip.

“You—” you whisper, but you don’t manage to say anything more, before Dabi turns back to your ex, grabbing him by the hair and yanking him down to his level, before sinking his razor-sharp fangs into the side of his neck before the larger man can even register what’s happening.

Your ex tries to fend him off, but Dabi is stronger. He ends up relinquishing his hold on his hair in favour of wrapping his arms around him in a death embrace. You can’t pull your eyes off of the scene in front of you, as your ex’s struggling gradually grows weaker, while Dabi laps at the blood flowing freely from the deep puncture holes in the side of his neck.

You hear your ex gargle wetly in the back of his throat before he goes completely limp in the white-haired mans grip. After a moment, Dabi retracts his fangs from his neck, before tossing his motionless body to the floor. You whimper involuntarily as you cover your mouth, staring at the lifeless body of your ex-boyfriend as Dabi whirls around to face you, his piercing eyes finding yours.

“You killed him.” You whisper. Dabi only glances down at the still-warm corpse on your bedroom floor for half a second before locking eyes with you again.

“I did.”

“Why?”

“He was assaulting you.”

“Oh.” You croak lamely. You try not to stare at the red coating his lips and dripping down his chin, staining the white of his shirt.

A moment of silence descends on your room. The only thing you can hear is the frantic pounding of your heart in your chest – it’s so loud in the resounding silence, you’re sure Dabi can hear it. The air is so tense you can cut it with a knife, but neither of you make a move. Finally, you clear your throat.

“I think I’m going to call the police.”

“You’re not going to do that.”

When the ivory-haired creature speaks, his voice is low and quiet, but you can tell just by looking at his eyes, he means business. You swallow thickly and nod to the corpse behind him.

“There’s a dead body in my apartment Dabi, I need to call the police. I—” you cough, trying to reason with him. “I’m not going to tell them about you. I won’t say anything. I know you were trying to protect me, but I can’t just ignore a dead body in my bedroom—”

“Don’t worry about it.” Dabi interrupts you, waving a hand at the corpse dismissively. “I’ll take care of it.”

“What do you mean you’ll—”

Dabi snaps his fingers, and before you can blink, the corpse of your ex-boyfriend bursts into bright blue flames. You scream as you scramble backwards, pressing yourself further against the wall, as the flames rage and quickly consume the body before your eyes. Dabi only grins savagely at your reaction.

“Don’t be scared sweetheart. He’s trash. The least he can do is become fuel for my flames.”

“Oh my god,” you whisper, watching as the cobalt flames extinguish themselves, leaving nothing but ash in their wake. “What are you?”

Dabi only stares you down as he wipes his mouth with the back of his hand. “I think you already know the answer doll.”

You do. But you don’t think you can voice it out loud. You don’t know what it means for either of you now.

Dabi licks his mismatched lips, allowing you to catch a glimpse of his red tinted fangs. “You’re coming with me.”

You shake your head. “No, hold on—”

“I’m not giving you a choice sweetheart.”

He’s on you faster than you can blink. He slaps a brunt hand over your mouth before you can cry out. He grabs your chin with his free hand as he presses you up against the wall, forcing you to stare into his burning irises.

“Sleep.” He commands.

You feel a wave of sudden fatigue pass over you, and your eyelids flutter shut against your will. The last thing you remember is feeling his insanely warm arms wrap around you and a sudden feeling of weightlessness, before sleep takes you.

You wake up with a pounding headache.

Blinking away sleep, you slowly sit up with a groan and rub at your eyes, wincing internally as you feel your eye makeup smear even further. You slowly look around, only to freeze as it suddenly dawns on you have no idea where you are.

You’re in what appears to be a bedroom, but it’s hard to tell since it’s so dark. The window coverings block out any form of light from outside, keeping you quite literally in the dark. You have no idea what time it is or (more concerning), who’s bedroom you’re in, until the events from before you passed out come flooding back to you.

Your ex. Blood everywhere. Dabi. Scars. Blue flames. Fangs.

You shudder at the last thought. Had you hallucinated the whole thing? It didn’t seem real. You think back to feeling the heat of the flames that had consumed your ex-boyfriend on your skin, and you rub at your arms involuntarily.

No, they had definitely been real. Which means everything else was real too.

Currently, you were certain of two things:

One: your shitty ex was dead. Drained of his blood before being incinerated to a crisp before your very eyes.

Two: Dabi wasn’t human.

Before you can sink too far into your thoughts, you’re suddenly aware of a prickling sensation dancing along your skin. You know the feeling all too well, and as groggy as you might feel in the moment, you’re painfully aware someone’s watching you.

You’re not alone.

A slight shuffling noise from the far corner of the room catches your attention. You slowly turn in the direction of the sound with baited breath, only to see an abnormal looking shadow faintly outlined in the surrounding darkness of the room.

You already know who it is without him having to say anything.

“Dabi?” you call out to him timidly. A deep sigh answers you.

“Good, you’re awake. You’ve been out for a while.” He rasps quietly.

“Where am I?” you ask, squinting at his outline. The more you try to make him out, the more he seems to try and blend into the pitch of the room.

“My room. Back at the house. I drove us back here after you passed out.” You hear him kiss the back of his teeth. “Sorry. I didn’t mean to make you sleep for so long.”

“Wait, how long have I been out?” you question, as you feel around your surroundings, only to realize that he’s put you on his bed.

“About an hour. Dawn’s coming soon. I couldn’t leave you alone after you saw all… that.”

He doesn’t need to clarify what he means.

You both laps into an uncomfortable silence, before you finally gather up the courage to ask him the question that’s plagued you since he took you.

“Are you going to kill me?”

Silence answers you, and you feel yourself start to shake as every horrible scenario you can think of races through your head. Almost as if he senses the what you’re thinking about, you hear Dabi take a hesitant step forward, only to catch himself at the last second.

“…No.” he finally admits. “No, I’m not going to kill you.”

“Then why did you bring me here?” you sniff, as you try to control the tears you feel pricking at the corners of your lash line. “Why do any of this. What are you? Who are you?”

He doesn’t answer you. You squint into the abys of the room where you know he is, and you can faintly see his deep blue eyes gazing back at you, looking like twin flames in the gloom. You swallow hard and try a different approach.

“It’s too dark in here… can I have some light?”

Dabi sighs, but you hear him snap his fingers, and suddenly a candle you didn’t know was nearby, bursts into blue flames. The wicks hiss and sizzle before settling, casting an eerie blue glow around the room, illuminating it slightly. You glance to the corner where you know Dabi is, and you can see him a little better, though he seems to be trying to keep himself out of the light as much as possible.

You frown slightly. “Come here.” You tell him quietly, patting the space beside you on the bed. You know you’re tempting fate, but you believe him when you say he won’t hurt you. He had multiple chances to kill you, and yet; you’re still here.

You hear Dabi snort. “I don’t think you want that.”

You shake your head. “I do. C’mere. We need to talk.”

Dabi falls silent, but you see him turn towards you, and slowly makes his way over to you. The flickering blue light the candle provides casts twisted shadows over his lean frame as he stops just in front of you, and bends down so he’s eye level with you.

You find yourself face to face with a mess of painful looking burns covering the majority of his face, held together with countless surgical staples. The burns are everywhere; under his eyes, his neck, the entirety of his lower jaw, and even his ears. Now that you’re up close, you can see he even has some staples decorating his ears much like regular piercings, and he even has three studs dotting the right side of his nose. They suit him in a way, and you can’t help but find him handsome, even with half of his face completely ravaged by burns.

Dabi’s eyes glint savagely as you take him in slowly, his two-toned lips pulling back and exposing the deadly sharp fangs inside his maw. “Not pretty, is it?”

“What happened to you?” you whisper, hesitantly reaching up to touch his burnt lower jaw. Dabi seems to want to flinch away from your touch, but he forces himself to stay grounded as your fingertips gently brush his destroyed skin.

He laughs breathlessly and rakes a burnt hand aggressively through his now very white hair. “It’s a long story.”

“I have time.”

“Yeah. Sure.” He agrees, pulling away from your gentle hands reluctantly. He trudges over to a small loveseat pushed up against the wall opposite to his bed and sits down on it, shrugging off his torn duster, before putting his head in his hands with a sigh, giving you a painful view of the long wine-coloured burns tracking down his arms and ending at his knuckles.

You try not to focus at the dried blood that’s still decorating his shirt and hands.

After a moment he props his head up on his hands, fixing you with his intense gaze, but still doesn’t say anything. You realize he’s waiting for you; but now you’re at a loss for words. The agitated vampire across the room from you sighs, and you can see the veins in his neck become more prominent as he forces himself to try and relax.

“I know you have questions, so ask.”

“So, you’re really a—” you cut yourself off and swallow thickly. Even though you know what he is without him saying it, you still can’t quiet bring yourself to say it out loud. He leans forward, smiling meanly as he rests his forearms on his knees, eyeing you with his burning stare of his, that suddenly seems so cold.

“Go on, you can say it.” He prompts you, finally getting you to unfreeze.

“—A vampire.” You finish lamely. He nods, leaning back and draping both arms over the back of the loveseat.

“You got it sweetheart.”

“But how?” you prod, finally finding your voice. “I thought they were myth?”

“So did I, until one bit me.” Dabi snickers unkindly across from you, before quieting down, allowing you to ask your next question.

“How did you become one?”

“I died.” Dabi tells you flatly, avoiding your gaze for the first time since he brought you here. His nose scrunches up after he says it.

“Well, I almost did. Technically I was walking the line between life and death when the old fucker found me.”

He sighs and runs a blood-stained hand through his spiky white mane, leaving faint russet streaks behind. You force yourself to maintain eye contact with him as he speaks again.

“When I was alive, my name was Touya Todoroki.” He admits softly, giving you his real name for the first time since you met him. “I was taking a walk in the woods near my family home when a forest fire broke out, burning everything. I got trapped in the blaze and I ended up with these.” He gestures to the dark patches of gnarled skin covering the majority of his visible skin.

“I’m not sure how I managed to survive, and I don’t know how long I was left there for; but it was the vampire who ended up turning me, who found me in the aftermath. I was in bad shape and probably would’ve died if he hadn’t given me his blood, turning me into this.”

He says it so scathingly. You know he’s frustrated without him having to tell you. Still… the horrific burns that mar his skin tell you a story of unspeakable agony. There’s no way a normal person would’ve been able to survive what he went through without help. His help just happened to have come from an unexpected source.

“He saved you.” You murmur quietly, causing Dabi… Touya… whatever his name was, to snort bitterly.

“He didn’t fucking ask, he just did, consequences be damned. Believe me, there was plenty of days at the beginning where I wish he hadn’t and just let me die.”

His bluntness causes a deep ache to bloom in your chest as you take in the vast amount of damage covering his body. You can only imagine how much worse the burns had been when he’d first been turned, on top of dealing with becoming what he is now. Before you can say anything, Dabi continues on, still refusing to look at you directly.

“After he turned me; my sire brought me back with him to recover. I ended up staying with him for a few years while I was figuring out my new body before I eventually left. Found my way here a while ago and never ended up leaving. Been here ever since.” He looks at you pointedly. “Don’t ask me how old I am. I stopped keeping track a while ago.”

Normally you’d be content to leave it there (honestly, now that he’s said it, you’re not sure if you want to know exactly how old he is anyways), but he has a car, which means he must have a license of some kind, which then begs the question how he was able to get one in the first place.

“Wait, so if you’re a vampire and you’re… older than you look, how have you been able to get a drivers license, or any I.D. for that matter?” Dabi snorts.

“Remember how Compress works as an entertainer?”

“Yeah…?”

“Turns out he’s really good at forgery too.”

“Oh.” You furrow your brows at his explanation.

“So… Compress knows about your… condition?” Dabi smirks at your hesitance.

“Oh yeah. Fully aware.”

“Is he… I mean… is everyone in the house a—”

“We’ll put it this way doll: nobody in this house has a heartbeat except for you.”

Well, this just kept getting better and better. Not only was your crush and his friend’s part of the undead; they were also committing fraud. You definitely knew how to pick them.

In hindsight, you shouldn’t be as surprised as you are upon hearing the rest of Dabi’s roommates are also vampires. All of them operated at night, and they definitely had quirks that set them apart from other people. Not to mention it would also explain the feeling of unease you always experienced around them. You’re more shocked at how many there are, which brings you to your next question:

“So, your sire—” you look at him questionably, waiting for him to explain. Thankfully, he provides you with an answer.

“—is a term referring to the one who turns you, yeah. Mine happened to be a particularly old bastard. Strong as hell, but old as time. He had a lot of influence over my kind back in the day. Pretty sure he died some years back. No idea who killed him, but I’d thank them if I knew.” He pauses before laughing lightly.

“Come to think of it; Shigaraki and I share the same sire, but he stayed with him way longer than I did. I left as soon as I could.”

Well, that was interesting news. “Why?”

“He played favourites.” The snowy-haired vampire grins at you from across the way, but there’s no warmth behind his eyes.

“I’m pretty sure he turned me first, but I was already gone by the time Shigaraki came into the picture. We knew of each other, but our paths never crossed. He sought me out a year or two before our sire bit the dust, and I’ve been stuck with him ever since. As for the others…” he waves his hand dismissively. “Hell if I know. They just sort of showed up one day, one after the other. I don’t know how they found us, s’not like I was broadcasting we were here, but they still came regardless, and then they never left.”

“For what it’s worth, I’m sorry about what happened to your sire.” You tell him. “It must be hard, loosing your mentor like that.” To your surprise Dabi only laughs, waving off your concerns.

“Don’t be. In fact, I’m not. I’m glad he’s gone. Shigaraki was more torn up about it then I ever was, but even he got over it. There’s a lot of perks that come along with your sire dying. Powerful perks.” He leans forward, pointing to the blue flames chewing away at the candle wicks.

“When it comes to vampire hierarchy, the most powerful vampires are the older ones who create the majority of newer vampires. The vampires they turn are basically their pawns – never to get any stronger – unless, their creator dies. Then they can inherit some of their former sire’s abilities through succession.”

He grins darkly at the confused expression you know you must be wearing on your face, because he elaborates before you can ask. He taps the marred skin of his lower jaw.

“If you haven’t noticed, I can shift between my real face, and the one you’re used to seeing; minus the burns. I didn’t used to be able to do that. Do you know how fucking difficult it is to go out in public when your face looks like this? Even at night, all people do is stare. It’s fucking annoying.” He shakes his head, allowing the dim candle light to reflect off his pale hair, giving it a blue tinge. “There’s a bunch of other things I can do now, but this is the most useful.”

“Like the flames?” You ask. Surprisingly, Dabi shakes his head.

“No, that I’ve always been able to do since I turned. My own special ability if you will. Normally you get one when you become a vampire. Shigaraki can decay shit; Toga can transform herself into a different person if she’s drank their blood; Twice can create multiple copies of himself; you get the picture. there’re some weird ones out there. Mine’s a sick fucking joke, considering it’s what killed me in the first place, but it’s powerful, so I can’t complain too much.”

“Oh.” You mumble, still trying to wrap your head around what he’s telling you, but you know you’re failing miserably. You’re not worried about him killing you, but you still don’t understand why he’s telling you all this.

“So… you don’t want to kill me.” You clarify gently. Dabi only shakes his head.

“No. Wouldn’t have bothered tell you all that if I did.” He confirms softly.

“Then what do you want with me?” you ask him again. Dabi sighs.

“I don’t think it’s a secret that I like you princess.” He tells you with the faintest hint of a smirk, and you feel heat rise to your cheeks. “—and I know you like me too.” He adds after a pause.

Your mouth twitches and you nod slowly before looking away. “I do, it’s just... this is a lot to take in.”

A thought occurs to you suddenly, an awful thought. One that you wish you didn’t think of, but now that you have, you have to ask.

“All those people… the missing ones from the boardwalk… that was you, wasn’t it?”

His silence is telling.

“Oh my god Dabi…” you whisper, running a hand through your hair as you let out a breathless laugh. “There’s so many people… how long have you been doing this for?”

“To be fair, not all of them were me.” He corrects you, but his answer lacks any of his usual fire. “There are five other vampires here. I can’t drain over a hundred people by myself. Besides, I don’t need much to survive. I can go two or three weeks without feeding, but the longer I go without blood, the worse the thirst is.”

“Over a hundred?” you sputter. You think back to all the faces you’d seen posted on the bulletin board. Some postings had been quite old while others had been days old, and there had probably been more before them – many more.

“Like I said; we’ve been here a long time. We never get old, and we basically never die… but we have to feed. That’s the trade off.” Dabi tells you solemnly.

“We normally try to go for people who won’t be missed; drunks, the occasional asshole who pisses us off… and some piece of shit abusers.” He growls ominously, and you know that he’s referring to your ex without him having to say it.

“… But some people just end up coming across us at the wrong place at the wrong time.” He admits after a moment. “We try to be selective about who we feed off of, but if we’re starving, we have to feed, otherwise we would go feral.”

“Is that why you brought me here?” you hate that you have to ask him, but you need to know. “To feed off of?”

“Hell no.” Dabi reaffirms. “Of course not. Your blood smells incredible, and I’d be lying if I told you I hadn’t thought about drinking from you...” He bites his burnt lower lip as you visibly cringe in front of him, before quickly adding: “But I’m not going to feed off you. I enjoy having you around too much. You’re different from the other humans I’m forced to be around. Besides, I’m not hungry anyways.”

You try not to read too much into that.

“So then what are your plans for me?” you finally ask, as you pull one of the blankets you were laying on over your legs. “Why bother telling me any of this? Do… do the others know I’m here?”

“They know. If you’re worried about them getting at you, they won’t. They’d have to go through me, and I’m not someone they want to fight anyways. I’d light their asses up if they got within ten feet of you. But they don’t want you harmed either, so don’t worry about them.”

“You’re sure about that?”

Dabi scoffs. “Shigaraki isn’t happy that I brought you back here, but he’s a miserable bastard on a good day. I couldn’t very well leave you back at your place anyways.”

“So then what happens now?” you ask quietly. “I don’t think things can go back to the way they were before.”

Dabi shakes his head; his ivory spikes sway sightly at the motion. “No. They can’t. I figured if I brought you back here and tried to explain what was going on, you’d understand at least a little. I wouldn’t have bothered saving you from that piece of shit if I didn’t somewhat care for you, you know.”

“I know.” You pause before averting your eyes, and mumbling bashfully; “Thank you for saving my life. I have no idea what he was going to do with me, but whatever it was, it wasn’t good. I was… so scared.” You admit as you drop your gaze to your hands.

You ex had never acted like that before in the past – even when things were at an all-time low between you, he’d never physically assaulted you. The look he’d had in his eyes could’ve fooled you into thinking he was possessed by a demon. You don’t want to think about what would’ve happened had Dabi not intervened.

At your silence, Dabi stands from his spot and slowly makes his way over to you, giving you plenty of time to stop him if you wanted, but you let him approach. He cautiously kneels on the bed in front of you, and slowly takes your hands in his large, scarred ones.

“Look;” he tells you softly, but firmly. “I wasn’t lying when I said I like you. There’s something about you I find irresistible – and it’s got nothing to do with how I find the smell of your blood intoxicating either. I want you to stay… with me, that is.”

You feel yourself soften at his admission and he groans in the back of his throat, squeezing your hands. “Look. I’m not good at this shit. I’ve been around a long time and I’ve never been good at it – never needed to be – but ever since I met you, I’ve wanted to keep you all to myself.” He bites out a laugh at his admission.

“It’s selfish of me to say that; especially considering everything that happened with your ex – but you make me want to be.” He licks his lips before quietly admitting;

“I may be a monster, but I certainly won’t treat you like one.”

You mull over his words for a moment. His eyes convey nothing but sincerity, and you find yourself believing what he’s saying to you. You squeeze his hands back.

“I feel the same way about you.” You admit, watching as a variety of emotions flicker through his eyes. Shock. Surprise. Acceptance, and something else you couldn’t quite place—

“Can I kiss you? He suddenly blurts out. You blink, realizing he’d gradually gotten closer to you, invading your space and crowding you in. If it’d had been anyone else, you’d be uncomfortable with how close they were to you; but it’s Dabi, and even with the knowledge of what he was, you don’t feel anything but calm.

Odd, considering you’d watched him murder a man right in front of you not too long ago – but even knowing that, you know he won’t hurt you.

You nod, your eyes slipping closed, and he leans in and presses his two-toned lips to your own. The texture of his lips is unlike anything you’ve ever felt; his upper lip is soft while his bottom lip is rough and chapped from the burns, but the contrast is nice, and you feel yourself sigh into the kiss, giving him further access to your mouth. The scarred man takes the opportunity to slip his tongue into your mouth, deepening the kiss, as you feel his hands leave your own to cradle either side of your face. You realize how big his hands are when you feel his fingers splay out across your lower jaw and sweep over the pulse point in your neck, keeping you tethered to him as you fist your hands in his shirt.

You only pull back when air becomes too much of a necessity, but not before you boldly run your tongue over the too-sharp teeth hidden in his mouth, causing Dabi to laugh slightly as he watches you regain your breath. His hands never leave the sides of your face, as you reach up to cover the backs of his stapled covered hands with your smaller ones.

“You’re playing a dangerous game sweetheart.” he chuckles, slowly rubbing circles onto your face with his fingertips. “Keep doing that, and I really won’t be able to control myself around you.”

His statement makes you blush and you squeeze his hands. “Dabi I—"

“Touya.”

“What—?”

“Touya. My real name. It’s Touya.” He tells you breathlessly. “You asked me when we first met what my real name was. It’s Touya. Just call me Touya.”

“Touya.” You test his real name out gently, and a pleased rumble escapes the back of his throat.

“Fuck, it sounds good coming from you.” He tells you, eyes half-lidded. “Really good.”

Your heart pounds in your chest as he closes the gap between you again, pressing his lips to your own, only this time, he’s bolder and allows his hands to wander down your body until they settle on your hips, hot as a brand.

“Shit.” You murmur as you wrap your arms around his neck. Touya chuckles against your lips before tilting his head so his head his mouth is right next to your ear.

“If you want to keep going, just know I’m not going to stop.” He rasps as he squeezes your hips. “I won’t force you, but if you don’t want to then you have to tell me now—”

You cut him off by turning your head and pressing your lips to his again, prompting him to pull you closer until you’re practically straddling his lap.

“Fuck.” He snarls as he shifts and pins you down on his bed. “Here I was trying to be nice. Trying to be good for you, but you had to go and rile me up—”

“Touya.” You whimper as you feel something hard pressing into your inner thigh. “Touya please. Don’t tease.”

“Fuck sweetheart, I know. Don’t worry I’m going to take care of you.” He hisses as he paws at your shirt. “Fucking—take this shit off. I want to see you.”

He helps strip you out of your clothes in record time, and suddenly you find yourself bare before him. You move to cover your exposed breasts but Touya swiftly pins your hands. He doesn’t bother to try and hide his unapologetic gaze as he takes in the sight of your naked body on his bed.

He looks at you as if you’re a work of art, you realize, and he seems to be completely lost in you. You call out to him gently, snapping him out of whatever trance he’s fallen under.

“I can’t believe you’re letting someone like me do this to someone like you.” He admits. “Even after I told you what I am. After you’ve seen what I can do. What I’ve done.” He shakes his head, but his eyes light up as a wicked smirk overtakes his features, allowing his fangs to peak out from under his lip.

“Think you might be as fucked up as me, pretty girl. No woman in their right mind would let a monster like me fuck them after watching me kill their shitbag ex. You’re a sick little thing, aren’t you?” he teases you, but you only shake your head.

“You’re not a monster.” You tell him sincerely. “I don’t think you are.”

Touya only smiles down at you as he touches his forehead to yours. “Think you might be the only person in the world who thinks that sweetheart, but thank you.”

You fist your hand in his bloodied shirt. “Take this off.” You tell him, and for the first time, he hesitates slightly.

“It’s not pretty underneath.” He warns you. “The burns go all the way down.”

You help him out of his shirt in response.

He’s not wrong: his torso is a mosaic of dark purple burns and staples crossing over his shoulders, stomach and back. His legs aren’t much better once you shimmy his pants down his legs, but you couldn’t care less once you see his cock.

It’s beautiful and pale like the rest of his unmarred skin, it’s a good length, and decently thick. The tip is flushed red and you can’t help but swallow in anticipation as he kneels between your legs again. Touya grins as he hovers over you.

“I can hear your heart about to burst out of your chest princess. You might wanna calm down; don’t want you passing out on me.”

“Shut up.” You mumble sheepishly, prompting him to laugh. “It’s been a long time since I’ve—well…”

Touya chuckles at your hesitance. “Me too.” He admits, and for some reason, it makes you feel better. Touya’s eyes rake down your exposed form, his Adam’s apple bobbing as he drags his eyes up to your neck. “You smell so good.”

“Do you want to?” you ask breathlessly, turning your head slightly to the side. “I could let you—”

“No, not yet.” Touya murmurs, bending down to kiss you. “Let me try something.”

You don’t get the chance to ask him what he means before he’s bent down between your legs, and licking a long stripe through the middle of your pussy with the flat of his tongue.

You let out a load moan and throw your head back as he begins to lap at your pussy like a man starved, his large hands hold your thighs open as he licks at your center. You whimper and moan as he eats you out with vigor – your cries only increasing in volume as he introduces his fingers to where you need him most.

He starts with one pushing deep into your core, but it isn’t long before he’s adding a second digit, scissoring you open as he eats you out like he’s biting into a ripe fruit, and you feel divine.

It’s not long before you feel yourself teetering on the edge, and you close your eyes as you prepare to fall – only for your eyes to suddenly snap open as you feel something sharp digging into your inner thigh. You bolt up with a gasp only to see your vampire’s fangs buried in the meat of your thigh as he continues to pump his long fingers in and out of you.

Your blood dribbles down his chin as he continues to suck on you – moaning around your leg – and some sick part of your brain thinks it’s one of the hottest things you’ve ever seen. You reach down and fist your hand in his hair, tugging on it slightly and watch his eyes close as he groans something that sounds suspiciously like “harder.”

His fingers brush up against your sweet spot when you tug on the blood-streaked strands again, and you buck up into his hand, causing him to stroke the spot again and again has he drinks your blood. You’re getting light-headed and you can’t tell if it’s from your impending orgasm or the blood loss, before Touya pulls away from your leg, and twists his fingers just right, causing you to fall over the edge with a loud gasp as you feel yourself come undone.

“Fuck me.” You hear Touya snarl, and suddenly he’s looming over you again, caging you in with both his arms on either side of you, mouth dripping red with your blood. He grins down at you sadistically, elongated fangs streaked red with your blood. “That’s so fucking hot.”

You only moan in response as you feel for the puncture wounds he’s left in your thigh, but he swats your hand away as he lines himself in with your entrance. He pins both of your hands above your head with his free hand, and swoops down to press a heated kiss to your neck before slamming himself home – filling you up in one fluid motion.

You feel your back arch off the bed, and your mouth drops open in a silent ‘o’ as you struggle to adjust to his size. Above you, Touya hisses, as he struggles to keep himself in check.

“I can feel you squeezing down on me.” He pants. “You keep doing that, I’m not going to last long.” He warns you, but you shake your head.

“Don’t care. I just—I just want to feel you Touy—”

You don’t get to finish your sentence before he’s moving within you. His movements are deep and deliberate, leaving your breathless as he snaps his hips against yours at a brutal pace. He’s relentless, almost as if he’s trying to make a home for himself in your depths. You notice that his pupils are dilating and shrinking rapidly as he struggles to hold himself back break completely breaking you.

“Fuuuck.” The white-haired vampire groans as he slides his hand down to your hip, holding you in place as he pounds into your gummy walls. “You’re perfect. I knew you would be. I wanted you. I wanted you from the moment I smelled your blood. I’m glad I didn’t—” he cuts his ramblings off, and buries his head in the crook of your neck, inhaling your scent as you moan his name.

You feel his fangs ghosting along your neck, and it brings you back to reality. You weakly tap at his hand holding both of yours prisoner with your fingers, and he quickly releases you. You opt to wrap your arms around his burnt neck – being mindful of the staples holding his skin together – trying to keep him as close as possible, as his other hand finds your free hip, and grips you hard enough that you know you’ll have handshape bruises by the time you’re done.

But that doesn’t matter, not when he’s trying his damnedest to rearrange your insides.

“I’m close.” You murmur in his burnt ear, and he grunts in acknowledgment.

“Me too.” He rumbles, pressing his warm body to yours. “Need you to come for me doll. Need to feel it—” he sneakily reaches down to rub at your clit, and that does you in.

You come with a choked scream and he follows you with an almost feral snarl. You feel his cock twitch and are rewarded by the warm stream of his dead seed deep within you. It’s too much stimulation, and you try to move away, but he follows you, holding you down with his body weight. You feel the press of his fangs like a whisper against your neck, but he doesn’t bite down, much to your surprise.

You stay glued together for what feels like an eternity, only for him to pull out of your body with a huff and flop down next to you on his bed. He doesn’t go far though, and opts to pull you close to his scar-ridden body so you’re practically laying on top of his chest; not that you mind though.

It’s funny, now that you’re so close to him – it’s only now that you realize he doesn’t have a heartbeat.

It should be concerning. It should have you running for the hills. You should be panicking at the knowledge of the literal undead roaming around, draining unsuspecting victims of their life blood – and while you’re still not sure what to think of the last part – you also know the vampire next to you wouldn’t hurt you. He’s protected you in his own gory way, and while you know you probably shouldn’t; you feel safe around him.

You trace the seams of his scars, and feel him hum contentedly in the back of his throat as he shifts you slightly against him. Peering at the dark window coverings, you can see the faint traces of dawn light trying to break through. Touya follows your gaze through heavily lidded eyes.

“Guess you’re staying here doll; I’m not going out in that. I’ll take you home later.”

“What, so you can make me do the walk of shame in front of your roommates?” you ask him, causing him to laugh.

“They won’t say anything. Not if they don’t want to get turned to ash.” He wiggles his eyebrows, and flashes his fangs at you, glinting wickedly in the low candle-light. You tap them hesitantly.

“Why didn’t you do it?”

“Do what?”

“Bite me. You could’ve.”

“Your leg says otherwise sweetheart.”

“Not that.” You brush him off. “I mean my neck. I know you wanted to. I could feel you.”

Touya exhales loudly through his pierced nose. “I did.” He admits. “The problem is, if I did, I probably wouldn’t stop.”

“Ah.”

You lapse into silence for a moment more, before you go back to tracing seams of his broken skin. “Can you turn people? Into what you are?”

He only nods, closing his eyes gently. “I can.” He confirms. “Never done it before though. Never had the need or want to.”

You feel your heart speed up in your chest, and you know he must be able to hear it as you force yourself to ask; “What would you do, if I asked you to turn me one day?” Touya only chuckles.

“I’d turn you into my own personal thrall. Keep you by my side.”

“Oh, so like some sort of slave?” you tease weakly, but Touya only shakes his head with a slight grimace.

“I was thinking more along the lines of a Dracula’s Bride sort of arrangement actually. I wouldn’t put you through the shit I went through when I first turned.”

The implication hangs heavy in the air between you, but he doesn’t make a move to take it back. You twist and prop yourself up on your elbow so you’re looking him dead in his eyes, only to see he’s deadly serious, causing your breath to hitch in your throat.

“You mean that?”

“Wouldn’t say it if I didn’t.” he tells you gruffly, placing one of his large hands on your head and pushing you back down to his chest. “Don’t ask me shit like that unless you’re actually serious though. It’s a one-way street. The change is permanent. You’re this forever.” He warns you.

He must see the hesitation in your eyes, because his voice softens, and the hand that’s currently holding your head down switches to lightly combing through your hair.

“Live your life for now sweetheart. My offer still stands: If you really want to toss your mortality out the window. I’ll be the one to take it from you. But for now, just think about it. You can give me your answer when you’re ready.”

“…and what if I decide I’m never ready?”

Touya chuckles. “Then you’ll have my undead ass as a boyfriend when you’re an old lady up until the day you die.”

“A boyfriend huh?” you tease, grinning up at him softly. He rolls his eyes.

“Yeah, yeah. I just told you I’d make you my thrall, that’s all you’re getting from me pretty girl.”

“You basically said you’d make me your wife. Dracula’s bride, remember?”

Touya rolls his eyes, and you swear you see the faintest dusting of pink flash across the parts of his cheeks that aren’t brunt, but it’s gone as soon as it came, prompting you to giggle, and you both fall into a comfortable silence.

He squeezes you once after a heartbeat. “I’d take care of you, you know; if you wanted me to turn you. I’ll take care of you now, but I’ll look after you if and when you decide you want me to change you. You know my secret so you’re stuck with me now. It’s not like I can let you go. You don’t have a choice.”

You laugh in spite of yourself and snuggle closer to him. “I could think of worse things.”

“You say that now…”

“and I’ll mean it later.” You tell him as you reach up to stroke the burnt flesh of his jaw. “Really, I do.”

You feel Touya press a light kiss to the crown of your head, “Yeah I know.” He confirms, murmuring into your hair. “Now, sleep. I’ll take you back to your place once the sun has set. We’ll figure out what to say to your landlord about the scorch marks I left behind. Worse comes to worse, you can just move in here with me.”

You feel your eyelids droop at his words and you snuggle into his burnt flesh, trying your best not to apply any more added pressure to the sutures keeping him together, as you feel his arms settle at your waist, keeping you close to him.

You weren’t sure what the future held for you now, but you were sure that whatever it decided to throw your way, your vampire wouldn’t be far behind you.

FIN

218 notes · View notes

shiny-jr · 8 months

Text

how to steal a heart (I)

[ a dummy's guide on how to steal the heart of a poor pathetic man ]

- Warning: Yes, this is still a yandere thing. You have been warned. Female reader.

- Note: This has been an idea (heavily inspired by Howl's Moving Castle) I had in my docs since fall 2022. I was talking to a mutual about how writing on Tumblr vs Quotev feels very different. If I leave something unfinished on Quotev, I feel incredibly guilty which prevents me from posting new stories. However, on Tumblr, I don't feel as guilty. Not sure why. Anyways, I know most of my followers here don't care for my ocs, and I've been wanting to post this for so long. So instead of posting on Quotev, I'll post it on here just to get rid of the urge to share this story (might delete this later). This is the same story I posted that little screenshot of not too long ago, and that screenshot was basically just the prologue chapter. So yeah. Hope you enjoy?

IN WHICH THERE IS A SEAMSTRESS . . .

Black smoke concealed the window like a thick veil as the walls around her shook. It was a sure sign that the train was inching by. The screech from its whistle and clanking against the railroad tracks, so loud that it must’ve been heard over a mile away, only confirmed her guess. Her hands continued to cut smoothly through the linen fabric, separating enough to fulfill another order placed this morning. As the young woman worked to separate the colors and gather more material, the corner of her eyes caught sight of the smoke concealing her perfect view.

The train’s fading motion and clanging against the tracks was eventually replaced by chatter just outside her workshop. It all became background noise, as she began to utilize the sewing machine. Lines formed over the cloth, blending it and connecting so they formed an article of clothing. Needles, pins, and scissors cut and dug deep through the cloth. Buttons of all shapes and sizes were neatly organized in little boxes, so she could easily take what she needed. Time just seemed to fly as she worked so quietly and efficiently, oblivious to the hours ticking by. Any other noise fell on deaf ears, even as a knock resounded on the firm wooden door that happened to be wide open already.

A pause before the person tried again, knocking a little louder again. “(Y/n)?”

Snapping out of her efficient trance, the tailor snapped to attention and straightened her sitting posture. Gazing at the door and back the window where the sun was much lower than before, it took her a moment to figure out what exactly was going on and what time it was. It was later in the day, and the woman at the door was Dalena… Well, everyone called her Ma Dalena because she was a kind older lady who tended to see the young female tailors as her own children. At least, most of the tailors.

“We closed up five minutes ago. You can go now.” Ma Dalena gave an encouraging smile that displayed the dimples on her skin, showing signs of age evident by the wrinkles. Judging by her long dress and small woven handbag hanging from her wrist, it was probably safe to assume that she had evening plans. “Why not spend the rest of the day with us?”

Us. Correct she was again. As welcoming as the invitation was to join Ma Dalena and the other tailors, she wasn’t willing to join them anymore. Not after the first time when she dared to venture with them. After shifts, the tailors had a tradition of going out into town. Not that it was a bad thing. But they used their time cafe hopping, searching for flirtatious men to satisfy their need for affection. Oftentimes, they would get caught up with the pushy kind. And ever since some troops from the military have returned from their duties, well… encountering a bunch of men who hadn’t felt the touch of a woman in months, was not ideal. At least for her.

Taking her foot off the pedal to pause her work and silence the sewing machine, she pretended to consider the invitation before mustering a polite smile with a shake of her head. “Hm… It sounds nice. But I promised the client I would finish this so they can pick it up tomorrow. So I’ll stay, but have fun. Have another drink in my place, alright?”

Ma Dalena merely nodded in understanding, her polite smile turning somber as she turned on her two-inch heels and began walking to the front entrance. The chatter of the other tailors ready and eager for the rest of the day off, went quiet as she announced, “We’re leaving now. Hurry now if you’re coming!”

The chatter resumed, accompanied by the sound of more heels tapping quickly against the wooden floors in an effort for the straying members to catch up with the group. They complimented each other's outfits they spent days making by hand, discussing various fashion trends, gossiping about clients and others in town.

In a way, she did and she didn’t regret accepting the invitation. It may have been nice to have good company for once, but it never felt right when she was present within their clique. It was as if she were trying to forcefully add a puzzle piece to an already complete puzzle, which is why she stopped forcing it. She wouldn’t want to sit there awkwardly during tea, unsure what to say as they spoke so confidently and loudly. It felt as if she were an imposter, someone trying to disguise themselves to blend in. It was why she worked in a small separate room, away from everyone else. That, and because she was the fastest tailor there. Part of her wondered if Ma Dalena was beginning to dislike her since she turned down invitation after invitation. But how was she to explain what she was feeling, when it would only sound like whining?

Drowning out her thoughts with work to occupy the space in her mind, she pressed her foot against the pedal and began sewing once more. The loud hum of the machine filled her ears as it worked against the red cloth under her fingertips. This was the way it was supposed to be. Mindlessly spending her waking hours working at a craft she didn’t excel at, but was decent enough to earn wages in. All while wondering what could’ve been, and secretly hoping that maybe soon there is something that can be––

“Look! Look out there! It’s Reyes’ temple!”

“Reyes?!”

“Where? I don’t see it!”

“There! Over the hill!”

Now that was something you don’t see everyday. Everyone retreated back to the window, desperate to catch a glimpse, even Ma Dalena. Halting her work once again, (Y/n) too was the tiniest bit curious.

In truth, magicians failed to interest her, not that she had an opportunity to see them much anyways. But all those in Etére knew to be cautious of two particular magic wielders: La Bruja de Bruez, the Witch of Bruez, and Reyes Ladrón de Corazones, Reyes the Thief of Hearts. The pair were like the local boogeymen, tales of their horrendous deeds spreading and becoming bedtime stories for children in order to scare them into good behavior.

Ever since her youth, she heard stories of La Bruja de Bruez. It was said that she was a wicked woman who’s lived for over a hundred years. A slight against her is taken seriously, and she curses those she comes across. But she was no mere fairytale. The witch has been a thorn in the country’s side for a long time, as she terrorizes the towns she visits. There hasn’t been much action taken against her, because she’s so powerful that hardly anyone stands a chance and she’s so elusive. Besides, the royal family don’t particularly care if the witch curses a random citizen every month or so, as long as they don’t have to risk pawns in their own arsenal of magicians just to take her down.

Only a few years ago, a second magician with fearsome spells and a horrible reputation, appeared. Reyes Ladrón de Corazones, or more commonly known as Reyes, was another brujo many feared, although not as much as his counterpart from Bruez. There were rumors, yes, but they were more lighthearted with little evidence to ever back up the claims. While the Bruja de Bruez spared no one, it was said that Reyes chose to pursue only young beautiful women. If you asked around town, half of the population would consider him a threat, while the other half would giggle and whisper about his rumored good looks. Maybe that’s how he lured them in? With charms. Either way, he was a cause for concern. It was said that at a young age after abandoning his position as apprentice under the royal sorceress, the most powerful known magician, he not only challenged her but won and stripped her of her powers. Of course, no one can neither confirm nor deny it, as the king kept a tight lid on the situation and supposedly those who approach Reyes meet a terrible fate. But his abode was proof enough of his sheer strength. It was like a castle, a temple wandering on mechanical legs, rumored to not only be fueled by magic but also made of it.

Through the mist and low hanging clouds, just over the rolling hills on the horizon she could make out the distinct shape of a temple. A magnificent temple that appears so small from so far away. But she knew that it was a beast, a titan wandering the wilderness where very few dared to venture. It prowled around on its mechanical legs, spewing black smoke as the only trail it left behind. Reyes’ moving temple disappeared behind the clouds, seemingly vanishing from sight. Onlookers within the tailor shop could only awe and wonder aloud what the brujo was like, what was true and what was not, their minds creating horrible fears and outlandish fantasies that would take root as rumors.

Lowering her gaze back to her work, she resumed once more, but the rumors overpowered the hum of her machine until their words reached her. The other tailors proceeded back to the front entrance, marveling about what they just witnessed. Was he hiding from soldiers practicing their flights just outside the town? Did you hear that he literally steals the hearts of women, but only beautiful ones? Someone said that a pretty waitress on the other side of town had her own heart torn out and stolen by Reyes just last week!

The door was shut and she was alone, left with her work and the noise outside. Swiftly she worked, able to repair tears and wears with ease and create other things. Able to get lost in the work for much longer, until she felt the ground shake and the screech of another whistle. The afternoon train. It’s smoke covering her window once again. It was getting late already. Not wishing to waste the rest of the day by continuing work or go to bed with a book she had already read twice, she switched off the machine and organized all the tools back into their places. Brushing off all stray strings from her dress, she then rearranged her completed work thus far and prepared to have a different kind of day.

Today, she would try to make it a can be sort of day. Even if it meant just visiting a close friend like Lía at the bakery. Just putting out the effort to go out today was more than she was usually willing. Although wishing it would be something special, a proper can be day without even trying, was like wishing to be acknowledged by a person you admire but never once talked to, it was much like winging it on a test without studying and praying you would get a perfect score even though knowing that it’s almost near impossible. But it isn’t statistically completely impossible, so you cling to that thin shred of hope that’s as taut as a piece of string.

The whirring of small planes buzzed overhead, the flying machines brandishing their flags like the proud and numerous soldiers. On nearly every home and business, there was the flag hanging over the door, a symbol of patriotism and support of the war effort. (Y/n) quickly crossed the streets and reached the trolley station that would take her further into town. Right now there was not a soldier in sight, but that was sure to change the closer to the center of town she got. She only prayed that there wouldn’t be any trouble with them.

The trolleys were full, people all going towards the center of town, in the same direction the planes overhead flew towards. If she had to guess, most of the people within the trolley were likely friends or family of returning soldiers. All giddy from the victory high of a major battle just won.

While watching the scenery go by, she wondered how Lía was fairing.

It was because of Lía and her family that she now worked in a tailor shop. (Y/n)’s parents had met an unfortunate end while traveling outside the kingdom. They were doctors dedicated to a good cause, determined to stay in dangerous war torn lands to heal and treat the poorest of folks. While she was busy with school and often alone but checked on by family friends, her parents were saving people an ocean away in a faraway land where Milavi’s war had spread. They had been too close to Milavi claimed territory, likely mistaken for doctors healing rebels, and were thus punished for their good deeds. With no one left to turn to, her family’s closest friend, Señor Obregón, adopted (Y/n) and treated her as one of his own.

Señor Obregón was a quiet but respectable man that spent his time either working or with his family. He was the one that taught her how to sew, knit, and tailor, after she became curious of his skills. There were two other girls, Lía and Cova, a few years younger than (Y/n), which is why she became the oldest sibling. Lía was the beauty admired all throughout their childhood and still beloved to this day. She most resembled her mother, but she wasn’t half as vain. Cova was the youngest and somehow the smartest, as she was able to quickly grasp the concepts from lessons even in (Y/n)’s class, despite being a few grade levels apart. She mostly resembled her father and his own wits. Then there was her, (Y/n), who had… whatever was left. Of course she never held any resentment toward her sisters, since they were always well behaved but perhaps a bit annoying with their squabbles. Lastly, was Señora Obregón, Rosita, who she just called Tia Rosa for short, was never rude or dismissive to her. Tia Rosa was actually very outgoing and talkative, but she was the sort of woman that wouldn’t be caught dead wearing something from last season. She desired the finer things in life and settled for no less, which is probably why Señor Obregón ended up in an early grave due to working himself to death just to try and afford the luxuries his wife craved.

Immediately after the funeral, while they were still dressed head-to-toe in black and their eyes were puffy from crying, Rosita sat all three of her daughters for a conversation about the future. It would be impossible for her to keep them all in school, especially considering she hadn’t worked a day in her life. However, she wasn’t cruel enough to just toss her young girls out into the streets with nowhere to go. So, she devised a plan for each girl. Cova would be able to best utilize her smarts in a challenging field full of promise, which is why she was sent to a good witch in the next town over, to become an apprentice in magic. Lía was already very popular around town, she would thrive in a social environment like the bakery on main street where to this day men constantly asked for her hand. As for her, (Y/n), she would stay here in Obregón’s tailor shop, where Tia Rosa deemed was best fit. Afterall, she did know how to carry on the business, she had even helped their reputation grow substantially as more people came in every day and profits increased. Although, she hardly had the time to spend the earnings on herself, that’s what Tia Rosa was there for. Rather, never there for. She’d collect earnings from the business (Y/n) ran and would disappear for weeks or months at a time to another town or city. But that's besides the point…

By now, the trolley she was on was near the center of town that happened to be within blocks away, the streets became crowded with people walking on foot. On roads below bridges, there were lines of military tanks rolling by. Not much further in, the sidewalks were jam packed with hundreds, upon thousands, of people. Confetti rained down, banners and flags were strung from every corner and door. Every window was occupied as citizens cheered and waved at the parade of temporary victors, a show of military strength. Soldiers in their crisp uniforms marched in unified lines, cavalry on horseback carried large flags.

As the density of the crowds increased, and the volume of cheers and the parade along with it, she felt her heart beat louder. This was too much, it was too loud, she couldn’t even think…! But she had come this far, to go back home now when she was so close would be a little pathetic. Avoiding the commotion like a plague, she decided it best to take the maze of alleyways to calm her nerves. There were hardly any people on those backstreets, just the occasional stationed soldier. Focusing her gaze on the war propaganda posters on the brick and clay walls underneath window boxes filled with colorful flowers, she pretended to carefully study them as she increased her pace from a calm stroll to a quick speed walk, examining the items as if they were the most fascinating objects she ever saw. Really, she’d rather not make awkward eye contact with the soldiers on guard that watched her like a hawk, which is why she hurried along until they were out of sight.

Now that she was alone, with the crowds and their entertainment separated from her by walls of homes and businesses, she felt relief as the once loud sounds melted into background noise. For now she could concentrate on the address scribbled out on the folded piece of paper in her hands, and her anxiety could be replaced with confusion as she attempted to navigate these small hidden paths. This was only the second time she was on this path, since (Y/n) barely had time to ever go out due to work and her own incompetence. The first was on a holiday some weeks ago when the shop closed early, which granted her a few hours to venture on the main roads to the bakery where her friend worked. This was the second time, and she’s never taken the back roads, which was why she couldn’t tell left from right here.

Just in time, she looked up from her note to stop her feet from moving, as she came face-to-face with an obstacle. It wasn’t another dead end, this obstacle wore clothing and golden pins, and had a head that could easily look down from his height and see the top of her hat. Immediately she stiffened up and took a step back, hesitantly forcing her eyes to look up at the smiling soldier that casually leaned against the wall.

The young man only appeared amused as she jumped a step back in surprise. (Y/n) noticed that delighted sparkle in his eyes, as if her skittish self and startled reaction was his entertainment for the afternoon. Before she could open her mouth to mutter an apology and force her head down to continue ahead, the man leaned just a few inches closer to get a better look at her face hidden by the rim of her colorfully embroidered sun hat. “Huh, just like a mouse. Are you lost?”

A mouse… A skittish field mouse. Would that then make him a rat or a predator? Holding her tongue so not as to speak her mind, she merely shook her head. Offending a soldier would not be good. Not that she had the confidence to say the quick comeback that came to mind anyways. “No… I’m not lost.” That was a lie.

The young soldier persisted, refusing to move off the path as he continued to block her way. “You look lost. Say, what do you say to an invitation to tea? Afterwards, we can go over directions and escort you to where you’re heading.” Even his partner in patrol, an older gentleman, also a soldier but likely more experienced by at least a few years, moved from his post and approached in curiosity.

As the second man stepped closer, she could distinctly hear his polished shoes tapping in a steady rhythm as he stood beside his friend. Her own heart rate easily outpaced his steps, and it wasn’t increasing due to excitement, it was due to growing unease. Yes, she knew rationally that these soldiers likely meant no harm and merely wanted to flirt, but her mind could only conjure up the worst possible scenarios as she reminded herself that they outnumbered her, they were stronger, and they had their long firearms strapped to their backs. Keeping her head down, she replied, “Thank you, but no. I’m supposed to be meeting up with someone.”

Just like the first did, the second soldier bent down a bit to peer at her features. Just like his accomplice, he wore an amused smile as he shook his head and remarked. “A mouse? That’s not very nice. Don’t worry, you’re much better than a simple little mouse.”

Rolling his eyes, the younger soldier only continued, “If you’re old enough to drink, we can go to a bar if that’s more your style? Do you live around here?”

This was getting ridiculous. Did they never learn to accept rejection? No means no, even children could comprehend that. But for now, she was at their mercy, no one would come to help her here. It would be up to them to decide she was no use for any fun and let her go, or continue to persist for their selfish desires. “No. Please let me pass.”

Barely phased by her firm reply, the younger of the two turned to his partner and scoffed, “See? I told you the girls don’t like the beard you’re growing out. It scares them.”

It’s as if her plea went through one ear and out the other, not swaying them in even the slightest bit. The older gentleman merely rubbed the stubble on his chin, “It makes me look better. Besides, I’m sure she doesn’t mind. She might even prefer a man with facial hair.” Actually, the word gentleman did not describe him well.

In that moment she was wondering, would she truly risk it all just to snap back in reply? It must’ve felt so satisfying, but was it necessary? Later, would she come to regret her decision or revel in it? Would she seriously use this sprouting frustration, minimal not only compared to her current fears but also in the grand scheme of things, to temporarily push past her anxiety and say something…? Probably not. As annoying as these men were, like the constant buzz of a pestersome fly, they hadn’t caused any harm except to waste a bit of her precious free time.

“Ah, there you are, mi corazón. I was worried about you.” A smooth and silky voice interrupted.

#yandere #yandere guy #yandere story #yandere male #yandere imagines #yandere oc #yandere x darling #yandere x you #yandere x y/n #yandere x reader #yandere writing #yandere fic #yandere oc x reader #yandere oc x you #yandere oc x y/n #yandere original character #how to steal a heart

717 notes · View notes

Last Seen Blogs

our-future-is-feminist-blog

Feministing

obsessedwithmothers

Tony

candebravo13

Candelaria Bravo

misty0104

无标题

gwarp

Run to You with All I Have