#back to paradise | Explore Tumblr Posts and Blogs

hellsitegenetics · 2 months

Text

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

#hellsitegenetics #faq #intro post #flowers #plants #requests #birds of paradise #asks #remember to keep checking back!

1K notes · View notes

the-sp0tless-mind · 6 months

Text

2K notes · View notes

hellcifrogs · 3 months

Text

Yes, all the girls are amazing, look amazing, do amazing things... But Ino with short hair is just the cherry on top for me!

#my art #naruto au #haruno sakura #ino yamanaka #hyuuga hinata #tenten #fox paradise au #naruto girls #naruto shippuden #hey look i cant walk but i can draw!!#my legs are exhausted not my arms #says with also exhausted lower back

760 notes · View notes

cr33py-crawli3 · 3 months

Text

HOW TO END THE CYCLE

#error 143 #john doe #obey me #the arcana #otome game #dating sim #blooming panic #paradise lost #mushroom oasis #what else am i supposed too do in my free time?!?#visual novel #romance visual novel #the kid at the back vn

432 notes · View notes

thestarofcottonland · 6 months

Text

Cosmetic Paradise and its sequels ~ 2007

#games that would have defined my childhood....#everything i wanted style savvy to be. elaborate dressup with life sim aspects #cosmetic paradise #took me forever to find the back cover to that top one for some reason

234 notes · View notes

muzzleroars · 21 days

Text

favorite scene in paradise lost where lucifer and gabriel insult each other back and forth until god breaks it up using astrology

#comes back after 2 weeks with art for an audience of me #i had a lot of fun looking through illuminated manuscripts for inspiration!!#esp with lucifer's little devil masks....ough i love their lil faces....#doodle tag #paradise lost #lucifer #gabriel

132 notes · View notes

tinartss · 6 months

Text

on moving out

#for context i drew this during the paradise of providence event👍#repost of old art #kavetham #haikaveh #i still think abt kaveh moving out often #always a bit torn between it signifying him getting back on his feet + regaining confidence in himself #but like sometimes he's a bit of an unreliable narrator....remember when he was like #hm. the first thing i will do w the prize money is move out and then build another palace but ten times bigger! like oh...kaveh.....#plus he can sometimes be blind (purposefully or not) to what's actually good for him..bc we (and alhaitham LOL) know the significance of #him having a home that's not just a house and how full circle of a moment that is for him #its always interesting to consider that their living situation in itself is this in-between flux moment #though i think kaveh trying his best to escape this “chapter of his life” isn't necessarily the solution.....#i still don't know how tumblr works so if u have to go thru all my yapping in these tags to repost i am so sorry </3 #ok thats all thank u for coming to my ted talk

290 notes · View notes

mangaparadise · 7 months

Text

356 notes · View notes

palahnyook · 1 month

Text

But my dreams are full of apples, and in the dark my body slowly transforms into fruit: tonsils shrinking to seeds and lungs to cores. I dream of white flowers blossoming under my nails, as if under ice. Then my nails break, open up like clams, and in the finger flesh there are little sticky fruit pearls.

— Paradise Rot, Jenny Hval

I will travel far beyond the path of reason Take me back to Eden, take me back to Eden

— Sleep Token, Take me back to Eden