#bill c 10 | Explore Tumblr Posts and Blogs

dante-mightdie · 23 days

Note

A small req? Wheree we're a milf and our incel son eventually joins the military (you choose if he joins the military or meets at a bar I ain't gaf) and meets Ghost, 141 whatever. He brings Ghost home to his basement room(or the 141 bb do whatever you want) and ghost is surprised n shi that we this incel momma when we com with snacks or something like 'get outta here mom you're embarrassing me Infront of my new friends!" Is our sons reaction or sum. And ghostie pookie excuses himself up to the bathroom to sloppily makeout with us 🥺

nobody look at me i’m foaming at the mouth

c/w: simon is kinda strange but in a weird sexy way, mentions of misogyny, talks of sex must no actual smut, housewife kink kinda

it’s no secret that your son is a nasty little misogynistic shit. everyone on base has had the experience of standing next to him on a night as out when he gets a drink thrown in his face by whatever girl is he was chatting to

they’d been there every time he dogs out in front of everyone when you visit him on base. watching your eyes well up when your son tells you that he doesn’t like your new haircut or dress, that you’re too old to wear stuff like that

simon tried not to judge, appearances can be deceiving. perhaps you’re not all smiles and baked goods, maybe you’re an awful mother behind the scenes. he really tried. until he found out the real reason your son treats you like shit…

“she made my dad leave. he told me after they divorced that she wasn’t giving him what he needed, that’s why he had to go and get it somewhere else.” your son finally admitted one night after going through half case of beer

simon felt his hand tighten around his bottle as your son continued to ramble about how you were always busy with shit jobs. waitressing, cleaning or retail. he spent most of his childhood never getting all the latest toys and clothes because you could never afford it, too busy catching up on late bills to make sure there was a roof over both of your heads

“she’s so selfish.”

‘fuck being non-judgmental’ simon thinks. this kid doesn’t know how lucky he is. having a such a lovely mum like you, never losing your patience with your son even when he treats you like dirt. always trying to greet him with a hug or kiss just for him to push you away. begging him to call when he’s away just so you can know your boy is safe :(

“sounds like your mad at your mum for being the one that stuck around, lad.” price buts in, shaking his head with a small laugh.

you had been a topic of discussion the night after your first visit to the base. the product of a few glasses of bourbon shared between simon and john

“did you see the new recruits mother? fuckin’ hell, if I were 10 years younger I’d be all over that.” price admitted, adjusting his hips as he leaned back in his desk chair. simon let out a small grunt of agreement, having thought about this since he first laid eyes on you

simon had come to the conclusion that you both just needed a good man in your life. your son needed a father figure that would actually stick around, he could tell by the way your son looks up to him and the captain, eager to impress them

and you. oh, you. with your sweet, simple dresses and adoring smile. simon wishes you’d smile at him like that. all that cooking that your son lets go to waste could go to him instead. you could cook his favourite dinners for him and take care of his house whilst he’s away at work, whipping the boy into shape. teaching him every thing that your sack of shit ex-husband clearly didn’t

he’d be so good to you too. he knows it’s been a while since you’ve had a man to take care of your needs. he sees the way you nearly drool as you watch him running laps around the field, tatted arms on display. he’d spit you open so nicely on his cock and he knows you’d take him so well too, your pretty cunt would he creaming all over him

he soon takes advantage of this knowledge, subtly convincing your son to invite him over to your home on leave. dropping some story about how his flat is getting some work done and that he only lives 20 minutes from you both. your son was quick to offer the lieutenant a place to stay, telling him that he could take your room. that you could sleep on the couch for a couple weeks.

‘we’ll share the bed.’ simon thinks, but he doesn’t dare say it to your sons face. can’t have this little brat meddling with his plan

his arrival is clearly a surprise to you from the way you rush about shortly afterwards to start scrubbing the house top to bottom, rattling off apologies about the state of everything. simon quickly shuts down any offer of him taking your bedroom

“keep your bed, love. I’ll take the sofa.” he grumbles, sipping the tea that you made for him whilst your son rolls his eyes from the other side of the kitchen

he can see the way your eyes look at him with this longing. he knows it won’t take much to get you into bed. poor thing that hasn’t had anyone to look after her for years

he spends the next few days proving to you that he can provide. helping you carry anything heavy, drying the dishes after you’ve watched them, fixing the handy jobs around the house

you’re constantly praising him, focusing your love and attention towards him instead of your ungrateful son and the boy hates it. which is just the cherry on top, simon thinks

“your mother is so lucky to have a son like you. you must help her around the house all the time!” you coo, fidgeting with your skirt

“my mum passed away… jus’ me left out of the whole family.” simon admits, solemnly

“you poor thing, I’m so sorry. you’re welcome here anytime…” you gasp softly, placing your delicate hand on his arm and squeezing the muscle of his bicep gently and simon is ashamed to say it made his cock twitch against his thigh

“thank you, sweetheart… such a lovely girl, aren’t you?” he smiles behind his mask, reaching over and wrapping his arm around your waist. he pulls you against him, putting one hand over your mouth to keep you quiet as he hoists you up onto the kitchen counter

he squeezes his large frame inbetween your spread legs, leaning forward to look into your widened eyes

“been so good to me, love. taking care of me. such a good mum to your son, ya just need a good man to be a wife to, don’t you?” he says, pushing your skirt up your lap and revealing your thighs to him

he feels your thighs squeeze his waist, an aroused reaction from you. your body slumps into his with a natural submission that makes his cock ache. he lowers his hand and hooks his mask over his nose, revealing the scar running over his lip

“s’alright, darling. ‘m here to look after you now. me, you and the boy will be a nice happy family, yeah?” he says with a small smirk. leaning forward to mould his lips against yours before you can answer

he hears the little whimper you let out as you kiss him back, a little sloppy and inexperienced from years of being single, too busy with your son and work to date

but that’s okay because simon’s here now. ready to claim his family.

#mw2 #cod mw2 #ghost #simon ghost riley #simon riley #simon riley x reader #ghost x reader #simon ghost riley x reader #ghost simon riley

2K notes · View notes

hellsitegenetics · 2 months

Text

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

#hellsitegenetics #faq #intro post #flowers #plants #requests #birds of paradise #asks #remember to keep checking back!

1K notes · View notes

freezenet · 2 years

Text

Documents Confirm That Lobbyists Successfully Got User Content Regulated Under Bill C-10

Documents have re-confirmed that user generated content was being regulated at the behest of lobbyists when the bill was known as C-10. (more…)

View On WordPress

#Bill C-10 #Bill C-11 #Canada #lobbyists #user generated content

0 notes

sukunasteeth · 28 days

Text

Wrestle Me

Tokyo had reached record temperatures that day. The sun was roasting the city, every street was a mirage from the bending light of its shine. The weather recently had been sending everyone either inside or to the nearest water source.

Yuji had gone to the beach with Megumi and Nobara in a futile attempt to escape the heat that had Japan in the sweaty palm of its hand. They had offered you and Sukuna a spot on the railway car there, but you knew that Sukuna was too exhausted from his recent missions to do any sort of going out. Not to mention the draining effect of the heat stacked on top of that. You were in the mood to just enjoy each other's presence.

The two of you were sheltered away in the darkness of his bedroom, lying sprawled out across the floor in front of his small rotating fan. Sukuna and Yuji never turned the A/C on. Since they had moved into their own apartment, the brothers had become rather stingy when it came to the bills. The air didn't start up until the room felt like a sauna, and it turned off much too soon to give relief.

Sweat continued to drip down the both of your spines, but Sukuna didn't seem to mind it. He was enjoying the peace of his day off, dressed against the heat in nothing but his boxer briefs and a tank top. He had his head resting in the cushion of your lap, his eyes were transfixed on an old leather notebook that he had stolen from one of the professors a few days ago. It was in a language you hadn't taken at the academy yet, but Sukuna tells you it was early notes on jujutsu from the old world.

You had been scrolling through your phone, occasionally showing him something you found amusing or anything that reminded you of him. He only gave you a reaction to maybe 10% of the material, but it was fun to see him roll his eyes, or scoff and wave your phone away.

The longer you remained in the same spot,however, the sweatier you felt and the more frustrated with the heat. You tried not to squirm under Sukuna's head, remaining as still as possible as though he were a sleeping animal taking refuge on your lap. Boredom, however, eventually pulls the last straw that has you stirring.

An idea comes to mind.

Sukuna glances up at you, as though he expects you to show him something else on your phone, but instead his attention is caught by the mischievous glint you feel twinkling in your eye.

"Wrestle me." You beam at him.

It was somewhat of a joke.

Compared to your boyfriend, it was clear who would win in a pinning tournament between the two of you.

Sukuna, who enjoys kickboxing in his spare time. Sukuna, who has never missed an opportunity for a fight in the decade that you've known him, who could dead-lift your torso with ease if he so desired.

Sukuna, who has never touched you with anything but heart wrenching gentleness.

His eyes widen at your command, the notebook he had previously found so interesting has been completely forgotten. He seems to catch the drift of your lack of entertainment, and quickly plays along. His surprise melts into an amused little smile.

"Oh yeah? Think you got a chance, kid?" He taunts, placing the book beside him. His attention now fully focused on you.

You snort, you were only a year younger than he was, but he loved to emphasize it when he could. Sukuna mistakes your noise as a scoff and cocks a daring brow at you.

You love when he’s in a playful mood.

"I could take you any day." You tease. Part of you is running for the hills inside, but another part is having fun with the big bad wolf. That was the constant state you were in with him. Sukuna didn't even have to try and he always had your heart racing.

Sukuna makes an impressed noise, "That, I'm well aware of. I don't know about in a fight, though."

You groan at his joke, shaking your head in disappointment, but Sukuna grabs onto your chin before you can get even one turn of your head out.

"Let's find out."

Ten minutes later, you're drenched in twice the amount of sweat as you were before, but Sukuna has barely lost a drop. He's got you twisted like a pretzel beneath him, holding your limbs in just the right way so that you're completely incapacitated in his hands.

Your first mistake was thinking Sukuna knew how to play-fight. The only person he had been remotely close with in your childhood was his twin brother, and the two of them had often "wrestled", but it only ended when one of them had blood dripping out of their noses. You learned early on not to question it. Having two boys as your childhood best friends had you turning your gaze from a lot of things, in fact.

The only thing you questioned now, was how you were going to get out of your current predicament. You were sure Sukuna was having a blast practically hogtying you with his hands, and now he knew how easy it was to get you in this position. It was a double whammy that would surely effect you in the future.

"Did you really think I'd go easy on you?" The weight of his chest presses into your back as he leans over you, sending hot breath over your neck. "How cute."

"Okay, okay! I give!" You whine, trying to wriggle out from beneath him. You had to admit that it was getting slightly painful, but Sukuna was well aware of your pressure points and where to stay away from. You still had one last trick up your sleeve, however.

Satisfied with your surrender, he nips at your ear with his teeth before he slides off of you and relinquishes his effortless grip. Before he can fully turn away, however, you're leaping onto his back like a monkey and tackling him into his mattress. It was a dirty tactic, but you had been wrestling your childhood best friend Yuji since the two of you were in elementary school, so you were no stranger to tricks of the trade. Especially the feign defeat card.

He blinks up at you. It was a difficult task to take Sukuna off guard, but you had accomplished it.

"Sucker." You playfully stick your tongue out at him, blowing a raspberry. Inside your chest, your heart is racing like a hummingbird’s wings. It’s almost like Sukuna knows this, because even though you’re the one on top of him, he’s still looking at you with an amused grin- unaffected by your change of position.

"You have a higher pain tolerance than I thought you did." He notes, tilting his head to the side like he's considering something. "What can we do with that new information, I wonder?"

It was another intimidation tactic. A good one. It had chills running down your spine. But, you weren’t going to let him win so easily this time. Suddenly, you were interested in how far you could push him, as well.

"Come on 'Kuna," You chide, your nose is practically touching his- a rabbit pressing against the snout of a hungry wolf. "Can't take defeat, my love?"

"Oh doll," His voice is a husky drawl, rough hands slide their way from their resting places on your hips to slip under the hem of your shirt and brush the skin of your waist. You try to contain your shiver. "You're playing a very dangerous game."

One last wave of confidence sweeps through you as you lean down, just like he always did, to murmur lowly into his ear. "And you're losing."

That did it.

Sukuna grabs onto your waist so quickly, you barely have time to register it before he loops his leg around your knee and easily flips the two of you back to your original position. You're giggling beneath him as he gathers your face into his hands, pressing calloused fingers into your cheeks. You've gotten under his impenetrable skin. You didn't know it, but you always did.

No matter how strong a man is, he will always lose to the woman he loves.

Sukuna was slowly starting to accept that.

#jjk #sukuna #sukuna x reader #sukuna x you #sukuna x y/n #jjk x reader #jujutsu kaisen #fluff #little something something #is it obvious how obsessed I am with the thought of him pinning someone down?#makes my heart go bingabangdingdang #also can we talk about this manga panel #my writing

814 notes · View notes

thot-of-khonshu · 1 year

Text

Say You Love Me (Joel Miller x f! reader)

1K Celebration | Masterlist

Part 2 - Coming Soon

Pairing: Joel Miller x f! Reader (pre and post outbreak)

Rating: M (18+, explicit smut)

Word Count: 6.2K

Summary: Red wine. Rage. Regret. Reunions. When pride separates you from the man that got away in 2003, you thought you’d never see him again. But when going to tie loose ends for Bill and Frank, you see him and a young companion.

Content: TLOU spoilers, slight changes to the story, age gap (~10-15 years), multiple sex scenes, dirty talk, unprotected p in v sex, fingering, cowgirl, creampie, oral (f), rough sex, alcohol consumption, grief, violence, mentions of death, the musical stylings of Fleetwood Mac

A/N: Happy TLOU day! This initially started out as a creation for my 1K celebration to "Maroon" by Taylor Swift, but as you can see it completely manifested into its own short story. Thanks to everyone for being patient for my writing. I hope y'all enjoy!

Every time you have a dream about everything before, you try to document it down in your ratty journal with your pen running on empty. Everything seems to run on empty.

You dream of your former life less and less as the years go by. It’s a hazy memory and you can’t remember how we were able to live on such luxuries and be comfortable and be happy.

You dream of the man with his large hands and warm smile on your living room floor, warm with wine.

Red lips. Red cheeks. Red wine.

The bitter taste of cheap red blends on his tongue.

Sticky Austin nights where you’d start outside in the thick humidity but end it in ice cold a/c. It never mattered anyway, Joel always ran hot like a furnace so you’d have to settle yourself in between thin sheets.

You met through Megan who was dating his younger brother Tommy, a Gulf War vet that was more serious about holding his liquor than he ever was fighting in the war. One night when he’d had too much to drink, Joel, the responsible one, picked him up. A sleeping baby girl in the backseat.

He barged through your front door. “Tommy, what the hell are you doin’ bothering these–”

He stopped as soon as he looked at you. From that moment it was like the two of you had this instant communication. He didn’t have to say anything, all you needed to do was look into his eyes.

“HI there.” He smile at you, that warm smile with that dimple on the side of his cheek. “I–uh–hope you’re not the girl my little brother’s been botherin’ “

“That would be my roommate.” You smile back at him. His smile grows even wider and you can’t remember the last time you had such electric eye contact with someone.

Tommy bursts through the door, coming out of the bathroom with Megan hoisting his large frame.

“Please get him in bed and away from vodka.” She hoists Tommy onto Joel.

“Tell me a bedtime story.” He slurs. Joel looks at you apologetically as he turns to bring him to the car. You and Megan exchanged a silent look as she could pick up on what was going on and she nudged you to go after him.

“Hey wait!” You call out, you try not to focus on his broad back muscles. “I think it’s clear Tommy needs some chaperoning whenever he comes over here.”

He furrows his brow in confusion at first. “Y’know, his big brother to come over and make sure he’s doing right?” ‘You smile.

“Just say when and I’ll tag along.” Joel winks at you.

He was always a man of his word.

The next weekend, Megan invited Tommy over and suggested he bring Joel along as well. Tommy came barreling in like a freight train and Joel laid back to greet you at the door. He held up a six pack of beer.

“I didn’t wanna come over empty handed. It’s all we had in the fridge.” Joel said.

“Yeah, Joel wanted to come right over after workin’ tonight. Even let Sarah stay at a friends house, ain’t that sweet?”

“Alright, Tommy. I still clearly gotta babysit you.” Joel rolls his eyes.

“We’ll, thank you for the beer, Joel but we’re more wine drinkers here. Do you like red blend?”

“I’ll drink whatever you give me.”

————————

A few hours later, Megan and Tommy have gone off on their own adventure. You and Joel split the bottle of wine between the two of you and despite him stating he could handle his liquor, his large body was sprawled out across your living room floor with his empty glass tipped over.

“Miller, I thought you said you could handle your liquor.” You grin at him from the couch.

“I usually can. I don’t know what was in your roommate’s cheapass screwtop–”

“Hey–don’t blame the alcohol for why you’re currently on our living room floor right now. And while she can’t defend herself.”

“You saying I’m a sloppy drunk?” He leans closer towards you and you observe the patches in his beard.

“I’m saying I don’t wanna hold your hair back above the toilet.” You grin at him. He looks at you, hard. You feel your heart rate rising and the moment is almost too much to handle. You need to ground yourself with something, anything. You turn to your vinyls.

“You like records?” You ask him, moving towards the shelf.

“Didn’t know people your age still listened to them.” He called out. You scoffed.

“I’m not that much younger than you. Besides, this is timeless. CDs might come and go like 8 track players, but these? These are gonna last through everything.” You hold up a record and he nods in approval, Fleetwood Mac’s self titled album. You flip to side two and the sounds of “Say You Love Me” flood the living room.

You join him on the living room rug and close your eyes, listening to Christine McVie’s voice.

Have mercy, baby, on a poor girl like me

You know I'm falling, falling, falling at your feet

I'm tingling right from my head to my toes

So help me, help me, help me make the feeling go

“God, her voice is just so ageless. I know everyone always looks at Rumours as their best but this one is just cla–” Your breath hitches when you feel his hand brush your cheek. You feel the warmth of his face coming closer and closer as you finally open your eyes to see Joel ready to kiss you.

But he forgot his wine glass in his hand as it spilled onto you with the remainder of his alcohol.

“Shit, shit.” Joel stumbles up and looks around. “I am so sorry, I can clean that up.”

You get up to him walking around your kitchen, looking for paper towels. When he turns around, you put your hand at his chest and look up at his beautiful brown eyes.

“Why don’t you help me find a new shirt?” You ask him in a low voice. His jaw is slacked as he slowly nods.

“Yes ma’am.” He follows behind you, taking your hand as you lead him into your bedroom.

One thing about Joel Miller? He takes his time. He takes his time giving you soft, syrupy kisses and drawing the anticipation by pulling at your lip.

He builds you up by meticulously touching every part of your body while peeling off your clothes, grabbing at the swell of your ass, the dips of your hips and pulling at the back of your neck. He wants to make you feel amazing.

Once you’re naked, he lays you on top of your bed and peers up at you as he pulls your knees apart.

He drags the tip of his tongue over your clit, savoring your taste as he moans in relief. You tremble against him, dragging your hand through his dark curls as he begins to put his full mouth into you, his tongue entering you as his nose brushes your clit. You can’t help but squirm on top of him, rocking onto him as he moans below you.

“You taste so fucking good.” Joel gets up for air briefly and dives back in. Kissing at your inner thighs, he takes one of his thick fingers and pushes one into you, your body instantly tightening around it.

“So wet for me too.” Joel moans. He moves in earnest, putting his mouth back onto your clit and the pleasure is all you can concentrate on. He adds another finger, getting up to watch you squirm at his fingers as your wetness fills the room from his methodical thrusts.

You feel yourself tense, your muscles tightening around him as your pleasure intensifies and your breaths go shallow. When he curves his fingers and moves his mouth back to your clit, you short circuit completely.

You writhe on top of him as you cum, moaning louder than you’d expected and hoping Tommy and Megan don’t hear anything. Your shallow breaths fill the room and your eyes are shut. Pleasure still pulsates through your body as Joel is now on top of you, kissing at your throat as you feel his heavy, still clothed cock on top of you.

When you release it, it springs from his boxers, thick and dripping at the top with precum. You rub the tip of his head as he lets out a hiss of air at your throat. You bring the liquid to your mouth and savor the taste.

“I hope this ain’t too forward,” His hands cup and knead at your breasts. “But I’m desperate to feel you.”

“Please” You beg. “I have condoms but I’m also on the pill. Whatever you need, just please don’t stop.”

Joel lines himself up against you, rubbing his thick cock against your soaked walls. His eyes don’t leave yours as he gently enters you. It’s soft at first, him trying to fit in every single inch while also not cumming immediately while he was inside of you. You gripped him, wet and tight.

During the pause when he’s finally deep inside of you, you both are riddled with heavy breathing. Your kisses are slow but hungry. You start to move below him and that’s what drives him wild.

He begins to pump faster inside of you, rubbing himself against your swollen clit. You don’t think you’ve ever had something so intimate before. You’d had sex, but this just felt like something out of another dimension. Joel was entirely focused on your pleasure, hungrily pawing at your body as he rocked on top of you.

When circled his fingers on your clit, you knew you were going to cum a second time. You grabbed at the bedsheets, another climax of pleasure making you arch.

After you came twice, Joel was needier. He raised your leg so he could get into a deeper position and you had felt so incredibly full. He fucks you at a rapid speed and feeling you convulse around him for another orgasm wasn’t helping and the room filled with the noise of his balls slapping onto your skin.

You loved that his broad body surrounded you, that all you could feel was him and all you could hear were his grunts into your ear. His hips began to stutter as he filled himself into you, emptying himself as much as he could into your tight walls.

You don’t realize how badly you were gripping him until you rub his back, his head on your chest and you feel the claw marks. His breathing is labored, still feeling the impact of your sex as you bury your fingers into his curls.

“This should go without being said,” Joel looked up at you. “But I would really like to take you out sometime.”

You weren’t going to say no to that.

—---------------------------------

You wake up, the motion of the car rattling you.

“Morning, sunshine.” Megan smiles behind the steering wheel. Before everything, Megan was terrified of driving and now you’d catch her dead before she’d stop and pick someone up, choosing to run them over instead because they were likely a hunter.

And wouldn’t you rather kill than be killed?

It all happened so fast but so painfully, hauntingly slow at the same time. In one night, civilization as you knew it had ceased to exist. Megan came home, shaking, covered in blood telling you you had to leave tonight.

You drove until you ran out of gas. You walked until you were able to rob some idiots that tried to give you a ride and take advantage of you. And that’s how you ended up at the Philadelphia quarantine zone. Somewhere far away from Texas and the sticky heat and long carefree nights.

There were a lot of men like that in this world, who thought they could take things from vulnerable women. Little did they realize, the vulnerable women didn’t make it. Not all of them were like that, though. Bill and Frank weren’t.

You’d met Frank over the radio, talking over some music his partner BIll was playing as some sort of signal. Frank was incredibly kind, warm and worldly in a world with almost nothing left. He’d offered to trade things between you and Megan’s QZ and the Lincoln town he lived in with Bill.

And Bill? He was…Bill. He wasn’t exactly kind and open to strangers, but he knew the both of you and trusted you after all of these years. Whoever Frank loved, he loved. So when you’d heard the 80’s distress signal coming from the radio, you’d decided to risk the trip and make sure everything was okay.

When you had gotten to the gate, usually coded, it was wide open and the two of you exchanged looks in surprise. Without having to say a word, you grabbed your handgun out of the glove compartment. Megan pulled up to Bill and Frank’s, seeing their door open.

The two of you had tried to get out of the car as quietly as possible. Crouching behind the car as you heard the crunch of footsteps.

“It could be Bill and Frank.” Megan whispered.

“When is it like Bill to ever keep the gate open?” You asked her. You heard the crunches coming closer.

The two of you signal to step out at the same time, adrenaline pumping through your veins. After all of this time, it never gets easier doing this.

Before you could pull the trigger, you hear a HYAH and see a small figure jump out towards you.

Jesus, it’s a child. Before she could try to stab either of you, Megan pins her down to the ground, knocking the knife out of the way and the kid squirms under her.

You see another figure jump into frame to defend the kid. A man with grey hair, a broad frame and a handgun. The two of you are in a standoff but something feels off. You know you’ve been to Lincoln so many times before but something about this feels entirely too familiar.

“Do not hurt the kid.” The man drawls, looking down at her and then back at you. “She didn’t—“

And then his eyes meet yours. Still as piercing as you remember. And you realize that you’re standing in front of Joel Miller for the first time in twenty years.

“…Joel?” Megan says something first.

“Hi Megan.” He looks at her briefly to acknowledge her, but he looks back at you. The gun still in his hand, gripped tightly.

“We’re not looking for any trouble.” Joel says. “We’re here to check on our friends.”

“Bill and Frank.” You finally say to him. “Our friends.” The look of confusion on his face is apparent.

“You two knew Bill and Frank?” He asks.

“How about ‘it’s good to see you two alive after all this time’, Joel?” You ask him, exasperated. You were tired of holding this gun, your hands were getting clammy and you had no intentions of shooting him. Even after all this time, you knew he wouldn’t shoot both of you either.

Megan lets the girl up and she runs to Joel. She puts her gun down and you motion for him to follow suit. He looks at you for a long hard moment, his eyes scanning your body as you feel yourself redden with embarrassment, feeling fully exposed in front of him and looking like apocalyptic shit. He sets his gun down as you follow suit.

“I think y’all should come inside, then.” Joel said. “Some things you need to see.”

You follow Joel and the young girl-you find out her name is Ellie- into Bill and Frank’s house. You go to the same place that Bill and Frank would keep supplies, notes or any clothing that Frank had to spare - the second cabinet to the right. That’s where you see their note.

Frank’s condition had worsened over the past few years. A degenerative disease you weren’t sure exactly what it was, but when he asked for a wheelchair from the Philadelphia QZ you were both more than happy to bring it to them. You knew it was only a matter of time before he went. When Bill decided to go with him, you weren’t surprised. Despite his exterior, everything Bill did was for Frank, the man he loved.

You couldn’t remember the last time you had felt that kind of devotion to someone until today.

The four of you sit at the table. An awkward silence between the four of you, the only sound being Ellie rocking her chair. One of the legs must’ve been broken and Bill hadn’t gotten to it ye–

Oh. Right.

“I didn’t know Bill and Frank knew anyone else besides us.” Megan said.

“Likewise. I guess that makes sense.” Joel said, his eyes still on you.

You agreed. “Frank, I’m sure, would’ve loved the extra company. More people to host garden parties and socialize for but if Bill had anything to do with it–”

“He would’ve threatened to kill us.” You say in unison.

“Trust me, he made sure to make us aware if we tried anything he had his gun right on the table the first time we met.” You said.

“His reputation precedes himself.” Joel said.

The two of you are silent for a moment. Megan and Ellie looking between the both of you.

“Am I missing something?” Ellie asked, pointing at the two of you back and forth.

“And I think that’s my queue to look around for some food. Maybe we can have some dinner, figure out what the fuck we’re doing and then call it a night before we go our separate ways, huh?” Megan quickly said.

You sit at the table with Joel and Ellie, completely silent as Joel is now looking away from you and Ellie keeps looking at the both of you.

“You can cut the tension with a knife, huh?” Ellie whistles.

“Ellie, go take a shower. They’ve got hot water.” Joel says. She quickly gets up and runs down the hall.

“You don’t have to tell me twice. But after I take one, you’re going in because man. And if we’re gonna be around company…”

“Ellie.” He raises his voice into a stern inflection you haven’t heard since…

Where the hell is Sarah?

—-------------------------------------------------

Later that night, you’ve hunkered down with Megan, Joel and Ellie. The four of you have rabbit along with some vegetables and rice from Frank’s garden. The tension has subsided as you’ve gotten into the wine cabinet. That’s when the memories flow back. The three of you share stories from Texas, your old lives that seem so long ago. Reminiscing on how things used to be as Ellie interjects with a question about the old world every now and then while reading a comic she snagged from Bill’s basement.

Megan eventually stretches her arms up. “Well, I’ve been drivin’ all day and I’m exhausted. I’m about to hit the hay.”

“Well I am gonna finish reading this in peace and quiet so I can read about this alien’s guts spilling out without interruptions. Goodnight! You kids have fun!” Ellie grins.

Megan gives you a look etched in worry before she heads to the stairs. You roll your eyes at her because you can take care of your goddamn self. You have been for ages.

You hear the footsteps go upstairs as you and Joel sit across from each other at the table. It’s like a lockbox with feelings you hadn’t had in years starts rattling in your chest, a monster of them waiting to come out and erupt.

You look over at him, his hair slicked back from his shower, grays prominent in his hair and his beard. The swell of his lips was still prominent and had the ability to drive you crazy.

“Bill and Frank.” You say to him, hoping to silence the voices in your own head.

“Bill and Frank.” He repeats, his hands fidgeting on the table.

“So, uh, I guess while we’re here–I’m gonna raid the liquor cabinet.” You head to the liquor cabinet to see if there’s anything strong enough to hold the awkward air between the two of you. You see a dusty bottle in the back of the cabinet, a red blend that looked entirely too familiar to pass up.

You bring it to the table, setting it down in front of Joel. He looks up at you and shakes his head in disbelief, a small smile etched across his face.

“After all this time, you still drink the same shitty red blend.” Joel says.

“Can you handle your liquor any better, Miller?” You slide it towards him, he catches the bottle with one large hand.

“I guess we’ll have to see.” He grumbles, slicing the wine bottle open with his knife.

It didn’t take long for you to feel the heaviness of the wine, sloshing in your stomach as you and Joel took turns taking long drinks from the bottle.

He tells you of Tess, his smuggling partner that had recently gotten infected while smuggling Ellie out of the city. While you admired her bravery and her sacrifice, you can’t help but feel a sting of jealousy. You’d had your partners every now and then, but none of them ever stuck around long enough. None of them ever mattered like he did.

“She was like family.” He stated.

You knew you couldn’t just say sorry. “I’m sorry for your loss” almost seems insulting these days with teh weight of how much it happens.

“Did–uh–you have any smuggling partners?” Joel asks, sipping on the bottle and looking away as if to play nonchalant. Twenty years and you can still tell when it’s all bullshit.

“I did. None of them were exactly like family but they were enough to help Megan and I get by. I never trusted them enough to introduce them to Bill and Frank.” You said.

“Oh.” Was all he could say.

“I–I couldn’t. I just couldn’t let myself get too far with anyone after–” You can’t even bare to say it. But he looks at you as if you have, like you’ve just cut part of his soul open.

“What the fuck happened?” You muttered, swigging from the bottle.

“You want the version they’re teaching kids in FEDRA school or the version we remember?” Joel asked.

“Joel…” You give him a long look. He looks at you, briefly, breaking eye contact to look anywhere else and scowl. He chooses to grab the bottle from you, taking a large gulp.

“It doesn’t matter now, does it?” He says.

“Maybe it doesn’t.” You say. “But I still wanna know. I just…we could’ve had this life.”

His brow arches.

“You and me. Tommy and Megan. Bill and Frank. We could’ve been a team. It would’ve been something.”

“Tommy decided to fuck off and join the Fireflies. Pretend like he was makin’ a difference. And then when that fell through last I heard he was in Wyoming. Megan was better off.” He stated.

“You were…” He silently mutters.

“We don’t have to talk about any of it. I’ve done some shit I regret but I did it to survive. Because that’s what we have to do in this new world. I get it. But those first few years…I couldn’t stop thinking about you.”

He takes a large drink of wine. “Or Tommy.”

“Or Sarah.”

“Well, there’s no damn use in thinkin’, is there?” Joel snaps back. You know you’ve clearly hit a nerve talking about Sarah. With whatever happened to her. Was she with the Fireflies? Was she with her Uncle Tommy? You’d hate to think it could be any worse. That brilliant, beautiful girl in any sort of trouble or not existing in this world.

By the pain in Joel’s eyes, the exterior he’d tried to mask by furrowed brows and a hardened expression, you knew. Suddenly the air felt thick.

“I’m sorry…I’m gonna step outside.” You rush to the porch as you feel the tears flood through your eyes. Sarah’s gone. You didn’t know that after all of the pain, after all of the violence, after everything this world has taken from you, that you could still feel this searing pain of loss.

You suddenly hated yourself for not being there. For not calling. For running away from things when they had gotten too serious, as if some bullshit relationship problems would matter in a week’s time in that moment. You had no idea what was about to happen.

If you’d known you would’ve lost everything and everyone in your life you had loved, you would’ve tried to hold on to the man you loved and his family for as long as you could.

But then again…maybe it was better this way that you weren’t there. You didn’t hold him back, you didn’t hold him back either. This world isn’t for the weak. Love makes you fucking weak. Joel makes you so fucking weak, 20 years later. It’s infuriating, intoxicating and confusing.

You hear the door open and footsteps come through. You wipe your tears away as you see Joel sit next to you on the bench.

“I’m sorry.” He says, solemnly. “You didn’t know. It was that night of the…”

“I know it’s so god damn insignificant now…but I’m so sorry I didn’t call.” You choke. Joel remains silent, his lips wavering.

“You didn’t know.” He repeats himself.

“So what happens now?” You ask him.

“We do what we came here to do. Get our supplies, celebrate Bill and Frank and we drink.”

“We drink.” You nod.

And drink you did.

You drank and remembered the good times, the times when he’d come over every Friday night that Sarah had a sleepover and you’d talk and touch each other until the sun came up. You drank and remember how even though Megan and Tommy had fizzled out, he had still come over to be with you. You drank and remembered the bad times, when you couldn’t handle the intimacy, you both couldn’t decide what this was.

You can’t bear the way he looks at you. You need an escape. You head to Frank’s record collection.

You dust off the record collection and see the familiar cover of Fleetwood Mac’s self titled album. You look up at Joel and his cheeks look like they sting with glee. He lets out a small giggle.

“What was it I used to tell you?” You try to remember.

“Records are timeless.” Joel says as you flip the vinyl to side B. “You were always right.”

The room floods with the faint sounds of “Say You Love Me”. It had been years since you’d heard this song but you still remembered every word. Joel extended his hand out to you and you took it, fingers stroking his palm.

You pressed yourself lightly against him, turning and looping over the hardwood floor as the music continued. Somehow, someway, you could still smell his subtle sandalwood scent.

'Cause when the lovin' starts and the lights go down

And there's not another living soul around

You woo me until the sun comes up

And you say that you love me

The two of you giggled like children as you looped around Bill and Frank’s living room. The light of the moon shone on Joel’s face and the hardened exterior of the older man was gone for a moment, and you were taken back to 2003 where that gorgeous carpenter was leaning against your doorway for the first time.

Your hand crept up his neck, feeling his peppered curls as he shivered. In response, he pressed his body closer to yours until you were cheek to cheek.

He turns to face you. His eyebrows scrunched in worry and confusion of the feelings that were rising. He never thought he would see you again, and these damn emotions kept flooding through his body.

“I showed up to your house that morning.” He whispered. “Right after we dropped Sarah off at school. My birthday.”

“So do you still think it doesn’t matter?” You asked him.

“It wouldn’t have changed anything.”

“But it would’ve given us one more good day. Before it all went to shit. And if that’s all we had, then I’m okay with that. Better than the alternative.”

You pressed your lips onto his, slow and calculated at first. You gave him one small peck to test his willingness to kiss you. You looked back at Joel and his eyes were shut tightly.

“I’m sorry–I shouldn’t have–” You try to break away but he tightens his grip around you.

“I’m just trying to savor this moment.” Joel whispers. You meet his lips again, hungrier, needier. Both of your hands exploring each other as if to make sure this was real and you weren’t dreaming it.

“Joel.” You break away as he strokes your cheek. “Let’s go to bed.”

“Yes ma’am.” He says.

It’s no shock that after all this time, you and Joel still fit together like a glove. Your body melts into his with a comfort that you haven’t felt in years. You didn’t know your body could ever feel that good again.

You didn’t think your hair, greasy and damaged when you looked at it in the mirror, could be stroked like that again. As if Joel had gotten a spool of gold and he didn’t want to ruin it, Joel petted you with delicacy as he undressed you.

Your stomach, somehow softened throughout the years with age even though you hadn’t had proper nourishment in years, being planted with soft kisses as Joel moved south, desperate to taste your pussy again.

You climb onto his lap and grip him with one hand, still as thick and as long as ever. You take a moment to look at him through the moonlight, after all these years he’s still incredibly handsome but this world took the sparkle in his eye away.

“Please, sweetheart.” Joel begs. “Let me feel you again. I’m desperate.”

That word is what makes you sink down onto him, inch by inch until he’s all the way inside. It was probably a bad idea to attempt to do this without any prep work but you didn’t care, you needed him and it filled a part of you that hadn’t been taken care of in years.

“Fuck. Fuck.” Joel rasps. “You’re still so goddamn tight.” You can feel your inner muscles clenching at his thickness and the desperate groan that he releases makes you weak.

You start to move, slowly, as his fingers dig into your hips. The pressure between the two of you is unbearable, you feel him and his full length but you’re desperate for more release. Joel’s ragged breaths concern you, though.

“Are you gonna be okay if I go faster?” You ask him.

“I ain’t that old, sweetheart.” Joel rasps under you, that damn smile back in action.

And with that, you lifted yourself up and slammed yourself into him, grinding your clit against his cock at a fast and desperate pace.

He moves forward, putting a mouthful of your breast into his mouth as his other hand rests on your lower back. You can feel the intense pleasure so blindly that you don’t know how long it’ll be until it boils over. When you contract around him and cum, Joel lets out an animalistic groan.

“Fuck, that’s it.” He moans. “Milk my cock, baby.”

You ride out your orgasm and just when you think you have time to recover, Joel begins to thrust upward deep and hard. His hips snapping up and bouncing you on top of him. He tangles his fingers into your hair, pulling you down to thrust his tongue into your mouth.

You suck his tongue and desperately cling to him, unsure how much longer you’ll be able to go without cumming again.

“I can feel it, sweetheart.” Joel groans. “Cum around my cock one more time, just give me one more. Please.”

He breaks free from your tight embrace to rub your swollen clit as you grind on top of him again, trying to remain as silent as possible so you don’t wake anyone else in the house.

You convulse and cum around him again, dizzy with pleasure as he takes one leg for leverage and begins to fuck into you harder than before. At this point, you can’t control the sounds coming out of you as he hits a spot inside of you that feels so good. His hips begin to stutter and Joel fills himself into you. He cums so hard that you feel it leaking out of you while he’s still inside.

The two of you stayed just like that for a few moments, clung to each other as you heard his heartbeat hammering inside of his chest. You peppered soft kisses onto his body as you got from on top of him. The contrast of being full and then leaving him made you wince.

Joel got up from the bed and you hesitated for a moment. Did he regret this decision? Was he going to sleep in his own bed? When he came back, he had a warm washcloth and he used it to wipe between your legs. Hot water will never be taken for granted in this world.

The two of you then snuggled up together, the situation being better left unsaid. You knew that you both had to start preparing for the morning, so instead of talking, you just shut your eyes and tried to enjoy his strong arms around you.

—-----------------

You heard a faint knock at the door and almost forgot where you were for a moment. When you felt Joel’s arms around you, his lips pressing against your cheek, you woke up with the biggest smile you’d had in a very long time.

“Good morning, you two.” Ellie shouts throughout the door. “Knock knock. Megan’s making breakfast, wake your asses up, lovebirds!”

“Don’t–don’t come in here Ellie.” Joel tries to exclaim, sleep in his voice.

“I’m fucking good, man. I’m gonna help Megan with breakfast.” You hear her footsteps as she leaves the hallway and you turn to him.

He was still there. And suddenly you were reminded of each and every time he’d stayed over, Megan making everyone breakfast as you’d talk and laugh through the previous night.

This morning was no different. It felt oddly comfortable, the four of you enjoying each other’s company even though you knew it had to end. You’d spent the rest of the morning gathering supplies but then it was time to grab your backpack out of the bedroom.

Joel was sitting on the edge of the bed. It reminded you of how things were the previous day, where he couldn’t look you in the eye. He was riddled with discomfort. In this world, you’re so used to not even having to say goodbye. That’s honestly not as painful as having to do it.

You walk up to him, giving him a long hug.

“Joel, if it’s true what you told me – if she’s immune – this is huge. It might give the world another chance. It might give us another chance.” You say to him.

“You still have so much hope for the world. That's why I will always love you.” Joel whispers. You feel your heart crack. You feel the toolbox in your chest start to rattle.

You know you shouldn’t say it. You know you’d be an idiot to say something so vulnerable and stupid in this world. But if you don’t say it, what else do you have?

“I love you too, Joel. Take care of yourself, okay? Take care of Ellie. If you ever find yourself at the Philadelphia QZ you know where to find me.” You say to him.

He presses his lips against you softly. As if to savor every moment, every feeling. Every curve and swell of your lip. He grabs at the back of your neck and you mimic him, grabbing the back of his. As if pushing further into the kiss could bring you back to those hot Austin nights.

Because you knew this was the last time you’d get a good taste of home.

You walk him out towards the car, Ellie already next to the passenger seat bouncing up and down because she had never ridden in a car before. You and Megan send them both off, his reflection in the rearview mirror never leaving your sight until the truck becomes a small blur.

“You gonna be okay?” Megan asks you, with that same look of worry she had given you the night before.

You’re not sure if you will be, but you have to forge ahead as you always do. “Yeah. I’ll be fine.” You state. And the two of you get ready to go, heading into the car back to the QZ.

“Talk about a blast from the fuckin’ past.” Megan says, starting the car. “It’s funny…I had actually heard about Nick – y'know the one that was in the Fireflies– talking about somewhere in Jackson. Small fuckin’ world.”

You lean your head up against the car window. Your thoughts immediately go back to last night.

Small fuckin’ world indeed.

3K notes · View notes

fairlyang · 3 months

Text

Roommate 🕷️

you get caught masturbating by your hot cocky roommate, and he helps you out

w/c: 4.3K

pairing: roommate!miguel x f!reader

tags: 18+ smut. fantasizing about him, thinking you're alone, being watched, flashbacks, he scared the living daylights out of you, secondhand embarrassment (I live for some cringe), confessions, rough, some spanish dirty talk (no Google translate but yes English translations), creampie, and passing tf out

notes: number three of my og fics from june and I don’t hate this one as much

You were a college student living in an apartment in New York with a cocky roommate because the rent would be too much for you alone. Miguel O'Hara.

You stumbled across his ad looking for a roommate who didn't have any kids, and wasn't a piece of shit who paid bills late. So you messaged him and said you were responsible with bills and didn't have any children. He messaged back within the same hour and asked when you can move in.

It was a little over a year since then and time flew fast. You almost never got to see Miguel because of school and work. You were in your junior year of college and were finally in a good working position with decent pay.

You weren't sure what kind of job Miguel has but it has to be something really frustrating because he comes home mad as shit super often. Maybe he works in construction? Not sure but he definitely has the build for it.

Now with finals week you were stressed as fuck scrambling to finish some work and any extra credit assignments to end your junior year of college well. You already had your day to day schedule set, classes between 8am-12pm and work between 2-10 occasionally 11.

Miguel's schedule on the other hand was all over the place and you never knew when you'd be seeing him, when he'd be home, and he still pays his half of the bills but what was the point if he barely stays here anyway?

You minded your business and the very rare times you end up stumbling across him you keep conversations casual not wanting to overstep or make him uncomfortable. But you still end up talking back to him playfully and he doesn't mind so that's been a good sign.

Tonight there was no sign of him, and you've been very stressed and touch starved all week long. You shut your bedroom curtains and jump onto your bed. You get comfortable and take off your pj pants but keeping your tank top on. You first start lightly rubbing your nipples, then pinching one and the other. You moan and feel them both getting hard. You squeeze your tits, closing your eyes.

You play with them imagining it's Miguel's hands on you instead of yours. "S-shit."

Your right hand trails down to your panties, you slowly rub your clit in circle subconsciously clenching your thighs from how sensitive it feels. You open your eyes and giggle. It's really been a while.

Your thoughts go back to Miguel and you've found him attractive since you stumbled upon his ad but it intensified when you moved in and he was around way more.

You were hanging in the living room reading when you hear a door slam and it startled you a bit. Then you hear a door open so you assumed Miguel just went back to his room so you kept reading.

You were sitting with your legs out on the sofa and you were facing the kitchen instead of the tv. Past the kitchen is a hallway that leads to your room, the bathroom then Miguel's at the end. You heard his footsteps moving around until you saw him walking straight into the kitchen with only a towel on his waist.

His skin was glistening, still wet. You widen your eyes and shook your head looking down at your book. But who were you kidding.... You bite your lip, looking up to look at his muscular back as he was getting something from the fridge. You look at how his shoulders move as he grabs something and your breathing becomes uneasy.

You quickly look back down at your book as he closes the fridge. We had an open bar kinda of island so you could look into the kitchen and he could look into the living room, which was what he was doing...

You felt his eyes on you so you try your best to stay calm, control your breathing and boom you're fine. Until he turns back around to get a snack from the cupboard reaching for the whatever was on the top shelf- he was already very tall so you knew he was doing for your viewing pleasure making you flush.

You roll your eyes but might as well- his biceps were huge, his shoulder blades were insane and your eyes began to feel very lustful. He puts down whatever he got and all of a sudden has to yawn and crack his back flexing everything for you to see. You felt like you were in a trance and couldn't look away until you heard him chuckle.

He starts turning around and you look down as soon as you saw him move and bite your lip. Shit shit shit. "Y'know you could take a picture if you'd like muñeca, they last longer." He says with a smirk on his face. (doll)

"I think I'll pass thanks." You say looking him in his eyes as you're scrunching your nose in fake disgust while he just smirks at you and walks away.

Your fingers were rubbing a little faster now slightly feeling your wetness over your panties. Damn.

You stop and lean over to your bedside table and grab your dildo. Might as well.

You move your panties to the side then spit on your dildo and making sure it gets everywhere. You grab it with one hand and use the other to stroke it. God why isn't this Miguel.

You lay on your stomach and close your eyes. You kiss the tip and start to slowly take it in your mouth. You moan and go lower until you feel the tip at your uvula. You pull away and moan using all your spit to stroke it again.

You move it to your bottom half and line it up to your wet pussy. "O-oh shit-" your eyes widen realizing how tight you are. Has it really been that long???

You take it out and start sucking again until you get more saliva and try to fit it inside again. The tip is barely in and you whine. You slowly fuck the tip into you until your pussy gets use to it and then it feels fine so you put it in a bit deeper and now you're halfway on your 8 inch dildo.

You moan and clench your thighs. You roll your eyes back and blink them open looking at how you fuck yourself slowly. You spread your legs with one hand between them fucking your pussy slowly when you push in further and take all of it. You whimper and shake a little. You grab a body pillow and place it on top of you, your empty hand grabbing onto it hard. You close your eyes and start to think of it being Miguel's dick inside you, teasing you not wanting to pound into you yet.

You decided to do some yoga in the living room while watching a video on the tv. You were in a sports bra and tight fitting shorts accentuating your curves, thighs, and ass. You didn't even hear him come in when you were doing the downward dog then switched to the doggy position unknowing you were being watched.

You did a straddle split and leaning forward for a solid minute when you heard a low whistle startling you. Your heart jumped out of your chest as you sit up and look behind you. "Were you... watching me?" You ask your eyebrows furrowed, confused as shit.

"Thought I could take some notes..." He says with a confident manner and gives you a wink making you roll your eyes.

"Acting as if you could do that O'Hara, no seas baboso." You chuckle and smirk. (Don't be stupid)

He has a smug grin on his face and you think of something. You go get into the extended doggy position earning a gulp and a quiet "chingada madre" from Miguel. (Mother fucker)

You try not to make any noises besides your steady breathing. You hold it for a good fifteen seconds before saying, "Take a picture it'll last longer."

"I just might..." he says sounding like he's out of breath making you smirk.

You fuck yourself faster and harder feeling your pussy starting to cream against your dildo. Your grip on the pillow was harder and needy, as if you were grabbing against Miguel's back. "F-fuck- mmmm god j-just like that" you moan out clenching against your dildo making you shake.

You stop for a second to control your breathing. You go back to it but at a slower pace, lovingly, and passionately. You fight back the urge to moan his name but couldn't resist. "Así Miguel- n-no pares—" you moan and feel yourself squirming into the mattress. (Just like that Miguel- d-don't stop—")

You move your hand a little faster and trying to hit deeper but you're feeling tired already. You whine as you hear the creaminess with every trust. My cream would look so good on his thick cock. "Miguel te necesito- fuckk- I need you- oh I need you so ba- bad-" you moan out shaking. (I need you)

You feel that familiar feeling in your stomach and you start to fuck yourself deeper and faster whining and moaning so much more. "Fuck- so g-good."

Your juices make even more noise and you start sweating so you move your pillow to the side never opening your eyes, for more immersion. Your left hand rubs your clit while your right is still going in and out of you. You suddenly feel your orgasm take over and you fuck yourself as deep as you can take it letting out the most animalistic moans and needy whines ever. "a-a- fuck- a-ay M-Miguel-! fill me s-so good p-pl- please-"

You completely stop, your whole body shaking, your mind all foggy and when you try to open your eyes they're all hazy so you just close them again. You calm your breathing and slowly take your dildo out. It plops out and sounds like it splashed out. Really sounds like you got filled.

You sigh and bring your dildo up to your lips softly kissing it. You then lick it and get a taste of your creamy pussy until you start to lick it off the whole thing. You get the taste of your pussy off your entire dildo until you find yourself sucking on it again. You take it down your throat just gagging on it until you pull it out and breathe out. All done.

You leave it on your stomach as you rub your eyes slowly a yawn coming out of your mouth. Wonder what time it is. You lean over to your bedside table putting it on a clean towel and check your phone. It's 12:58pm. Damn.

You leave your phone there, and go back to your previous position on your bed and yawn again rubbing your eyes. When you open them you scream. You sit up trying to cover yourself fast but it's too late. "M-MIGUEL??? W-WHAT THE FUCK ARE YOU DOING HERE?!?!??!?" You yell pulling your tank top down, and grabbing your pillow to cover your bottom half.

Your cheeks have never felt this hot in your life, oh GOD WHAT DID HE HEAR-

You feel sick to your stomach- he's literally just standing in the middle of the room with his eyes closed? But WHY-

Your eyes are wide, cheeks so fucking red. Oh my god he saw everything- you gulp and reach down to quickly fix your panties and try to calm down. "So!??!??" You yell waiting for an answer.

He takes a step closer and you can finally see him clearly in the light. He was wearing a black tee with grey sweatpants making your breath hitch when you saw his stiff bulge. Once you look back at his face his eyes open and they're red.

You jump and your heart started beating fast as fuck. "Chingada madr— W- wha- who- Miguel? What the fuck-" (mother fucke-)

He walks over to the left side of the bed making you move to the other side scared shitless. He chuckles and as fast as you can blink he's on your side of the bed grabbing your hips and leading you against the wall, grinding you onto him. You whimper and try to get out of his grasp. "Don't try it doll... no need to act like you don't want me to play with you." He says using a finger to lift your chin to meet his eyes.

His red eyes filled with so much lust it scared you. Excited you even. "W-what are you-" You ask nervously biting your lip.

He chuckles again and pushes you against the wall. You gasp as his hands start to roam your body. You bite your lip as his hands caress your hips, smacks your ass, and then pulls on your hair from behind. Your head was pulled back as well and he leans in to kiss your neck. You moan and wrap your arms behind his neck twisting and pulling on pieces of hair. He groans against your skin and bites on it. You whimper and he leaves a wet kiss on it.

He pulls away but leans close to your face, "Wanna tell me what you were doing?" He leans in about to touch your quivering lips.

"I- uh I got- horny." You whisper breathing on his lips.

"Yeah? So horny you started thinking of me playing with you hmm?" Your thighs clench and you bite your lip looking up at him.

"Contéstame amor." He growls and you moan. (Answer me love)

"Mhm- it's not the first nor the last time I'll do it either." You say looking up at him with the most innocent eyes you could pull.

He groans and grinds his bulge against your stomach making your wide go wide. "Good girl...." He snarls making your thighs clench even more.

"What were you thinking of specifically right now as you came?" He asks tracing his fingers along your neck and collarbone.

"I- I- uh- mmm..."

"Answer." He growls and you nod.

He groans and quickly picks you up and holds you against the wall. "So you like being a dirty girl when I'm gone? Not even thinking I could catch you? Not bothering to think of how hard you make me...." He snarks a hand behind your neck.

This left you breathless and made you whimper more. You wrap your legs around his hips even more to have his bulge rub against your covered but drenched pussy. "I- fuck- I haven't touched myself in a week and I needed to feel something inside me- I n-never knew you thought of me that way-" you say and he growls grinding harder against you.

You both moan at the same time and he leans in millimeters from your lips. "I've been wanting to fuck you since we met." He whispers and you smash your lips together. He reciprocated and moans into your mouth.

You have one hand on his cheek and the other gripping hairs between your fingers. His were on your neck and playing with your hair. His tongue slides into your mouth and you let him. His tongue was exploring your mouth and you couldn't even believe this was happening. You tug on his shirt to take it off and he pulls away for literally a second somehow taking it off and his lips were back on yours. "Tan hermosa...." (So beautiful)

You moan and he grinds harder against you. He groans against your mouth and you feel him grab your tank top. Then you hear the sound of fabric ripping and in two seconds its gone. "I'll get you a new one." He mutters when you stopped kissing back to say something.

"So how long were you watching me for? you perv..." You ask pulling away finally getting your hands on his broad shoulders and big biceps.

"As soon as you started fucking yourself. God I heard your moans and couldn't help myself coming in to watch- mm I needed to finally have you for myself." He answers and leaves another mark on your neck but going towards your chest.

"You can have all of me." You whisper making him squeeze your tits roughly and suck on your nipple so roughly.

You gasp and he carries you to the bed. He puts you down towards the middle and he gets on top of you kissing you desperately. Your hands are all over each other and the kiss get more and more heated, needy, and hot. He pulls away and leaves trails of kisses on your jaw, when he leaves a couple marks on your neck. "Fuck-"

He kisses them after leaving marks and goes down to suck on your nipples again while his hand goes down to rub you over your panties. "Mmm- fuck- así M-Miguel." You moan out and feel yourself shake a bit.

He runs your clit a little faster but it's still sensitive so you buck your hips up whining. He stops and pulls away looking up at you, "was that too much?"

"N-no just uh still sensitive." You say looking anywhere but his eyes.

"Then how about no foreplay and I just fuck you?" He whispers making you clench your thighs.

He smirks and leans in to kiss you. You tug on the waistband of his sweats while kissing him and he grunts. "Well actually I might wanna use your mouth a bit...." He says and you smile.

You grab him and flip positions so you're on top of him. You sit up and place yourself right on his bulge and grind on it slowly. He leans his head back his mouthing in the shape of an o and his breathing heavy. "Don't tease me too much or you won't end up liking the outcome...."

You shrug and lay one hand against his chest while grinding against him. "Jesus you're so hard- did you even stroke yourself watching me or just tortured yourself and watched?" You ask with a chuckle making him smirk.

"Might’ve been more interested in the show to even do anything...." He says and winks.

You grin and go down his body, tracing your fingers along every crevice and line, along his abs and v line. You lick down his v line to where his sweats were. "Don't need these right now..." you pull them down as he shifts up a bit so you can get them over his ass.

You slide them all the way down and just look at his bulge over his tight fitting boxers. It looks so long and thick. "Wore these on purpose hm?"

"Just took a guess." He says with a smirk.

You grab the top of the boxers and pull them off slowly until you get to where the whole thing just plops out and hits his stomach making your eyes widen. "Now suck on it like you sucked on your dildo." He says making you gulp. He's insane.

It was a good 8 to 9 inches but so fucking girthy your mind couldn't wrap your head around it. You grab the bottom of it and you have to practically grab it with both your hands. You bite your lip then kiss the tip softly. Then you stick your tongue out and slap it against your wet tongue. He quietly moans and you look up at him and do it again. He rolls his eyes back and his head against the headboard. You giggle and spit on the tip watching it all go down and slowly stroke it to have all the saliva cover it. You spit on it some more and start stroking him. While you do that you go down to his balls and suck on them. You could hear him moan some more and you could feel how wet it's making you. "Así cariño no pares- ay si-" (Just like that dear don't stop- oh fuck)

You stroke him a little faster now and come up to suck on it. You get in a decent position and slide it in your mouth slowly. You close your eyes and start going down and back up. You go about halfway until he thrusts his hips making you take the whole thing down your throat, and you moan on it. You pull up and breathe out. "Would you prefer to fuck my face? I don't have a gag reflex...."

He widens his eyes and grabs you leading you towards the floor. You get on your knees while he stands in front of you. "It won't be for too long.... This time." He says with a wink making your cheeks flush red.

"I just really need to feel your throat real quick... then that wet pussy." He says and you nod.

"You can pull on my hair too if you want..."

"Dios- porque estas tan perfecta- mas que me imaginé..." he says and goes straight to work grabbing your hair with one hand and letting you put your mouth on it first. (God- why are you so perfect- more than I imagined...)

He starts to slowly move his hips letting you adjust for a few seconds before he finally starts going faster. Your head is still and he's the one doing all the moving, you close your eyes while you feel him in your mouth going deeper and deeper. You feel him go down your throat and he keeps hitting it making you drip. He goes faster and he doesn't stop moaning your name while still having a tight grip on your hair. "Fuck- Y/n your t-throat feels so good."

You moan against his dick and he groans. "Fuck this-" he says and moving back and sliding his dick out of your mouth.

He grabs your hands helping you get up only to have him man handle you on to the bed making you lay on your stomach. "Ass up now." He says in a stern voice and you comply.

You move your ass as much as you can and then arch your back. "The dirtiest girl huh?" He smirks and lines up his dick to your pussy.

"Nomas para ti Miguel." You murmur looking back at him and he moans and slams into you making you jump and whimper. (Just for you Miguel)

"H-holy fu- oh s-shit-!" you moan, your legs shaking already.

He grabs onto your hips and starts fucking you faster already not letting you adjust at all. You moan and roll your eyes back. He's moaning and groaning the room filled with the sound of skin to skin, his body against yours. "Migue-" you moan out and lay your head against the bed.

"Fuck baby- god you feel so much better than I thought you would." He says making you whimper and clench cashing him to moan.

"Fuck- oh fuck you're so tight around me baby-"

His words just do something to your body and you're already feel all dazed and obsessed with him fucking you. So many months of fantasizing and now it's finally happening. He's pounding into you and smacking your ass leaving it red. "Miguel deeper plea-"

He cuts you off by fucking you deeper making you both moan and making you clench around him again as well as whine. "O-oh fuck- oh Miguel I'm-"

"Me too baby, fuck I wanna cum inside you-" he moans out and you clench again making him go faster.

He's pounding into you and you feel your orgasm come fast. He moans with every trust he makes and it's driving you insane. Your arch is no longer an arch as your legs were slowly giving up on you but that didn't stop Miguel from still fucking you hard and also leaning down to you his mouth to your ear, and whispering dirty things to you. "Así soñabas que te cogiera nena? Eh? Quisiste esto desde que me viste huh? Yo se que yo si, mmm desde que v-veniste el primer día." (Is this how you dreamed I'd fuck you baby girl? You've wanted this since you first saw me huh? I know I did, mm since the first time you c-came.)

Your eyes rolls back and you whimper, "fuck- yes- fuck I dreamt you'd fuck me like this every- every fucking night Miguel."

He goes back to his original position but he flips you around so you're on your back while he was still inside you. "I wanna look at your pretty face while I cum deep inside you."

You wrap your arms around his neck and bring him in for a kiss. It's instantly needy and desperate, his tongue in your mouth and yours trying to go into his, with his pace still going strong. "P-pleas-"

He goes a bit slower and he moans in your mouth. Your hands go to his back light digging your nails into his skin which makes him groan. He fucks you deeper again unexpectedly so your nails dig into his skin a little harder and you feel close. "M-Miguel- I'm so- fu- I'm so clo-"

He pulls away him your mouth and nods, "me too angel- cum with me."

You moan and wrap your legs around his legs and it feels even bigger inside you. You both moan together and his legs start shaking. You're feeling tired fast but you need to cum with him. Your eyes are closing as you're ready for him to cum inside you to sleep together. You both start shaking as you clench around him and he groans finally shooting his cum inside you and your orgasm takes over, your legs shaking as he stops. You're both panting in each others face when he goes all the way inside you making sure every inch of you is covered. He slowly pulls out and all his cum spills out. "Jesus fuck Y/n- holy- god that pussy worked fucking wonders."

You shake and just nod before closing your eyes and losing consciousness. "Goodnight love."

#miguel ohara #Miguel O’Hara #Miguel o hara #atsv miguel #across the spiderverse #spiderman 2099 #miguel ohara imagine #miguel o'hara #miguel o’hara x reader #miguel ohara x reader #miguel ohara oneshot #Miguel O’Hara smut #miguel ohara x y/n #miguel ohara smut #miguel ohara fic #miguel ohara x you

760 notes · View notes

clockmax · 10 months

Text

﹒𝐗-𝐅𝐈𝐋𝐄 | 𝐓𝐀𝐏𝐄 𝟏﹒

← previous | next → | ﹗𝐒𝐞𝐫𝐢𝐞𝐬 𝐌𝐚𝐬𝐭𝐞𝐫𝐥𝐢𝐬𝐭﹗

pairing: dilf!Miguel O'hara x babysitter!fem!reader

Summary: In a AU where his marriage doesn't work anymore, he spends time away from his house. In turn, his 'wife' hired you to keep watch over Gabriella. But soon, a infatuation bloomed between someone who you couldn't have.

Warnings: NSFW, MDNI. infidelity, mentions of divorce, age gap(19-31), drinking, no use of y/n, oral(f receiving), p in v, mating press, praising, slight breeding kink if you squint, not proofread uhh thats it i think

w/c: 3k

You stood outside in the cold night, the sounds of crickets and other sorts of bugs in the night kept you from silence. It was cold, body shivering as you held your jacket close. Your breath was visible, the cold nipping at whatever skin was left exposed. Your body was flushed from the drop in temperature, winters air cruel. You were absolutely freezing. Yet you stood outside, watching as Miguel counted a stack of 10 dollar bills.

“40.. 50… 60..” The man mumbled, fingers sorting through the cash, “ 70.. 80, there.”

His hands moved to your own, placing the cash in your shaking hands. Fingers find themselves delicately sorting through the cash, double counting. Miguel Looked down at you, watching as you re-counted the cash.

“That’s the agree amount, right?” He tilted his head, cocking an eyebrow.

“Yes-” *You nod, putting the cash inside your purse.

“Then that’s your pay, I hope Gabriella wasn’t too much trouble.” He gave himself a small chuckle, putting his wallet away.

“It was nothing, really, she isn’t any trouble at all, sir.” For some reason you just couldn’t take your eyes off him, watching his every movement. You felt your body almost become warm against the weather, heart beating faster than it was before. Christ, you couldn’t get more embarrassed on the inside about it though. A crush on your boss’ husband? Really? Even your friends poked at you for that.

“There’s no need to be modest, I know she can be a handful. Kids got so much energy that she doesn’t know what to do with.”

His hands shuffled back in his wallet again, pulling out another 20, “There’s an extra 20, ‘cause I know,” Handing you the bill, giving a small playful wink.

His eyes happen to wander your body, looking at how you shivered and tugged your jacket closer, freezing hand putting the 20 with the rest of the cash. There was a slight twinge of guilt for having you outside when it was this cold. Muttering something to himself in spanish before he headed for his front door, turning back to you.

“Would you like to come in? I don’t want to leave you in the cold.” The offer felt a little weird, out of place for him. I mean he wasn’t your boss, his ‘wife’ if you could call her that was. But hey, practically the same thing, right?

“Are you sure?” You asked, looking up at him. The offer was still a little strange.

You two didn’t really talk much besides work and a few personal questions, but those were usually 2 minute conversations before you were on your way. Still, none of that stopped your eyes from looking at Miguel whenever you had the chance. It was a stupid crush, really. He was a married man with a daughter, plus he was older than you by a long shot.

“It’s no worries, I’d rather have someone to talk to while I drink much rather than drinking alone.” Miguel opened the door, holding it as you entered inside.

“Thank you.” You nodded, taking off your coat.

You tried your best not to let your emotions get the best of you. All he needed was someone to talk to, nothing more. Yet your mind couldn’t help but wander with thoughts that, even if you were being interrogated, would never say out loud.

You settled yourself in on a nearby chair, watching as Miguel walked over to the liquor cabinet, pulling out a bottle of whatever he was drinking, you couldn’t read the bottle, not from a totally different room. Soon enough he walked over to the couch, sitting down with his glass.

“Will your wife get mad that I’m still here?” You asked, still a little hesitant.

“Don’t worry about her, she’ll be gone for a long time,” His hands held his glass, taking a sip from it before setting it down, swallowing the liquid, “That’s how it’s been since she met her yoga instructor.”

You tilted your head, confused at the situation. You knew from what you were told that there was a rough patch in their marriage, but didn’t expect to be greeted with cheating.

“Aren’t you mad?” Mumbling a little, still hearable though. “Sorry, I shouldn’t have said that.” You quickly ducked your head, looking down in embarrassment for asking such a question.

Miguel let out a sigh, taking another swig of his drink.

“No, I’m not mad. Our marriage isn’t what it was, so we don’t really care about who sees who.” Taking another drink of the alcohol, the liquid running down his throat.

You moved your head back up to look at him,mind running wild with that. I mean, if they don’t care who sees who, you could make your move? But still, weird. He’s technically your boss, and still married, and with a kid. You’re just the babysitter, someone trying to make money for college.

“Nevermind. What about you, how is college coming along?” He asked, trying to change the subject from that of his now broken marriage.

“Rough, barely making enough with as many jobs as I have to pay tuition.” Leaning back in your chair, hands balling up in your lap.

“Hope every penny is worth it. Everyone where you’re at is probably struggling too, don’t get in a fuss over it.” Miguel's eyes looking over your frame once again.. Eyes looking at your thighs for maybe a moment too long before looking back up at your face.

“I know I know, but some people are just so care free, able to go to parties while I’m wondering if I’m gonna be able to stay at college.” You whined, upset about the financial situation you were in.

“Some people are just better at hiding it then others. I struggled in college, even being financially stable now, I was in student debt too,” Miguel sighed, “Look the message is a struggle always has a solution… 7 years of fatherhood and I still can’t give any good dad advice, if you can call it that.”

Miguel found himself getting another sip of his drink, getting up to get another glass full.

“You should relax though, don’t stress too much. Never does any good.” He’d tell you from the kitchen, refilling his glass.

“I’m just worried I’ll never get anything done if I don’t hyperfocus, forget what I need to do because I get too caught up with free time.” Your thoughts were racing, your worries about your current life situation flooding out of your mouth.

“No no, get what you need done too. Just don’t let it take over your down time. You’re young still, a whole life ahead of you.” Walking back to the couch, taking a seat again as he took yet another drink, “You got a boyfriend?” He asked, nonchalantly, no hesitation.

“No,” You mumbled, a little embarrassed.

“No?” Miguel Repeated, “I’m surprised.” “Why?” You turned your head, a puzzle expression painting your face.

“Cause you’re a young, pretty girl on campus, and no varsity jacket has come to take you away?” It sounded almost as if he was joking, teasing you for it. But he meant no harm.

“No, not yet. They already have themselves a girlfriend or something.” You sigh, sinking back into your chair.

“Yea times have changed, but, there’s probably a guy out there waiting to say the right things to you.”

How you hated that sentence. Another guy. You wanted Miguel, deep down you wanted him, but you couldn’t have him. Not at this moment, at least. Not only could it put you out of a job, but complicate things. And what if his wife catches you? He said that she doesnt care, but what if she cares that the person she employed is sleeping with her husband? I mean, why would she? Their practically divorced anyways. Or maybe you’re just thinking too much. Your body tensing up.

“I have my eye on someone, actually. Just having troubles about it.” You confess, looking down, kicking your feet.

“Oh you do? That’s rare. And troubles? Yea, I get that… Okay, what’s he like?” He questions you, sitting upright and fixing his posture.

“He’s older,” You start off, hands shaking a little. Were you really about to do this? Tell him how you feel? I mean the doors open for you to tell him, it’s only a matter of how he’ll react.

“Older? Like his senior year?” Miguel took notice of how tense you were, gaze softening a little. “You don’t have to tell me anything if you don’t want to.”

“No.” You bluntly respond.

“Okay so not that old, I hope he’s nice to a sweet girl like you.” Miguel offered a faint smile, leaning back into the cushion.

“He has a kid-” You usher out, mouth speaking faster than your mind.

For a second, Miguel is taken aback. That old? Seriously?

“Has a kid? At that age?” I mean, for anything it could have been a toddler kid, no way a full kid at that age he was thinking of. “Well.. as long as you know what you’re getting yourself into.” He took another swish of his drink.

You gulped, body shaking as you tensed up, mind feeling dizzy from the whole situation. “No he’s not my age, what I mean is-”

But you were quickly cut off, the tension in the air thick enough to cut with a knife.

“Yea, I got the hint.” Miguel looked at you, face stone cold as he held his glass.

“Listen, uh, I’m flattered, really. But uh, that would be weird, right. I mean, that would be taboo even. I’m too old for a sweet heart like you. Don’t you have anyone on campus you’d rather be with?”

His expression was stone cold, and you sunk back into your chair. Not you really regretted yourself for telling him this. How you wish the ground would just swallow you whole right now, or simply pass away on the spot.

“No, I just- I can’t get my eye off you and-” Quickly shutting yourself up, biting your tongue. You swore you were biting hard enough to draw blood, mentally cursing yourself for making this a conversation. He was right, Miguel was too old for you. But yet here you were, admitting those stupid feelings that you should have never brought up in the first place.

“But what about your parents, certainly they wouldn’t approve? Hell, Dana would have a fit if she smelt your perfume where it doesn’t belong. Let alone knowing her divorcing husband is with, uh..” Miguel sighed, slumping, hand on his elbow as he clenched his glass so hard he could probably break it if he wanted to.

Miguel sat back up, chugging the rest of his drink down before setting the glass on the coffee table, beckoning you over to him with his finger. “Come here,” He told you, almost as if it was a order.

Within what feels like minutes of you moving through the room, air thick with tension as you make your way over to him. Yet no sooner does he have you sitting under him, frame tower over yours.

Both of your lips were practically glued to each other, tongue exploring each others mouths as his hands felt up your body. You couldn’t help but feel his up too, hands tracing over each and every one of his well toned muscles.

Miguels hand moved under your shirt, grabbing one of your breasts. His hands fondled the soft skin of your tit, rolling your nipple between his fingers. You let out a whine, muffle by the kiss. You felt your juices start to form a puddle in your underwear already, thighs clenched together to give your clit some friction.

When he finally pulled away, eyes looking at yours. Christ this was wrong, but there was no stopping now. Miguel kissed down your neck, taking off your shirt. He kissed your breasts, sucking on them too. Making his way down your stomach, gently biting as if to mark it, hands working at your pants, tugging the material down and away. Getting on his knees infront of your legs, hands pulling them apart by your inner thigh.

His eyes took a moment to look at your cunt, how pretty it looked, how your juices were moving past your slit. His eyes moved black up to you,

“You sure about this, Corazón?”

It was without hesitation that you nodded, opening your legs more, almost presenting yourself to him. Miguel quickly became fixed on your pussy, tongue licking a stripe between your leaking folds, tasting your sweet arousal.

“Taste so sweet.. Didn’t take you for someone who likes older guys.” He mumbled against your clit, sucking on the bud. His hands moved to your ass, squeezing the soft flesh as he moved you closer to his face, burying himself in your cunt.

He licked and sucked on your clit before moving down to lick your juices from your folds, tongue moving inside your soft walls. Miguel was eating you out like you were his last meal, arousal coating his mouth and dripping down his chin. You just tasted so sweet, he couldn’t get enough of it, groaning in your pussy, tasting you like you were some sort of desert.

Miguel kept eating you out, noises almost sounding pornographic. He took in every moan and whine that left your mouth, feeling how his cock hardened just from the thought of being inside you next. You were so tight on his tongue, walls squeezing and contracting. You felt your orgasm approach, stomach tightening into knots. It wasn't long as he sucked on your clit, juices gushing out of your slit as your back arched, Thighs squeezed around his head as he kept licking up your juices, hand squeezing your ass. After a few more licks, he moved his head up , leaning over you again as he unbuttoned his pants and removed his boxers, cock springing free.

“This is what you were after the whole time, isn’t it?” Miguel cooed, grabbing your legs to fold them up, knees practically meeting your chest.

He lined his tip up with your entrance, slowly sinking himself in. It was a tight fit, almost too tight, sinking himself deeper into you. You whined and moaned, hands holding at his thigh.

“Ease up for me, pretty girl.” Miguel moved one of his hands down to your clit, rubbing the swollen tissue as your walls slightly eased up, taking the advantage to put himself balls deep inside of you.

He let out a groan once you clenched back down on him, hand moving back up to hold your other leg up. You looked up at Miguel through lidded eyes, mind clouded with lust. God, did you feel so full. His tip was prodding at your cervix, a vein gently pressing against that spongy spot inside of you.

After a few seconds, his hips started moving. A fast yet not too rough pace. His hips snapped against your skin, the faint sound of clapping as well a few curses under his breath mixing in with your moans. Fuck, he was in too deep, and you were already cock drunk. Your hands found their way to his head, pulling him in for a heated kiss.

Your noises were muffled in his mouth, the squelching sound of your pussy getting stretched out by him taking up the noise. How good it felt to finally have Miguel's cock in you, how many times you dreamed of this, touched yourself to the thought, yet the real thing was even bette.

“Good girl, taking me so well.” Miguel Praised, forehead touching yours, looking at how your pupils were blown wide, legs gently shaking. You couldn’t help but clench around him from the praise, letting out a mewl as you moaned again. Your second orgasm was building up already, and fast.

“ ‘m so close-” You moaned, the pleasure feeling almost too good then it’s supposed to. This was so wrong, yet, it just felt so right.

“Go on, come for me, be a good girl and listen, hm?” He’d whisper, pace picking up slightly.

Miguel felt his own high approach, letting out a groan as he trapped your lips in a kiss again,the grip on your legs getting slightly rougher, pace getting rougher too. His dicktouched all those special places inside of you, juices coating his thick cock and dripped down his balls, some dripping onto the couch too.

Before you knew it, you were both coming. Walls tightening around him, practically milking Miguel dry as thick, hot ropes of cum painted your walls. For a few moments, you both stayed like that, coming down from your high.

The reality then set in of what had just happened. His hands moved away from your legs as he pulled away from your body, eyes looking at your pussy, how he dripped out of you.

“Sorry-” You mumbled through your panting, body hot from the adrenaline, eyes looking down at the small mess.

“No it’s okat- let me uh, let me get a towel..” Miguel replied, fixing his boxers back on. He was only gone for a few moments before coming back with a towel, gently cleaning up the mess. Miguel folded the towel, gently placing you on top of the soft material.

The rest of the night was a blur, head reeling from the events. All you remembered was eventually landing in his bed, laying next to him. Miguel was fast asleep next to you, and you laid awake. All you could do was try and process everything. You slept with the person you had a stupid crush on, but also slept with a father, with a (almost non) married man. Oh you weren’t supposed to do that. What about morals? God this was such a stupid thing. You put your feelings over thought, and now, you were going to land yourself in such a difficult situation. Falling in love with someone who you couldn’t have.

taglist: @pandoraslxna @deputy-videogamer @its-paprika @yuuuumii @buggiecrawls @l0vedi3n @projectdreamwalker @urbimom @chshiresins @1tsk1tty

2K notes · View notes

solarlunarsstuff · 29 days

Note

hello 👀👀👀 may i request an alastor trying to woo lucifer's oldest daughter while the big boss of hell and charlie are watching 👀👀👀

thank you so much and have a wonderful day!!! ♥️♥️♥️♥️♥️

YIPPEE !! A hazbin Hotel req ! I only watched around 4-5 episodes of the newest show so it might not be accurate ! Enjoy :) !

Alastor x Fem!Reader (FANFIC)

A/n: He might be a little bit obsessed with you, but don't worry, he'll make you quiet if he has to force it. (HUSKERDUST 4 LIFEEEEE)

TW: Fingering, READER IS A HOOKER !!!, semi-public, getting caught, his horn thingies grow, tongue fucking, getting eaten out, dry humping, pet names (slut, whore, baby, doll, ect), you look a little bit like Charlie, dirty talk, nipple play, messy make-outs, overestimating, and edging. Lmk if I missed anything ! 😙

Synopsis: Alastor, the 7'3 radio demon, the overlord of a lot of land in hell. Even though he's shown no sign of wanting to experience intimacy, he can change that rule...

The first daughter of the big boss of hell.

That was your title, ever since you were born. Later on though, you had gotten a little sister.

Charlie Morningstar.

She was a big ray of sunshine despite being born in this hellish place. You loved her, you really did.

The both of you nearly look the same. You did dye your hair to (F/c) so there is quite a difference. You're about 6'9, a few inches taller than her.

You also held that wicked smile from your father, typical.

Anyway, you were in the middle of cleaning your apartment when you heard a knock on your door and the sound of paper falling onto the floor.

You thought it was those stupid kids on floor 4 playing games again, but it wasn't. Turned out to be a letter, signed by... your younger sister?

Of course, having nothing else to do, you ripped it open with your nails and unfolded the neat paper.

It read,

'My dear sister, I know we don't talk much anymore, but I would love it if you paid a visit to the hotel! I also know you probably don't have a job, but dad wanted to see you too. He had just come to the hotel about an hour ago. He was basically pleading to see your pretty face again! So, please, think of this and get back to me as soon as possible.

XOXO, Charlie'

You always loved the way that she signed letters. She's been sending you letters with her sign off like that for years now.

Either way, you sat on your couch, contemplating if you should just go or not.

"Fuck it..." You thought out loud

Choosing something comfortable and not something you wore while hooking up.

Oh, right... You're a hooker. It's a job that's actually nicely paid, paid enough for food and your bills. That's it, that's what you were worried about.

What if one of your clients worked there? What of your dad and sister find out?

One client stood out to you though, what was his name? Did it start with an 'A'? Either way, he was one of those people who would choose a hooker and later on be actually interested.

You? Never, it would ruin your job reputation, not wanting to let your job go, you kindly refused, and he went on with his life.

Until you have gotten various notes from someone, some of them were wholesome? In a way, like, "I miss you" or "Just give me a chance".

Others... others were sort of... sexual... For example, "My cock aches for you" and they even sent a paper that had been covered in lipstick kisses.

But it wasn't lips. It was, uhm, you get the idea. He might have been a little bit crazy for you, but it stopped a couple of years ago.

Maybe he realized that I wasn't interested in something serious? You still thought about it as you took the taxi to the front street of the hotel.

You thanked the driver, but instead of him saying your welcome...

"How about I give you a ten? You know, for your pretty body?" He grinned

"No thanks, you don't seem like the type that I would bother with. Plus, that 10 won't even cover 20 minutes.." You snarled back

He whispered some slur under his breath but drove off anyway.

"People think they can just ask me for -" you stumbled back as you ran into something, more like someone...

Red vest, big deer ears, a staff...

'Oh shit..' You thought to yourself

Maybe he won't remember you?

"Back for round two, love?" He grinned maliciously

'God fucking dammit..' you looked up seeing that stupid radio demon overlord.

"No, I'm not, you sick fuck. I'm here to see my little sister.." You moved around him and continued to walk towards the hotel.

"Ahh, that's why I thought you looked familiar.." his voice had a hint of static to it.

You stayed silent and opened the doors, your sister turned around to see who it was.

"Alastor, I said that you -" she stopped once she saw you.

'That's what his name was...' You smiled a little at how your sister nearly knocked you over as she came and wrapped her arms around you.

"OH MY GOD, Y/N, YOU CAMEE!!!" She jumped up and down while hugging the shit out of you.

"Hah, yep, it's me!" You awkwardly hugged her back, noticing your father talking to the other workers on the lobby couches.

Lucifer turned from the sound of your voice and did the same thing as Charlie.

"MY SWEET GIRL!" He squealed

"Hey, dad." I sighed as he also hugged me

Charlie's personality was mostly taken by your father's side while you to your mother's.

Not really knowing your mom, but you knew you had almost the same personality. The little family bonding was broken by the voice of presumed 'Alastor'.

"Y/n, was it? Pleasure to meet you!~" As if... This fucker is acting as if you've never met before.

"Right..." You went along with it, about to shake his hand, but almost forgot that he is an overlord of souls.

You just smiled lightly at him, seemed like it was the safest option.

[1 hour later]

Nifty was off somewhere cleaning, Angeldust was flirting with Husk, Lucifer and Charlie were laughing at something stupid. And you, you were just sitting on the end of the couch, sipping on your (F/d).

Everything was going lovely until you heard a little bit of static start to form behind you. Everybody else didn't seem to notice, but you did. While turning around, you saw that dumb fucks face.

"Darling, tell me.. Do you like me for the money? Or for how your pretty walls wrapped around my d-" you instantly cut him off, not wanting anybody to hear.

"Shut the fuck up..." You glared at him

He smuggly smiled and sat next to you, squishing you between the armrest and him.

"Could you move-" Your voice stopped in your throat when his hand landed on your thigh.

Alastor kept his hand there, slightly rubbing his hand closer to your cunt.

He paid no mind to your silent pleas. Instead, he started talking with Husk and Angeldust. Thank the gods you were in a blindspot, or everybody would've seen Alastor touching you up.

His hand swiftly slipped into your shorts, rubbing your dampened panties from the outside.

You started to softly buck your hips into his fingers, wanting to gain friction. As if it was obvious, he stopped, grinning from you silently whining.

"Are you okay?" Your father, Lucifer, asked. He noticed how you were twitching.

"Mhm!" Was all you could muster as Alastor started to pump his fingers again.

Your arm flared out, gripping his shoulder. "A-alastor... You..." You couldn't speak for shit.

"Please let me and Miss Y/N excuse ourselves!" Alastor announced to the group.

Before you could speak up, he dragged you a few feet around the corner. "What the fuck-" he cut you off by forcing his lips onto yours.

"You're going to shut the fuck up and take me right here..." He pulled away slightly before diving back in.