#and i'm gonna make your life hell on earth | Explore Tumblr Posts and Blogs

armxnh · 5 months

Text

i know we just met, but i love you

synopsis: love at first sight with the tokyo revengers men.

characters: manjiro 'mikey' sano, takashi mitsuya, chifuyu matsuno

genre: fluff

warnings: none (i think...?)

masterlist.

manjiro 'mikey' sano

"ken-chinnnn" the leader of the toman whined at his taller friend. draken rolled his eyes in response, "no mikey, drop it."

"come onnnn-" the said man pouted exaggeratedly, "what did i do wrong?"

"nothing." the delinquent replied taking his wallet out of the pocket of his jacket, "you just don't need to eat twenty-five taiyaki."

"sorry to bother you but there are a lot of people who are waiting take their orders so if you could-" daiki, as it was written on his name tag, tried to cut them off from behind the counter.

for the past ten minutes, the two delinquents were arguing about their order. draken wanted to buy mikey five taiyaki, while mikey wanted his friend to buy him twenty-five of them.

draken turned his head to the cashier, "yeah, so five taiyaki and-"

"twenty-five taiyaki." "damn you-"

"hurry up! unlike other people, some of us have important things to do!" a customer yelled from the back of the line.

manjiro snapped his head to the back of the line, narrowing his eyes at the older man who had just yelled at him. "see now you're making people angry, mikey. 'm not gonna spend ¥5,272 on snacks."

"i need to eat a lot if i want to be taller!"

"for the last time. you won't get taller! you are at your maximum height!"

"alright! i'm not going through this again." a soft voice cut both of them before they could start the same argument they had 2 minutes ago. "daiki, i'll pay for their order- just make his goddamn snacks, please."

when manjiro turned to look at the person who 'saved his life', he felt like he has just died and miraculously came back to life as he made eye contact with you.

you were... pretty.

his eyes were set on you, taking in every single detail he could as if he was scared to forget how you look the second he'll look away.

"thank you, but that's not necessary!" draken politely thanked you as you grabbed your fidelity card of the small shop.

"don't worry about it! after all, those fidelity points have to be used for something." you waved him off, looking back at daiki, "could you also add my regular oder with that, please daiki?"

"o-of course, (y/n)!" the young worker quickly tapped your oder in the computer, a red hue covering his cheeks when you smiled at him.

"mikey, what do you say?" draken looked at his friend, hinting him to thank you, but his words fell into deaf ears as mikey kept looking at you like you hung the moon and stars in the sky.

"mikey?" He nudged the said man's shoulder trying to snap him out of his thoughts, only to be ignored once more.

the tall blond dropped the smile as he turned to his friend hitting the side of his head, finally snapping him out of his thoughts, "mikey!"

"um? what?" mikey barely glanced at draken when he responded, his heartbeat increasing when you looked back at him with your receipt in hand.

"i said, what do you say to the girl who just bought you your snacks?" he replied, glancing between the two of you clearly wondering why his friend was acting weird all of the sudden.

"marry me."

ken ryuguji never whipped his head to look at his friend so fast in his life. What the hell did he just said?!

you felt your face warm up at his words, chuckling as you walk past him, placing your hand on his shoulder, "do you ask every girl who buys you snacks to marry you?"

manjiro felt like he was in heaven when you stood closer to him. how can someone be so pretty and be so nice and smell so good and be so pretty at the same time.

"what?" toman's leader came back down to earth when you handed him the box filled of taiyaki. "did i say that out loud?" manjiro mumbled, frowning to himself. before looking back at you, just to see you making your way outside. "hey- wait!"

he tossed the snacks at draken jogging to meet you outside of the shop. "w-wait!"

you turned to look at him, the soft summer breeze sweating through your hair, leaving your face completely out in the open, "yes?"

"you're (y/n), right?" he asked remembering how the cashier called you when you were ordering, "i'm mikey..." he wanted to say something else but the words got caught in his throat when you smiled at him.

"nice to meet you, mikey" you replied before your eyes drifted behind him to the small group of guys that were looking at the two of you intensely, the 'ken-chin' guy from earlier standing with them. "i think your friends are waiting for you"

manjiro glanced back to see his best friends looking at them with knowing looks on their faces, "never mind them- this is- you are more important."

you looked away from him, his intense eye contact making your face feel warm, "you really know how to talk to girls you know?"

"thank you for earlier... the snacks and all..."

"that was 2 months worth of fidelity points- you better eat every single one of those taiyaki" you playfully warned the gang leader.

"don't worry about that..!" mikey replied knowing damn well that he will inhale those snacks. "can i walk you home? it's going to get dark soon- wouldn't want my wife to get attacked or something!"

wife?!

you suppress a smile at his words, "of course, wouldn't want it to get dark at 2 pm, and then get attacked by who knows what next to a bakery."

"exactly! let's go, wifey!"

takashi mitsuya

"what did you say you're brother's name was?" you asked the crying girl in front of you.

"...t- taka-shi" the small girl sobbed in your shoulder as you gently patted her head.

"alright and what's your name?" you gently asked as you scanned the area trying to find someone who looked like they had just lost their child.

"i- i- i'm mana"

"you have a really pretty name, you know?" you smiled fondly at the girl as you whipped the tears of her face with your thumbs.

"really?"

"heck yeah! it's a badass name!" you felt relief wash over you when you saw a smile spread across the kid's face, "i'm (y/n) and i'm gonna help you find your brother alright?"

"thank you..." she mumbled quietly.

"you're going to hop on my shoulders and tell me when you see your brother okay?" the girl looked up at you with stars in her eyes, you pulled mana on your shoulder, her small hands on your head.

you walked for a good 15 minutes before mana tapped your head with on hand while the other pointed toward an unknown man in the crowd of person, "they're there! that's draken!"

draken? wasn't her brother's name takashi? you wondered as you put mana to the ground your hand grabbing hers just in case she got lost again.

"mana!" a little girl's voice called out as you arrived next to the very tall guy with a dragon tattoo on his head. the small girl that looked very similar to mana hugged tightly the younger girl.

"mitsuya! ' found her" the tall guy called out for someone else behind him. the 'mitsuya' guy appeared from behind the 'draken' guy not long after he called out from him. the purple haired teen practically attacked his sister with a hug, sighing in relief.

"don't ever do that again, mana." he gently scaled his younger sister, "you could've gotten lost and we would've been really sad, al-?"

"it's fine! (y/n) helped me find you!" she pointed her finger at her. mitsuya ruffled his sister's hair, before straightening up to thank the person that help his mini-him, "thank you so mu..."

he felt like the world had stopped moving. like it was only the two of them in the middle of the festival. takashi mitsuya was in a trance. he was simply mesmerized by the sight of you.

"it's no problem, really! " you softly smiled at him, "your sister is a real angel-"

anything else you said after wasn't even registered but the delinquent in front of you. he was usually so good at this- talking to people was what he did best so... why couldn't he utter a single word for you.

his cheeks were red, his palm were sweaty, why was he anxious?- he was hanging on everything you did. even if he felt like he had forgotten how to speak, your voice felt like melody to his ears.

he snapped out of his trance when someone nudge his shoulder. mitsuya glanced at draken beside him, suddenly remembering that they weren't alone and that you were talking to him.

you looked at him with a puzzled look, "are you alright?

your question made him overthink about everything that happened in the last 2 minutes of your meeting. Did he look like a creep?

"i- i- great."

the hell was that takashi? he cursed himself.

darken cleared his throat, holding back his laugh. he brought his fist to his mouth faking coughs as he muttered a small, "real smooth, mitsuya".

you chuckled at his friend's comment, making mitsuya straighten up, you pulled out your hand for him to shake.

"let's start over, alright? i'm (y/n)... you're takashi right?"

draken stepped up clearly expecting his friend to be to lost in space to answer you, "he prefers mitsuya-"

"takashi's fine!" the said man interjected, as he quickly grabbed your hand to shake it, sending one of his pretty smile in your direction.

"i-"

"are you going to marry my brother?" he couldn't catch a break could he? luna asked you with big eyes.

you chuckled softly at her words, "how about this... i will give my number to your brother. then we'll go out to eat something to talk about marriage alright?"

"yes!" the girl tightly hugged your leg as you said that.

"does that sound like a plan to you, takashi?" yes!

mitsuya hurriedly started to look in his pocket for a pen, when draken pulled one out of his pocket with a piece of paper and handed it to the purple haired boy, "there you go, casanova"

takashi handed you the paper and the pen, before you wrote your name with your phone number on it.

"see y'a soon, taka! bye, mana don't get lost again alright?"

as soon as you were out of sight takashi turned to draken with a stern look, "not a word about this, alright?"

"you're crazy!" draken crackled putting his hand in his pocket, "i'm going to tell everyone!"

"draken!"

"as your wingman i feel like it's my responsibility-"

"no it is not!"

chifuyu matsuno

"hurry up, chifuyu!" takemichi yelled at his friend. they couldn't be late. not for that.

"how come you are slow as hell during a fight, yet you sprint your life on a sunday at 8 am?" the blond joked as he calmly walked behind takemichi with not a care in the world.

"come on! we're gonna be late!" he repeated hurriedly before stopping abruptly while looking around him.

"late to what?" chifuyu yawned, before looking at his friend, who stood there looking around, up and down as if his brain had finally snapped, "you alright?"

"alright stand here and don't move." takemichi moved the delinquent around so that he would stand in the middle of a park- an empty park.

"did you finally snapped or...?" he asked when the time traveler started to back away from him, "are you going to kill me? is this really how it's gonna end-"

"watch out!"

a voice yelled, but it was too late.

a ball directly hit his face, knocking chifuyu to the dirty ground, his eyes closing due to the shock.

it took him a couple of seconds before finally opening his eyes again, only to realize that he was in heaven. the prettiest girl he had ever seen in his life held his head in her hands, her index and middle finger pressed against the front of his neck just below his jaw- making sure that his heart was still beating.

"oh- thank god! you're not dead!"

"are you an angel?" chifuyu mumbled placing his hand on top of yours- making sure you were real, "am i in heaven?"

you let a breathy chuckle at his words, "you're cute- but no you're not dead... i kicked a ball in your face- unintentionally of course!"

his eyes finally focused on you, remembering what had happened. he blinked a couple of time, his eyes scanning your face- a pretty girl's face... so close to his face with her hands on his face and his hands on her hand-

what?!

chifuyu's face became as red a tomato straitening his posture to apologize for touching you without your authorization, "i'm so sorry-"

his head came in contact with your head, making you pull back immediately from the blond. "ow! i told you i didn't do it on purpose!" you groan holding your head with your hands.

chifuyu gasped in horror at his own clumsiness as he placed a hand on the back of your head. hopping that the coldness of it would help you a little, "i'm sorry! i swear i didn't mean it! please hit me again so that we're even!"

...what? now why would he say that?

"what? what's wrong with you?! do you get turn on by getting hit or something?!"

chifuyu panically looked around to search takemichi so that he could help him. when he finally spotted him, hiding behind the swings, the time traveler was smiling proudly with his two thumbs up in the air.

his action making him recall a conversation the two of them had a couple of weeks earlier.

"so... am i married in the future?" chifuyu asked takemichi as he bit down the sandwich he made himself for lunch.

takemichi raised his brows at the question, "yeah-"

"really?!" the blond gasped, with heart in his eyes, "do i know her?! no wait- that'll ruin the surprise- is she pretty?! no wait- of course she's pretty you idiot!"

the time traveler chuckled at his friend's words, rubbing the back of his neck, "do you want me to tell you how you met?"

"no! it has to be a surprise!" chifuyu refused, "wait am i going to meet her soon? is that why you said that?! takemichi?! answer!"

"nah- like you said it has to be a surprise~"

"takemichi!"

"if it makes you feel better- you embarrassed yourself in front of her"

"how would that make me feel better?!"

that sneaky bastard.

"i'm sorry! i don't know how to talk to pretty girls..." chifuyu mumbled looking to the ground, but his face snapped back at you when he realize what he had just say, your eyes round at his words, "i- i mean not that don't know how to talk you! wait- not that you're not pretty! you are pretty- beautiful even! but that is not the point! i don't need you to hit me! just please don't think i hurt you on purpose- i don't hit pretty girls! no wait- i don't hit girls at all! but you being beautifully-pretty is just a plus you know! an-"

you smacked your hand on his mouth, stopping his rambling, the butterflies in your stomach flying way to much due to his words. "please stop-! you're too cute..."

takemichi titled his head at the scene in front of him, clearly not remembering that part of the story your older self told him in the future about how chifuyu and her had met-

but... mission failed successfully... i guess?

ⓒarmxnh

#tokyo revengers x reader #tokyo revengers #chifuyu x reader #chifuyu matsuno #takashi x reader #takashi mitsuya #manjiro x reader #mikey x reader #manjiro sano

4K notes · View notes

hellsitegenetics · 2 months

Text

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

#hellsitegenetics #faq #intro post #flowers #plants #requests #birds of paradise #asks #remember to keep checking back!

1K notes · View notes

zombiefiilm · 4 months

Text

Next to You

spencer reid x fem!reader

summary: sharing a room with the person in the bau that hates you the most makes you go through more emotions than you thought possible

warnings: kind of enemies to lovers, arguing, crying, no use of y/n, smut, nsfw - 18+ only, apology sex, soft sex, fem oral, protected p in v, praise, typical criminal minds death and unsub mentions

word count: 2.7k

Last minute cases in desolate towns in the midwest often meant that there was nowhere for the team to stay. It wasn't uncommon for you to have to pair or group up with other team members in dodgy motel rooms.

The most recent investigation had brought you all to the middle of nowhere in Nebraska, a long day ending with a drive to an motel that housed 7 rooms in total.

You, Reid and Rossi were the last to arrive so when Prentiss handed you a room key and told you that you would be sharing with Reid, it was already too late to complain.

"It's for your own good" she she grinned, picking her go-bag off the floor beside her.

"I hate you" you sighed.

"Sure you do" she was already walking off. You've been face to face with serial killers regularly, and this was just surviving a few nights in the same room as Spencer Reid, you could do this.

You walked back outside to find Reid standing in the dark by the car, right hand in this pocket and his left leaning against the black SUV.

"Looks like you're with me, Reid" you announced and the way that his face instantly dropped almost knocked you over. It was almost like you'd told him you were about to kill him.

"Come on" you began walking down to room 4, Spencer following shortly behind as you unlocked the door.

Being met with just one double bed though was enough to bring tears to your eyes. The couch looked like it had been through the war and there was no way on earth you were even touching it. And the sigh that Spencer let out made you want to rip your own hair out.

"I'm gonna sleep in the car" you quickly turned around to walk out of the door.

"You're not sleeping outside with a killer targeting women the exact same age as you on the loose" he stopped you in your tracks. He was right. "I can take the couch".

You were a little surprised at the chivalry but thankful none the less. "Are you sure?"

He didn't answer, instead dropping himself onto the couch.

Feeling content with his actions, you dropped your own bag on the floor beside the bed and told him you were going to use the bathroom before cleaning yourself up and changing into the oversized t-shirt you were using as pyjamas.

Coming out of the bathroom again, you were going to tell Reid that he was free to use the bathroom now but he simply glared at you.

It was as if he wanted to make your life hell. He always scowled at you, made snarky comments on little details about you, gloated whenever you got anything wrong. He always drove you up the walls, since you first started at the BAU, and you never knew why.

It's not like you had done anything to him, from what you knew at least. You smiled and shook his hand when you met him and even thought he was cute, you treated him just like you did with everyone else on the team, but you quickly noticed how differently he treated you.

You gave him plenty of time to warm up to you before you let yourself develop any solid opinions on him. You were warned about how he took to knew people, and you were understanding at first. But after you were several months in, and now years, and he still treated you like an outsider, you were no longer shy to expressing your dislike for him.

Other people on the team noticed it too, you, JJ, Garcia and Emily often discussing it with each other, but if one of them ever mentioned Spencer's attitude to himself, he'd deny everything and brush it off.

You really tried to not let it get to you, especially with the support from others, But man, did it upset you.

Spencer eventually got himself ready in the bathroom and came back out, silently setting himself up on the couch as you sat in the bed and did some research. There was a nice silence for a while, and then:

"Could you stop turning the pages so loud" he sounded irritated already and you hadn't even spoken to each other in the past 30 minutes.

"What?" you matched his tone, was he really trying to start a fight with you right now?

"I can't even think with how much noise you're making"

"I'm not making any noise, Reid, what's wrong with you?"

"You're flicking the pages, I can't pay attention to anything else"

"Oh so the sound of paper is able to stop boy genius in his tracks?" you mocked, pissed off at what he was choosing to do do.

He glared at you in response, he looked like he was about to blow a fuse.

"I don't know how to help you here, Reid, I'm trying to work on the case"

"Yeah, trying, it's not like you've ever actually done anything important for one" his voice had raised slightly.

"What?"

"You're practically incompetent, how you got recruited to the bureau, I'll never know" you hadn't even noticed him standing up, but it suddenly made you feel uncomfortable so you got out of the bed too, standing on the opposite side of the room.

"Excuse me?" you were completely shocked now, how had he gotten so far.

"You heard me. You have no place on this team. All you do is mess things up, you can't figure anything out and then you go and let our unsubs go"

You knew exactly what he was talking about. During one of your first cases, you had unintentionally informed an unsub that the FBI were searching for him during an interview with his wife and he got away. He was dangerous and you had never forgiven yourself for the people who had died before he was finally caught.

You just broke down in tears after that. It felt like he'd re-opened the wound right there and then.

"Fuck you" you spat through tears. You couldn't even look at him now, turning your back to him to sit on the bed.

"Oh my god, I'm so sorry" it was like he had suddenly snapped out of the unexplained rage he was just experiencing.

You felt the bed dip as he sat down behind you, and then a hand rest on your shoulder.

You were edging on losing the ability to breathe. It wasn't even just remembering the worst experience you had on the job, it was the fact that Spencer had used it against you just to get a reaction out of you. You wouldn't have even expected that from him.

He just sat behind you as you attempted to regain some sense of composure, not saying anything else. Was he finally feeling some sense of remorse for how horribly he had been treating you?

Once he noticed that your breathing had slowed, he called out your last name, your work name. It felt so impersonal in that moment. Not that you'd ever been on a first name basis with him, but you gave no reaction to him.

He tried again, squeezing your shoulder this time. You gave him nothing.

But then he whispered your name. Your first name. It was quiet, apologetic.. desperate.

You sniffled, wiping the tears from under your eyes before you turned around to look at him. He was sitting right behind you in the bed now, his big brown eyes practically burning a hole in your head. You knew you probably looked like a mess now, face red and wet, eyes puffy, and hair mangled.

"God, I'm sorry" his hand reached up to wipe a stray tear from your cheek "I'm such an idiot, I can't believe I said that".

You flinched at his touch, not saying anything back to him.

"If I could take that back I would, I did not mean it. It was just in the moment" he tried to hold your face in his hand but you avoided his touch.

"In the moment?" you repeated "What even was that moment. It's like you wanted to have an argument with me for fun".

"I don't want to argue with you, I just.."

"You just hate me" you finished.

"No! I don't hate you, I'm just stupid and don't know how to deal with how I feel about you"

You looked directly into his eyes, eyebrows furrowed. "How you feel about me?"

You managed to catch his gaze as it briefly flicked down to your lips. It felt like something was drawing you closer as you moved towards him.

"Please, let me make it up to you".

"No. Are you saying you've treated me like this because you can't figure out what to do about your feelings for me? What are you? Twelve? You've made my life miserable."

The tears spilled out again, what was he even saying?

"Please, just let me show you how sorry I am"

His voice was laced in what could only be described as desperation, it was making you want to hear him out, forgive him, and you didn't quite know why.

"Please" his voice was on the verge of breaking.

Your walls were crumbling down, it was like he'd cast a spell on you

"please"

You only nodded, allowing him to to lean in closer to you, finally cupping your head in his hands and softly pressing his lips against yours.

It was like he was purposefully avoiding any roughness as he gently kissed, from your lips down your jaw and then down your neck. He looked at you then, his eyes meeting yours in a silent question. And you nodded.

He loosely grabbed the hem of your shirt, and you let him lift it up over your head.

He didn't touch you yet, kissing your lips again as he began to slide your underwear down. You manoeuvred enough for him to take them off you completely. He was so gentle that you didn't even think of feeling self-conscious being completely undressed in front of him.

He urged you to spread your legs and quickly laid down on his stomach in between them.

You barely had time to blink before his lips were on you, kissing up the inside of your thigh. as his hands wrapped around you, holding you down.

Then, he was softly licking up your cunt, softly moaning to himself as he tasted you. He avoided your clit, dragging his tongue everywhere except where you needed him most.

"Spence" the nickname drove him crazy, he finally felt like maybe you could be his.

He finally flicked his tongue over your clit and you couldn't help but push your hips against his face, a whine slipping from your lips.

He only egged you on, using your legs to pull closer to his mouth. He kept circling your clit, increasing the amount of pressure he used as your squirmed under him.

Every few moments, he'd bring his tongue down again, dipping into your hole gently, gathering your slick, before suckling at your clit again.

Slurs of his name, swears and a few 'oh my gods' were the only coherent sounds that could leave your mouth. He had gotten you incredibly sensitive and you felt like you could tip over the edge at any moment.

Spencer himself couldn't stop himself from moaning at your taste, your sounds, how your skin felt under his hands. The vibrations pushing you further.

He suddenly sucked a bit harsher, almost nipping your clit before going back to his previously gentle movements.

The contrast between the rare harsher movements and his gentle attention had you bucking into his face, only to be stopped by his hands pushing you down.

All of a sudden, you felt your release. You moaned much to loud as you writhed under Spencer's mouth, him carrying you through your orgasm.

Just as you felt yourself come down, you went to pull yourself away from Spencer, but he refused to let you, keeping you pinned down to the bed as he let himself taste your release.

"Spencer, please" you were so incredibly sensitive at this point, your body jolting at every small movement. You had to bite the side of your hand to stop yourself from yelling out from the pleasure.

He suddenly pulled off of you with a soft *pop* ad sat up, quickly kicking his trousers and boxers off as you reached forward and loosened his tie and unbuttoned his shirt.

Now that he too was undressed, you felt more equal, it was almost metaphorical as if he was agreeing to end the weird tension between the both of you.

He sat between your legs again, lifting your legs around his hips. You hadn't noticed the condom he had taken out from his pocket until you heard the crinkle of the foil as he opened it.

He quickly rolled it down his shaft as you finally got the chance to look at him. You felt yourself clench in anticipation.

He finally lined himself up and you were subconsciously pushing your hips down towards him.

"Please, Reid" you practically begged as he leaned forward but he stopped at your words.

You looked into his eyes, pleading for him to fill you up, but he didn't.

"Spencer" you whined, and he quickly rutted his hips into you.

"Thats it, good girl" he praised as the air was knocked from your lungs.

He started slow, using one hand to prop himself up and the other to finally caress your skin. It was like he was trying to memorise the curves of your body with one hand. He grabbed at your hips, held your waist, squeezed your breasts, as he slowly picked up his pace.

He couldn't get enough of feeling your body as he pinched your nipple, marvelling at the way it hardened further.

"God, you're so beautiful" his hand finally fell down to your clit, rubbing small circles in time with his thrusts.

You couldn't even get a single word out at this point, too tired and desperate to say anything.

"I'm so sorry baby" if he didn't have your attention before, the name had definitely gotten it now. "I'll be so good for you from now on" you could tell he was close from the waver in his voice, but you too felt your 2nd release approaching.

"You're so perfect" his rambling was interrupted by groans, "never want to leave your side ever again" his thrusts had last there rhythm as he circled your clit quicker, desperate to get you to cum before him.

It didn't take long for the coil in your stomach to snap, vision blurring as he continued his thrusts. Not much after, he plunged into you one last time. You could feel him coming inside as he filled up the condom, his chest now flush against yours.

You both laid there for a few moments, enjoying the hot, sticky embrace as you caught your breathe.

Silently, Spencer pulled out, taking off the condom and throwing it in the trash before pulling his boxers on. He then got you cleaned up, helping you put on your own underwear afterwards, before you got into the bed.

He tried to walk over to the couch but you were not letting that happen. “Get in here Reid" you muttered, laughing quietly as he practically jumped in beside you.

As he faced you in the bed, he brushed a stray hair behind your ear. "I'll make it up to you, I'm sorry, about everything" he kissed you once more, it would take more time for you to forgive him, but for now you let yourself fall asleep in his arms.

#spencer reid #spencer reid smut #dr spencer reid #spencer reid x reader #spencer reid x reader smut #spencer reid x you #spencer reid x you smut #criminal minds #criminal minds smut #spencer reid x fem reader #spencer reid x female reader #spencer reid x y/n #spencer reid x y/n smut #spencer reid x fem!reader #spencerreid #spencer reid x fem!reader smut #spencer reid fluff

1K notes · View notes

nastybuckybarnes · 6 months

Text

Welcome Home

Pairing: Simon Riley X Reader

Summary: Nothing shatters the tension of a fight quite like needing your boyfriend to rush home to save you from people who would do you harm.

Warnings: Angst, Language, Fighting, Fluff, Kind of mean!Simon but not too bad, very minor violence, home invasion, I think that's it...?

Word Count: 1.5K

A/n: we're gonna dip a toe in the COD water and see what happens. I love ghost and Konig so we'll see what else I do there. For any and all COD stuff, I use Canadian Military as a basis for the readers background.

~*~

"I've had enough of this. I'm not gonna argue with you about somethin' so stupid," he hisses, glaring at you with hard, cold eyes.

"It's not stupid, Simon, you just don't want to ever entertain the idea of talking about things that might make you slightly uncomfortable!"

"Oh fuckin hell." He drags a hand down his face and shakes his head.

"Everythin's always gotta end with you being right, doesn't it?"

You frown at his absolute lack of any sort of understanding or empathy.

"This isn't about me being right, this is about you at the very least hearing me out!" You try.

"You knew what you were getting in to the moment you met me, m'not sure what you're expecting of me now. S'not like I can go and change the way things are, now can I?"

You narrow your eyes at him and his blatant ignorance.

"I understand full well, Lieutenant. I've been there, which is something you seem to conveniently forget."

He lets out a humourless chuckle and shakes his head, "don't go put yourself in the same category as me now, lovey. You know you weren't exactly at my level when you served."

His words are a slap in the face.

Sure, you were never quite JTF2 or SAS level, but that doesn't mean your time in the military is any less valid than his.

Seven years of your life you devoted to serving your country, the medical help for teams like his, and all he can do is turn his nose down at it as if it means nothing to him.

"You know what? Fuck you, Simon. I never even insinuated that we were at the same level and for you to try and..." you stop, pinching the bridge of your nose as anger fills you.

"What? Got nothin' to say now? That's a shock."

It takes all your strength not to lash out at him and even more to stop your bottom lip from quivering at just how mean he's being.

Sure, he's always been a little rough around the edges, a little harsh and brazen, but never has he been so downright mean to you.

"Get out."

"What?" This seems to genuinely catch him off guard, his arrogance faltering for a moment.

"Get out. Leave."

Simon Riley isn't a man who gets scared. He's been chewed up and spat out of hell before. Nothing on Earth can get the jump on him and nothing can scare him.

At least, that's what he thought.

His palms tingle and he needs to grind his teeth together a few times to collect himself before speaking.

"So that's it then?" He asks, his deep voice barking the question like he would an order.

You two have had your fair share of fights in the time that you've been dating, even more since you moved in together, but none where he's thought you might end things.

"I'm not gonna stand here and take a verbal beating from you, Si. Get out and come back when you've had a chance to fucking cool off."

He stares at you for a long moment, testing your resolve, waiting to see if you really mean it.

When you hold his glare, not backing down, he grabs his coat, mask, and keys and storms out of the house without another word.

You stand there in the kitchen for a long moment, the silence ringing heavily in your ears before you storm up the stairs to take a shower and, hopefully, argue out all your hostility in private.

The warm water runs over your tense shoulders for a few minutes and you try your hardest to relax, to let the anger seep out of you and run down the drain, but when you hear the front door open you're filled with rage once more.

You stand in the shower silently, waiting for the door to open and close again, signalling his departure, but instead you just hear boots on the kitchen floor.

Scoffing and shaking your head, you start to seethe.

As if he's wearing his shoes in the house on top of everything else.

You yank the shower curtain aside and step out onto the mat, not bothering to turn the shower off.

A crash from the kitchen makes you freeze.

Simon is never this loud.

Like a deer on the highway, you stay still, silencing your breathing as you listen to the noises coming from the kitchen.

Instead of calling out to him and potentially causing more trouble, you take a silent step to the counter where your phone lies.

You grab it and hit his icon quickly, listening to it ring for a while before he sends you to his voicemail. A loud beep sounds tauntingly in your ear and you huff out an angry breath.

You hang up and call him back, grinding your teeth together when he sends you straight to voicemail again.

The noises in the kitchen continue, and your heart jumps into your throat.

Answer your phone, Simon.

You shoot the text off quickly then immediately call him again, your stomach settling when the call connects.

"Are you home?" You waste no time on pleasantries, and instead hear him sigh heavily.

"You told me to get the fuck out, didn't ya? Why would I be home."

Your breath hitches and you press your back to the bathroom door, turning the lock silently as panic fills you.

"Simon, someone's here."

The fear in your voice has his blood running cold, his fingers gripping the steering wheel tighter as your fight gets shoved from his mind.

"What do you mean 'someone's here'?" He asks, his voice lacking the anger it had only moments ago.

"I heard the door open and I can hear someone in the kitchen."

You hear his tires screeching on the pavement and his engine roaring as he speeds home.

"Where are you right now?" This isn't Simon talking now. You recognize the change.

This is Ghost.

"I'm in our bathroom. Door locked and shower on."

"Good. Keep that water running. As long as they think you don't know they're there, you should be okay until I get home."

"Okay." You feel a little bit safer knowing he's on his way home.

"Keep me on the line."

"Okay."

There's a few seconds of just breathing before you speak again.

"How far are you?"

"Two minutes away."

"Okay... After you deal with these guys we can go back to yelling at each other," you whisper, wrapping a towel around your body and leaning against the wall across from the door.

He chuckles softly and the sound makes a small smile tug at your lips.

As much as he pisses you off and even sometimes hurts your feelings, deep down you know you'll never love anyone the way you love him.

You don't realize you've been quiet until he calls your name softly.

"You still with me, dove?" His voice is soft and you hear him turn the car off.

"I'm here."

"Good. I'm home now, don't come out of the bathroom 'till I come get you, understood?"

"Understood."

Sometimes living with Simon reminds you of being on base, and there are times when you despise it.

And then there are the times when you don't mind it as much. This is one of those times.

You hear the muffled sound of what must be him putting his phone in his pocket, and you close your eyes as you hear the soft click of the door handle through the speaker.

His footsteps are silent, even through the phone, and you feel ridiculous for ever thinking you'd hear it if he came home.

You can hear him as he takes down one intruder, and then what must be a second one.

He says nothing to them, that you can hear. But a series of dull thuds echo through the house before silence remains.

A few minutes go by of nothing, but you don't dare speak or open the door.

Ghost gave you an order, and you have no intentions of disobeying.

There are a few more moments of silence before you hear a crisp knock on the door.

"Lovey? You can open up now."

Breathing out a sigh of relief, you open the bathroom door and are immediately engulfed in Simon's strong arms.

He walks you backwards into the bathroom and squeezes you to his chest, mask hiked up over his nose so he can breathe in the scent of you.

"You all right, love?" He asks softly, his voice gruff and ever so rough.

"M'okay, Si. Thank you for coming home."

"S'my fault anyway. I shoulda locked the door before leavin' in a huff the way I did."

You frown and shake your head, pulling away to look up at him.

"This is in no way your fault, Simon. I could've easily locked the door after you. I'm just happy you got home in time."

Though you're not sure what the intruders really wanted, you're glad you didn't have to find out alone.

"I'll always come home."

And with those four words, he puts to rest not only the intruder situation, but also your argument from earlier.

Because he will. He'll always come home to you, regardless of what he needs to do, he'll make sure he comes home to you.

#simon Riley x reader #ghost x reader #simon ghost riley #simon Riley x reader fluff #simon x reader #cod x reader #cod mwii #cod mw2 #cod fanfic #cod mw2 x reader #soap #price #gaz #fluff #angst #simon Riley fluff

2K notes · View notes

eufezco · 1 year

Text

you meet joel again after the outbreak and he finds out you have a daughter

seeing joel again after the outbreak was something you thought would never happen, but there he was, twenty years later, with almost completely gray hair and beard, and looking more tired than he used to. his brown eyes shone when he saw you, thinking that you were some sort of hallucination produced by tiredness, but your arms hugging his neck felt so tight and your head against his chest felt too real to be a creation of his mind.

he gulped nervously and took a few steps backward when you took the little girl in your arms as if he was scared of the little human. you had always been very good with children so he wasn't surprised that you were now taking care of them in jackson. because that's what it was, wasn't it? you were looking after someone's child, right?

"this- this is my daughter, joel." oh shit. your face expressed concern, waiting for a reaction from the man in front of you, but his eyes were locked on the child in your arms. he should have guessed. enough time passed, you were a grown woman and life was good in jackson, probably the best place on earth right now to start a family. he softly nodded his head, trying not to show how shocked he was. the baby was sucking on her finger, cooing and doing that stupid baby sounds like she was mocking him. "congrats" was all he could say.

he was waiting for you to introduce him to the father of your daughter, but you never did, it was as if you were torturing him slowly. maria wanted to put joel and ellie in the house across the street from hers and tommy's, but you offered them to stay with you.

"oh, that place has been untouched since the outbreak, i actually think only the heat works." you cut tommy off when he was saying that it was decent. joel was gonna decline your offer but ellie, who had been tickling your daughter's belly and playing with her tiny hands until that moment, was quicker than him on saying that they'd love to.

he hated to see that baby. joel hated her chubby cheeks and her small hands trying to reach for him every time he was near. he also hated tripping over her toys around the house and how she cutely laughed when ellie played with her. he hated seeing her wrapped in a towel like a burrito after her bath and he hated to see her cheeks and nose red from the cold weather, and how she stomped when she was wearing her big coat and fell on her ass in the snow.

"so, where's the dad?" ellie asked you with her mouth full of food. joel gave her a look that would have killed her and huffed. there was truly no way this kid was shutting the fuck up. "you don't have to -" "no, it's fine." you assured joel while making sure that your daughter was liking her food. you threw a glance at joel to see his reaction and he was looking at you with his face more relaxed than usual. his brow was not furrowed and his eyebrows were arched, trying not to show how interested he was in your answer but at the same time very annoyed because of ellie being so nosy. "he left." "shit- i'm sorry." you shook your head. "it was before she was born. it's better this way, you know? if he was gonna be a shitty dad, i prefer him not to be around." "hell yeah. fuck him." ellie said while nodding her head in agreement with what you were saying. joel threw another deadly glance at ellie after she cursed in front of you and your kid. " i bet you are the coolest mom, right joel?" ellie's words made you giggle but you were also waiting for joel's answer. it was easy for him to empathize with you since you were going through the same thing he went through with sarah. he found it very easy to be a single parent. sarah was the best kid and he had you and tommy to help him. but you were alone, you lived alone, you had to go to work, and you had to take care of your daughter. he clenched his jaw. "that's right."

when you showed them your house, ellie loved it. she lay down on your couch, she opened your fridge, she sat in front of the fireplace, she turned the lights on and off multiple times, checking that they were indeed working. joel told her to stop but you assured him that it was okay, you liked seeing the girl so excited over such small things.

joel on the other hand was static next to you while ellie played around. your daughter was looking at him with her head resting on your shoulder, and joel looked at her from time to time only to find that the baby was still staring at him.

you showed them the rest of the house. ellie had her own room, which was meant to be your daughter's future room but she could have it, and you would share your room with joel. but after seeing his face, you thought it might have been a better idea to offer him the guest room.

"we also have a guest room. there's no bed but there's a couch and the heat doesn't work there but if you want-" "oh no, old joel will be great here." ellie appeared behind him, giving a few pats on his shoulder. you smiled at the girl but waited for an answer from joel. he was trying so hard to ignore the crib next to your side of the bed and how the little girl was sitting in the middle of the mattress, playing with her stupid little toys and violently sucking on her pacifier. instead of that, he decided to remember all those nights sleeping with ellie either in the woods or in the car, and the way he could hardly move when he woke up the next day because his body ached so much. but joel also remembered how good it felt being your little spoon and waking up next to you. of course, he didn't expect things to be like they used to be, but probably sleeping next to you was the only thing he had left of what once was his home. "this is okay." "great! and it's not as if we haven't slept together before, so..." you added trying to downplay the issue. "woow." ellie was so interested in this. "how is that?" "no-" "we were neighbors, and sometimes we-" "enough."

you knew why joel was so distant with your daughter. meanwhile, ellie loved to be around her, joel tried as hard as he could to keep his distance. you lived next to them and in the afternoons you helped sarah with her homework. you stayed with them for dinner and then enjoyed a movie or played some board games with them. the night the outbreak started, joel knocked on your door and told you to go inside his truck immediately. you were familiar with the relationship joel had with his daughter and you knew what a shock it had been to lose her. that's why you didn't blame him for his behavior.

"is she okay?" joel asked you half asleep and you hummed in response. "she's just hungry. i'm sorry. you can go back to sleep." you sat on the edge of the bed, rubbing the sleep of your eyes and picking her up in your arms. you mumbled something to her and kissed her forehead while you started to softly rock her in your arms. "no. how can i- how can i help?" joel sat on the bed and waited, noticing how she calmed down after you took her in your arms. the light coming from the street illuminated your silhouette and allowed Joel to appreciate your daughter's wet face. "hm- i need her bottle. it's ready in the kitchen. if you could heat it in the microwave for like a minute, that would be great." while he waited, he couldn't help but think of baby sarah in his arms. her cheeks were wet and her eyes were wide open, joel had to leave early in the morning for work but he didn't mind staying with her up all night if it was necessary. joel was trying to distract her until her bottle was ready, letting her small fingers wrap around his big one. joel had to take a few seconds before going back to the room with you, his hand pressed against his chest trying to control his breathing. once he came back with the baby's bottle, he sat by your side, handing it over to you and nodding after you thanked him. he watched as she enjoyed her meal and as you softly rocked her in your arms. your head fell on joel's shoulder and he didn't know what to do so he just stayed with you like that until you finished feeding her.

"i'm late. i'll see you at lunchtime." you couldn't be late another time, maria will literally kill you. you placed your daughter in joel's arms before you could remember how hesitant he had been with her and he had no other choice but to hold her so she wouldn't fall.

"are you okay? do you want me to take her?" ellie asked after seeing joel's shocked face. he held the little girl with outstretched arms, keeping her away from him. the baby cooed and extended her arms wanting to reach joel. she opened and closed her fist, getting really impatient and starting to make sounds of discomfort. the man frowned and had no other choice but to hold her against his chest. "shit... well done, joel. look, she even seems to like you." ellie added when the girl hid her face in joel's neck.

a few days after that he seemed to be closer to your daughter, you even caught him playing with her rattle, your daughter lying in her crib and with her arms up in the air trying to reach the toy. he was serious, not allowing himself to show how he really felt. your baby laughed with him and you decided to leave the room carefully to not interrupt the moment.

he started with small things like letting her hold his thumb between her fist every time he noticed she was staring into his soul again, and always keeping an eye on her when ellie was helping her to walk in the snow in case she fell or got tired of trying. then joel started feeding her, cutting the fruit into very small pieces, making sure that the milk wasn't too hot or too cold. at first, just sitting by your side but she was too distracted by his presence to eat so he had to start feeding her eventually.

you sighed in exhaustion once you entered your house. "i'm so tired." you sighed again and rested your head on joel's shoulder. your baby was half asleep on joel's arm, visibly comfortable by the way she cooed every now and then and by the way she rubbed her face against his arm. joel was rocking her softly. using one finger you tickled her belly to let her know that you were home. he put her in her pajamas, fed her dinner and you would even say that he had bathed her by the way her little curls were still damp. "she likes you." you said. he brought the pacifier to her mouth and with closed eyes, she quickly caught it with her lips. "she likes you more than me." "that's not true." joel spoke with a low voice, being careful not to be too rough and wake the child up. he turned his head to look at you, his eyes finally leaving your daughter to pay attention to you. you also looked at him with your head still resting on his shoulder. "you like her more than me." you pouted, trying to stay focused on his deep brown eyes and not on his lips and how close his mouth was to your face. "also not true." you smirked and moved one of your hands to play with your daughter's. she squeezed your index finger tightly between her tiny fist while joel kept looking at you. all that you had now should have been with him. your daughter, your house, your life. before the outbreak happened, one night drinking a few glasses of wine at his house after sarah went to sleep, you told him what you hoped your life would be like. you wanted to find your person and maybe even get married, you wanted to travel, moved in with them, start a family, raise your children, have movie nights. not much different from what you had with him at that time. you were almost there, touching your dreamed life with your fingertips, if you only had more time... when joel realized, your eyes were on him again and you had his chin between your thumb and index finger. your thumb brushed his lower lip, testing the waters, and his eyes slowly closed. you understood that as a green light to continue so, you leaned towards him and pressed your lips against his. just like that, no need to move them or rush things. you just missed feeling his lips against yours as much as he did. the kiss lasted ten seconds at most, but it was enough time for your breaths to mix and for joel's body to truly relax after months. you showed a little smile to him after the kiss and the soft look on his face let you know that he was satisfied. you went in for another kiss and he had his eyes closed already but then all of a sudden, your daughter on joel's arm started crying. "oh, i think someone's jealous."

5K notes · View notes

lovelybrooke · 3 months

Note

I saw your post for Hazbin Part 3 ideas so I’d like to help!

Idea one: Immortal reader(that’s what I’m calling them) “dies” again and goes back to hell.

Ideas two: Charlie and the others hesitantly get Lucifer to help and Lucifer also becomes a platonic Yandere? (I swear this man needs another daughter and the fact that immortal reader doesn’t have a dad)

Idea three: this one ties into the second idea. Charlie and the others get Lucifer and they all go up to earth only to see immortal reader going about there life. Oooo what if Lucifer recognizes them? Like back when they “died” as a kid they met Lucifer but immortal reader doesn’t remember because they were a kid?

Idea four: What if immortal reader finds out about them not being able to die? That there mom or someone tells them about an curse being places or a spell gone wrong causing them to be immortal. What if every time they died they get a scar reflecting that specific death?

This was all I could come up with at the moment but if you need more I can give more!

I've been thinking a lot about idea two and three because I do want to include Lucifer because I remember when I first saw him in like some art somewhere and was like "oh he gonna be so evil and scary" and in reality he's just a sad dad, which I love.

Imagine reader still being in hell when Lucifer shows, and with all the talk about fathers, reader reveals they never knew their dad.

(little blurb below the cut)

"Wait--really?" Charlie frowns at the declaration, her father sharing a similar look. You just spent the last two minutes listening to Lucifer, Charlie's dad, argue with Alastor about god knows what. When Charlie told you her dad was coming over, you imagined him, the supposed ruler of hell, to be more scary. You definitely did not expect him to be the way he was now, almost like a wet cat. Though you couldn't doubt that he cared about Charlie.

Eventually, you even got pulled into the argument, with Lucifer demanding you to pick who the better father was. You didn't want to cause an even bigger argument, so you simply said that you couldn't pick since you don't really have a point of reference, which ultimately led you to where you are now.

You shrug "Yeah, I mean I've seen pictures but that's about it." You say blankly. It never really bothered you since he was never in your life. Your mother didn't really talk about him either, other than when she was drunk, and those were all just insults. There was a time where he called the house looking for your mom, sounding angry. You got scared and hung up before you could say anything. You never told your mom he called.

Angel lets out a low chuckle from his seat at the bar "wow--just another thing to make you sad." You didn't know if that was a joke or not, but for some reason he looked upset.

You couldn't focus on that for long though, since Charlie was rushing up and giving you a big hug "Oh I'm so sorry--Dad! You can't just ask questions like that!" She reprimanded him.

"It's not that big of a deal..." You said, subtly trying to push her away.

"Of course it is--I wouldn't have brought him here if I knew--"

"Charlie, I don't care, I promise." You say, more firmly this time. Finally, she let you go, though the solemn look didn't leave her face. Looking over, Lucifer matched the look on her daughter's face. Alastor however, was smiling wide, like always, though you could see his look become softer when directed at you.

Maybe it was all in your head though.

#yandere x reader #soft yandere #platonic yandere #platonic yandere hazbin hotel #yandere hazbin hotel #hazbin hotel x reader #hazbin hotel

663 notes · View notes

qiwoomi · 1 month

Text

officially yours (his)

gojo satoru x fem! reader

fluff, established relationship, marriage, modern au, slightly suggestive in the end

a/n: idk how long it's been, almost about a year but I'm back again. this time school isn't an obstacle anymore :] wrote this while seasons - wave to earth is playing in the background

If years ago you're telling the Gojo Satoru you would marry him, he would tell you it would be a dream out of reach. Because back then, he's not confident in himself to make someone as beautiful- inside and out as you happy. It might be because of his rough past, and he didn't want to risk you going through it as he doesn't want you to get hurt.

You are too delicate, too fragile that he's sure that he doesn't deserve you. Hell, he would even risk letting someone else have you if it meant you don't have to go through a single trouble that he always endures. Though he's used to it by now, but you don't.

So how is it possible that here he is, standing on the shoreline of the vast ocean of your dreams, his shoes a little drenched and stained with sand. But never mind all that. His eyes are on you, teary and red though it won't fall. His lips are trembling, he wants to say something, but he knew that he would be sobbing and he promised himself that he won't ruin the ceremony that unite both of you in sickness and health.

There you are in your white wedding dress, your dream wedding dress, as you held the bouquet of flowers in your hand, keeping up a smile even though you're also on the verge of tears. Your eyes are blurry, but your father guided you to him, letting go of you as you're now standing in front of each other.

You allowed yourself to sniffle. Geto then starts doing the speech and declaration to officiate both of you in your wedding day, Satoru's eyes never fell from yours.

It's time to declare each other's wedding vows, which you anticipate. Satoru fixed his bow tie nervously, as you smiled.

"[Name], my love, my heart, my life, my everything." He starts, and his voice already cracked which earned a few laughs from your families and friends. He was full on sniffling, nose red as the first drop of tears stained his cheek. "First of all, I want to thank you a lot for everything you've done for me. Taking care of me even when I'm whiny and clingy, even though I stained your shirt with my snot as you patted me to sleep. Always being there to comfort me because you know that I'm not fine, even though I insist I am. You always knew before me, and this is one of the reasons why I fall in love with you." He manage to make through the first paragraphs, as onslaught of tears stained his cheeks again.

"Oh my god, I'm crying." He accidentally slipped into the mic, as chuckles are heard again. He's trying to wipe them off with his sleeves now. "Does anyone have a tissue?" He sniffled, as Geto handed him a q-tip. He tried wiping his tears with them, as it didn't do as much. "What does a q-tip gonna do? I need a tissue." He sniffled again, only realising the tissue in his breast pocket when you pointed them out.

"Ah, thank god." He sniffled, as he tried to compose himself while wiping his tears. Now the audiences were laughing, which makes you laugh too even though you're also about to drown in tears. "Okay." He cleared his throat, lifting up the paper in his view which is stained by droplets of tears.

"I'm sure that even if I continue listing them down, words wouldn't be enough to express my love to you- because it runs deep. And it is dangerous, at least this is what I thought when I was so young and naive, still learning what real love means." He sniffled. "But I got addicted to it, you're too addictive that I'm sure the thought of you will never go away. Everyday I wake up, I'm thankful that I even get the chance to be with you. And I try to make it last, even though temporary, these fleeting moments is my motivator."

He inhaled, before reading the next last paragraph. "My love, I want you to know that this has been my dream for the longest time. And to see and experience myself to be officially yours is a dream come true. I'm yours, always yours from the start and eternally. I promise myself from the start, and I want you to know that I'll always be with you no matter in sickness or in health, in the hardest days of your life or the easiest. I love you wholeheartedly in all versions of yourself. My heart, I have devoted myself to you, and should you think that I'm not, I'll always remind you through my actions. I love you, my [Name], my wife now and forever."

Gojo Satoru managed to finish, his tears are now at bay only for it to stream continously again when it's your turn to recite your wedding vows. It is safe to say that Gojo Satoru cried more than you, and he took 1 to 2 business days to process your marriage before finally going back to his 'normal' safe. And you love him all the same.

bonus:

It was late on your wedding night, after making love with him. You laid on his chest, catching your breath as he caressed your hair, his eyes on the ceiling as if lost in thought. It was quiet, but you love it.

"My love?" He starts, his eyes now on you, admiring your features. His hand on your hair is so comforting, that it took you a second to answer him. "Mhm? What is it baby?" You asked, looking up at him with sincereness and love in your eyes.

He pouted, frowning a little. Whatever it is that's weighing on his mind, you want to make it go away. "I'm sorry for ruining our wedding. I just can't hold it- you know. I never thought we would go this far." He mumbled, as you now start cupping his face, making him look into your eyes.

"Hey, it's fine. You know, I love that you're not afraid to show your true self. I love you. You make the wedding more memorable." I reassured him, speaking softly that he might even fall asleep to my voice.

Satoru didn't answer, though it's evident he's happy to know your thoughts now that his frowns and pout go away. "I love you too. You know, we're not even done for the night." He teased, now going back to his 'normal' self.

You slapped his chest playfully, though there's no denying it when your cheeks are flushed.

a/n: this is inspired from one of the videos I came across on ig (iykyk) I wish I copied the link but I lost it ☹️ the video literally screams satoru and you can't fight me.

EDIT: HERE'S THE LINK GUYS!!!

est. 250324

do not copy, translate or repost my work.

#gojo satoru #gojo fluff #gojo x reader #jjk gojo #gojo angst #jjk x reader #jjk fanfic #jjk fluff #gojo satoru x reader #gojo x you #gojo x y/n #gojo satoru x you #gojo satoru x y/n #gojo satoru x female reader #gojo x female reader #jjk x fem!reader #jjk x you #jjk x y/n

479 notes · View notes

remember-the-fanfics · 2 months

Text

An asked 'I feel like if Adam met the gen Z overlord before he came to the hotel they talk circles around him.'

But it came out as their first interaction, they still roasting Adam when they can.

Set in the first episode

"Ah yes, the first man. The reason I had to live my life and have responsibilities. So wonderful." Said (Y/n), after Adam revealed who he actually was..

"Who the fuck do you think you're talking too? I'm the dickmaster!" Adam said finally noticing (Y/n)'s presence in the room.

"Well being the first man, you really had nothing else to compare it to." They told him with a smile.

"This is (Y/n), they came with me because-."

"I don't trust any of you so I'm making sure Charlie stays safe." (Y/n) finished the sentence not wanting Charlie to soften any words with the Angels.

"No sinner should be here, I should end you for even setting a foot in here." Said Lute, glaring and getting close to (Y/n), who just glared back while getting up from their chair.

"Test me, bit-." Getting interrupted by Charlie pulling them back into their chair. (Y/n) looked at Charlie with a upset glare but settled back down while Lute returned back to Adam's side.

"I want to discuss biggest problem." Said Charlie, trying to get back on track on why she was here.

"Oh herpes. Yeah, that's a bitch." Adam replied.

"Seems to be a you problem." Said (Y/n), seeming already done with Adam.

"No! Our... other biggest problem."

"Ugly people? Math? Global Warming? No wait, that's earth problem." Said Adam, earning a deadpan look from Charlie, who (Y/n) patted on the back.

"You can't change stupid, Charlie. No matter how you try." They whispered to Charlie. "But hey maybe he isn't a complete moron."

Which (Y/n) completely took back after tuning in to Adam being on a different topic now. Being sexist and boasting his own masculinity.

"Do you cope by being a complete ass?" They said, Adam completely ignoring (Y/n) went on.

"-expects you to pay the check but you're like 'Hey, I thought you wanted equality."

"I'm gonna kill him." Said (Y/n), looking at Charlie.

"No! Our shared problem of overpopulation in Hell!" Charlie finally said before (Y/n) could try and kill him.

"Ohh, well that's not a problem! We got that covered." Adam said before turning to Lute. "Lute, how many demons did you kill this year?"

"A good 275 this year, sir."

"275? Woah, badass! Awesome job, danger tits! Pound it." Adam said putting his hand up for a fist bump which Lute did.

"That's not good! They aren't your people to kill!" Said (Y/n), upset with how casual the two seem to be about it. "They are Charlie's people, me including."

"Well that must suck for you." Said Adam before laughing, making (Y/n) pissed. But Charlie jumped in before they could get any more heated about it.

"But these are souls...Humans souls just the same as the ones you have up in heaven." Said Charlie, getting (Y/n) to sit back down.

"They're not the same. They had their chance and they earned damnation." Lute coldly said before looking at (Y/n). "Like you."

"Oooo, so scary." Said (Y/n), flipping Lute off.

"You're wrong. Sinners made mistakes, sure, but everyone makes mistakes." Said Charlie.

"Angels don't make mistakes."

"You really believe that?" Said Charlie and (Y/n).

"I know that."

"Yeah, I've never made a mistake in my fucking life." Said Adam.

"Didn't you get kicked out of the Garden?" (Y/n) asked him.

"That was one tim-."

"And apparently had your first wife leave you."

"Low blow, tiny." Adam said before Lute walk around the table to where Charlie and (Y/n) was seated.

"The only reason you're still here is because daddy gave you and your hellborn kind a pardon from an exorcist blade. How does that feel, to know how little you matter?" Lute said, taunting Charlie.

"Bitch, he probably did that because he cares about her." Said (Y/n), glaring at Lute. "So go fuck yourself with a chainsaw."

"Nothing is stopping me from killing you now, sinner." Lute said, getting close to (Y/n)'s face for to long before moving on.

"Opps, almost out of time. Guess we should get into it." Said Adam.

"Oh fuck!" Said Charlie, getting her presentation ready. "Okay I've got a lot to get through and not a lot of time and I feel like you weren't hearing me before so here it goes."

-I ain't typing a whole ass song-

"-Ugh, Shit!" Said Charlie, after (Y/n) and her got pushed out of the room.

"Mother- trucker!" Yelled (Y/n), not wanting motherfucker and Adam in the same sentence or thought. "Dude that hurt like a buttcheck on a stick." They said getting off the floor and helping Charlie up.

"Are you okay? You weren't treated kindly in there." Asked Charlie.

"It's fine, I knew what I was walking into when I came with you." Said (Y/n), shrugging.

"I'm sorry you got dragged here for nothing." Charlie said before getting a side hug from (Y/n).

"You got nothing to apologize for. I knew from the dipshit's face from the start it would be a long shot if he is in charge."

"Thank you, (Y/n)."

"Soo.. 6 months, huh? I have to go back to my territory to get ahead start with that but I'll meet you at the hotel afterwards, okay?"

"Alright, see you then!"

"Byyyyeee~" With that (Y/n) took off to their territory.

"(Y/n)... where have I heard that name before?"

#hazbin hotel #hazbin hotel x reader #platonic hazbin hotel #hazbin charlie #charlie morningstar #hazbin lute #hazbin Adam #makes me want to write a fic #but then again so much typing would be needed #genz reader

596 notes · View notes

nariism · 4 months

Text

*ੈ✩ LAST WORDS OF A SHOOTING STAR

pair. itadori yuji x reader

synopsis. in the 3 days following the shibuya incident, itadori yuji emerges as a husk of his former self. with his immediate execution resumed, you both grapple with the feelings you have for each other and come to terms with his impending death.

content. hurt/comfort (lots of comfort, thank art because i was gonna be mean about this and they convinced me not to), slightly canon divergent (taking place between shibuya and the culling games), fluff and minor angst, yuta is the best wingman

wc. ~4.4k

NOVEMBER 1 2018

You imagine that your face was rather ghastly when you received the news.

"Execution?" You repeated, the word tasting bitter on your tongue. No, that was the wrong description. It tasted of death—like iron and the depths of Hell filling your mouth until you were gurgling on it.

Unlike the rest of the Jujutsu Sorcerers from Tokyo, you had been ordered to stay back with Shoko in case of an emergency. You remember your exile from battle had left a similar rotten flavour in your mouth.

You vanished off the face of the earth after the incident was over. Most probably presumed you died in the aftermath. Devoured by a curse, they would say and shake their heads. You were always troublesome. And then they would move on with the rest of the world, all the same.

Lives were only temporary in the world of curses. Focus on who you can save, not who is already gone. They'll only end up a curse in your sleep. What a horrible notion to have.

The truth is that you'd been whisked away with Yuta, who seemed to be scheming a plan of his own. Perhaps as a middle finger to the higher ups he hated so much, or perhaps just for his own selfish reasons. You wouldn't know until he was finished carrying it through—he's too good at keeping secrets.

He wanted your reverse cursed technique, you knew that much for sure, even though he could do it himself. You were useful by his side, fitting into his plot in a way you could not in Shibuya. Feeling some sort of obligation and satisfaction, you followed him like a lost puppy.

And now here you are, seated by a dimming fire in the abandoned part of the city. Yuta was too clever for his own good. You suppose Gojo taught him some things well. This was their plan after all.

Yuji was safe, if only for this moment in time.

"Now with Gojo gone, it would have been easy for the higher ups to send assassins your way."

Ruthless and truthful, you flinch, but Yuji does not. He remains perfectly still in your hold, with your hands rotating his face around to get a better look at his wounds. You pour your cursed energy into him, hoping to breathe life back into his eyes, but they stay dull and empty.

"We'll find a way to stop this," you assure, reaching over to take a sanitizing wipe to clean an open cut. Yuta was too rough on him, but it was at least believable that Yuji was dead. He doesn't even recoil from the alcohol stinging his flesh, too engrossed in his own thoughts.

"Why?" He asks weakly. You gawk at him, but then it melts away into a softness that finally makes him blink up at you. "I'm evil."

"You're not evil, Yuji."

"I am. I killed those people. I did." His voice comes flat and defeated, nothing like the one you used to listen to over dinner while he reenacted shitty western films.

You never realize what you'll miss until it's gone. It's hollow, the ache in your heart.

"You don't understand. How could you? All this blood on my hands—"

"It was Sukuna," you quickly refute.

"And Sukuna only lives because I do!"

His voice raises at you, causing the flames behind you to flicker and crack. It's enough for Yuta to step in, acting as a barrier between your tense bodies. Yuji seems to shrink at this, realizing his emotions have run amok and that he has yelled at you.

You only stare back at him in bewilderment, like a frightened animal. Your upperclassman shakes his head.

"Enough of this. We need to start making plans."

You lay awake that night, alone and anxious. Yuta has taken the first shift of watching and patrolling while the two of you rest, though hesitant to leave you alone. He told you it’s another reason he dragged you along: having three people to rotate shifts instead of just two would be easier on your bodies and minds. The city is not what it used to be, now overrun with curses of all grades.

You reassured him it would be fine, that you would fall asleep quickly and so would Yuji—his body has to run out of steam eventually, right? Oh, what a fool you were.

The tension is so heavy that it's awkward, even though you're sleeping on opposite ends of the tunnel.

"Sleep," you demand as if you were Inumaki, like you have the power to curse him.

His eyes flutter open. Even in the firelight, you don't see any shine in them, seeming as if they had been extinguished of life. "Why don't you?"

"I can't until you do."

"That's stupid," he tells you.

It's not the first time you've argued like this. Back when the world felt right, you would sneak in through his dorm window well into the hours of the night. Platonic, you had convinced yourself. You snuck into his bed seeking companionship as a friend. That's the lie you gorged on.

A piece of you knew, and you're sure he did too, that the way your hands explored his arms was unnatural for two friends, and that friends wouldn't sneak into each other's rooms like this with such severe punishment on the line.

It was safe in his arms, with the dull hum of his television running an old horror film in the background. You didn't have to think about much other than his warmth when you sat between his legs with your back to his chest. Or when his arm was draped over your shoulder and you were pressed into his side—actually, you think you preferred this one though you felt sorry for his sore arm.

You would bicker about dumb, pointless things. Which movie is better, or which character deserved to be mutilated more. It would go on for so long that Megumi would bang his fist on their shared wall to get the two of you to shut up.

There was no curse strong enough to change time itself, so you keep your thoughts and memories to yourself when you respond.

"You'll be too tired to function on your shift," you reason.

"You both will be fine without me." Better off without me, you know he means. You've gotten good at reading between his lines.

You slowly sit up in your sleeping bag, eyes never leaving Yuji. He seems so frail right now, even though he looks more adult than he ever has before.

"Human Earthworm 4 was better than 2," you suddenly say. His eyes peer open again in confusion.

"Huh? 2 was way better."

"I liked the love story in 4," you argue, slowly getting out of your bag to shuffle to his side of the concrete tunnel. He looks at you as if you've said something outlandish, too preoccupied with his thoughts to wonder why you've come so close.

"2 had the best special effects though."

Your body shifts under his blanket.

"But 4 had a happier ending." (As far as 'happy' goes in the Human Earthworm series, at least.)

His arm falls around your waist as it has a hundred times, pulling you into his chest.

"Whatever," he huffs. The next topic comes fast and you're thrown into a full blown conversation with him. If you concentrate enough, you can imagine your bodies being tangled together in his bed, safe and sound.

Concrete and fire and the stench of curses melt away until he's all you can focus on.

"You have weird taste in movies," he concludes with his eyes drifting shut.

NOVEMBER 2 2018

You think you know how to fix broken people until you find that they are more than skin and bones.

You learn one thing after the Shibuya Incident: there are wounds residing within Yuji just as much as there are marking his flesh.

Yuta, you realize, had left the two of you alone to sleep and has protected you all night. You'll make it up to him, you reason. Yuji deserved to sleep.

When you wake up to his sleeping face, you think his cuts are healing nicely. But then his expression twists up in terror—a nightmare, if he even had enough energy left in him to conjure up dreams. He murmurs in his sleep, shakes his head a few times and thrashes around so much you're surprised you slept through the night by his side.

"Sukuna," he's whispering. Sukuna, Sukuna, Sukuna. King of Curses. The second voice tormenting him that lives in his own brain like a parasite. You bury yourself into his chest and hold him as tight as you can. He relaxes, body releasing its rigid form, but the murmurs continue.

He is shattered beyond repair. No amount of cursed energy could fix that, even if you tried.

You had once watched Yuji electrocute himself trying to set up the janky old television in his dorm room.

He fell back onto the floor with a loud crash, head hitting the wood so hard you thought he might have a concussion. It caused such a racket that Megumi came running into the room asking what happened, demon dog ready behind him in case of an ambush.

You rushed to the floor, discarding all the food you had settled in your lap and crumbled beside him to scoop him into your arms.

"Yuji!" You called him. People rarely used his first name. You felt special, like you knew him better than others did and for some reason that was a privilege. "Are you okay?"

He laughed in your arms, seeming unfazed by the fact that electricity had run through every vein in his body. "I'm fine, see? My finger just slipped."

You and Megumi both sighed in relief, though you always thought it was strange when you reflected on it. Yuji was a funny guy, yes. He was equal parts humour and destruction but not a klutz. Mistakes happen, so you let it slide until now, but some part of you was nagging to ask.

"That day," you start while rolling up your sleeping bag. "You electrocuted yourself. Remember?"

He looks at you funny over his shoulder. Yuta has already started cracking open cans of food for breakfast, embers of your dead fire cracking.

"Hmm, yeah. I remember. Why?"

"I just thought..." you trail off. "Well, Sukuna makes you tough to a lot of things. I'm surprised small electric shocks aren't one of them."

Sukuna. A name you'd been avoiding since this morning. Sickening silence settles between you. It's so heavy that you pause in your cleaning to look at him, brow raised.

"Yeah," he coughs. "Well, maybe I exaggerated."

"Huh?" You sound annoyed now. "You scared us half to death!"

Yuji only falters in his own chores. When he looks at you again, there's a longing in his gaze that you don't know how you could have missed. Or perhaps it was never there until now.

"It was nice to have you fawning over me," he admits.

The day goes on and all you feel is a terrible grief.

You become painfully aware of each millimeter the sun glides across the sky, from one horizon to the other. Time slips through your fingers fast as sand.

Horrifically, you can't find anything to talk about to fill the emptiness—Nobara and Megumi feel off the table considering the extent of their injuries. You don't even dare to breathe Gojo's name, let alone speak of him so boldly as Yuta is.

You're afraid that Yuji will spiral again, confused and unwilling to cooperate with his judgement clouded by loss. It's not your fault, you would say. It is, he would argue. It would do neither of you good, so you idle around while he and Yuta devise plans to tiptoe around the higher ups.

A part of you knows that if either of you told him to submit and die, he would. He's already teetering on the edge of self-destruction.

On the outside, he seems perfectly indifferent. Gaze steady, face stone and unchanging as he speaks. He's doomed, ill-fated, someone full of misfortune. He looks so lonely that the air itself parts for him where he stands.

To shoulder so much responsibility, so much death, maybe he truly is alone. Some fraction of him, at least—a piece of himself only he would ever understand.

Your hand snakes into his without a second thought. You don't know why you did it, nor do you have any reasoning that he doesn't yank away from you. His hand trembles, and it's then that you realize his whole body is wracked with tremors that don't match his distant disposition.

The second thing you learn is this: when Yuji self-destructs, he does it from the inside-out.

Itadori Yuji loves chocolate cake.

He loves all food, really, acting like your friend group's personal food dumpster whenever any of you were full. But chocolate cake you knew he had a sweet tooth for.

You used to bring it with you to his dorm, stopping by the convenience stores on the way home to grab a pre-packaged slice from the fridge for him to eat.

"You're making a mess," you would tell him with a frown, using your thumb to wipe up frosting from the corner of his mouth. You would lick the pad of your finger clean after that, and he would watch almost in a trance.

It's the reason why you stop on one of your patrols, poking through the fridge section of a convenience store. The power has been out for a long time in this part of the city, all the food is already room temperature, but you figure this is fine as long as it smells okay.

The way Yuji's face lights up when he sees you is all it takes for the worry to go away.

It briefly feels as though nothing has ever gone wrong—that after this slice of cake the two of you will tumble back onto his mattress and turn on another showing of Titanic. (He groaned about it once, saying he got KO'd too many times during this film. You only laughed in confusion.)

At the end of the day, you know those days will never come back to you, lost forever in the wind.

Fire dances before you and you watch, enchanted by the flames. You remember last night, how not even the firelight could make Yuji look the same as he did before. You turn your head to look at him, to see if it's any different tonight, just for your cheek to be caught in his palm.

His thumb traces your lip, the way you used to do to him. You recognize the pull of his finger against your flesh, the swipe of it to get frosting off, but he still seems dissatisfied.

"What?" You ask.

"It didn't come off," he mutters, leaning in dangerously close to observe. Heat rises all the way to your cheeks and makes your hairs stand on end. His touch is like molten lava. You wonder if it has something to do with the monster living inside of him.

"I can't see it," you whine without a mirror.

He draws a little closer, until he's inches from your face. "Let me..."

You've suddenly been dropped into cold, unknown waters. This is all unfamiliar. He's rushing this, as if making up for all the time the two of you lost pretending you were only friends. As if he can cram all the things he's wanted to tell you into one night.

Recoiling away, you find yourself hesitating. If he kisses you, this all becomes too real. It's an acknowledgment of his impending death. That the thread of his life is finer and further stretched than yours is.

An unpleasant thought rings through your mind. What if I become a curse on him?

"This only ends badly for us," you whisper, but the conviction is missing from your voice.

He doesn't care. At least, it doesn't look like he does. Who knows what he's thinking right now?

"Who cares?" He says. "We're Jujutsu Sorcerers. Everything bad happens to us no matter what."

You don't have any rebuttal to that, no argument that forms in your mind that could challenge his words. He was right. Only disaster befalls Sorcerers. Disaster and grief.

For a while you had forgotten, living these idyllic months watching the days pass by. You feel like you wasted that precious time worrying about stupid things, like what to have for breakfast or what kind of snacks you should pick up for movie night.

(It ended up being popcorn every time. He liked to piss off Sukuna with it, saying the King of Curses would never get to experience the pleasure of picking out kernels from his teeth. You scoffed but bought it anyway.)

Another thought crosses your mind: Yuji is more fit to be in a rom-com, or a television series where the good guys always win. Not this tragedy. Not this massacre.

You wonder if he's ever felt the same way. If he ever wished he could reach into the sky and turn the sun back to a time before he even knew what a curse was.

If you’d met each other under different circumstances, would this have been a different story? The thought makes your heart ache, a part of you so deep that even if you reached into your chest and plucked it, you'd still wail.

"Can I?" He asks you, eager but quiet. Had this been a few months ago, you imagine that he would have had this spark in his eye. That his lips would be crashing into yours with no inhibition.

But Yuji has always been selfless, you think he always will be. He doesn't want to drag you down if you don't want to—an out, they call it. An escape route just before he careens into a ditch.

Hope has drained from every inch of his expression. This is his loneliness talking.

Despite the dread that licks up your spine, you cup his face. You swear he jolts slightly beneath your touch, as if you've reached out to strike him down. A retribution he believes he deserves.

He kisses you like it's his last day on earth.

You learn one last thing: Itadori Yuji tastes familiarly of death.

Yuta decides to leave you alone for a second night in a row. His presence is so crushing that you know he's alive, but he stalks off somewhere else, leaving just you and Yuji huddled by the pitiful fire you've built.

He once claimed himself jokingly to be a love expert, and then ran off to Kenya for so long that you lost track of how much time passed. You wish you'd asked him before he left what he meant, but at the time it seemed irrelevant. Insignificant. The name Itadori Yuji had not yet been impressed into your heart like a seal.

You're busy setting up the sleeping bags, this time pushing them flush together. They're so close you can barely see the seam between them. Yuji stands on the other side of the fire, watching.

It reminds him of all the times you'd ever scolded him for not making his bed in the morning. I'm gonna crawl back in tonight anyway, he said. Who cares if it's messy?

Idiot, you would call him. But there was no malice behind it. He treated it like a pet name, a badge of honour to be your idiot.

Life felt so simple back then. He was full of determination and life and stuck to his morals as best he could. When he wavered he would text you to come over so you could fall asleep on his chest and suffocate any other thoughts out of his head.

"I've never felt so powerful before," he admits quietly. You turn to look at him, curious. "Like I could do anything in the world."

There's a negative connotation to that, you know. He could do anything. The world would crumble at his feet and there he would stand, laughing at it all. It isn't his will, not even slightly, but the demon taking refuge in his body would love to see the blood pool.

"Like I could just... reach out and—"

"Yuji!" You hiss, lurching forward to take his hand into yours and retreat from the flame. The skin is already pink and blistering, scorched by the embers. You twist his wrist around, observing where the fire licked the deepest, and pour your energy into him.

When you look up to see if he's crying, or at least grimacing in pain, you find only his smiling face—warm and adoring. For a second it feels like the world isn't burning around you.

It was nice to have you fawning over me.

You wipe that stupid smirk off his face, leaning in to smear a kiss along the scar on his lip.

"Idiot," you say, and he laughs for the first time in so long that it sounds foreign in your ears.

(He doesn't fall asleep that night. He would rather savour the sound of your soft snores, memorize the form of your body in his hold, and try his hardest to burn this into his brain.

So be it if you come to curse him one day. He would welcome you with open arms.)

NOVEMBER 3 2018

The day comes when Megumi sneaks into your hideout, asking for help.

His sister, he explains. He needs help saving Tsumiki. For some reason, resentment boils in your stomach, but then it's snuffed just as fast.

Two days and two nights you've spent pretending Japan isn't collapsing, content with sitting idly by as curses overran Tokyo. You're sure Megumi thought you to be cowards, that you were all hiding under this bridge to wait out the hellstorm that was raining down on your homes.

It was true to some extent. Once Yuji stepped out into battle again, that was that. You're not sure things would ever be the same again, though you suppose you lost the privilege of routine days ago.

"Let me come too," you urge. Three pairs of eyes land on you.

"No," Yuji pushes. "It's dangerous."

"I can fight!"

"You can't," he pauses, then corrects himself, "You won't."

Awkward silence settles over your encampment. Yuta stirs, standing to hold you steady by the shoulders.

"If we need help... if one of us is hurt, we'll need you unharmed. Do you understand?"

Ah, ever so wise, your upperclassman. So easy to persuade you. There's a reason why he's the chosen one only second to Gojo.

You swallow the bile that fights up your throat. "What if you don't come back?"

Yuji steps in this time, knocking away Yuta to hold you by the face. Get a grip, this means. Pull yourself together, don't you dare fall apart in front of me.

"We will."

You once considered telling him how you felt, letting it eat away at you until Nobara groaned in disgust.

“If Itadori starts dating before I do, I’ll puke.”

You remember that you laughed, thinking she was so dramatic. You loved that about her. “I think you would do worse.”

She glared at you, foot lightly kicking at your shin under the table. Still, she made sure to push equal amounts of rice to your side of the plate. “I might burn a village down,” she huffed, placing her chin on her palm.

“You’re fine. Even if I told him how I feel, I don’t think he’d accept.”

“Huh?” Nobara sounded genuinely confused, raising a brow at you. “What makes you think that?”

You didn't know how to answer that. Maybe you were just afraid that you had misinterpreted everything, that the way he held you was protective in a familial manner and that he would slam his door in your face when you tried.

Looking back on it, you can imagine him in the next room ranting about the same things to Megumi.

“He still has posters of Jennifer Lawrence on his wall,” you argued weakly while shoveling rice into your spoon. She watched you take your bite with her lips parted in disbelief.

You wish you had told him, then. Not that it would have changed where you both ended up.

You watch as they pack up their things.

Megumi's demon dog keeps you quiet company, tail thrashing against the ground as you slick back its fur. They talk around the dying flames, devising plan after plan. None seem safe. None would be.

Yuta and Megumi leave first, taking the lead in front of the pack. His dog melts into the shadows and disappears, leaving you sitting alone.

"I want to take you back, but..." Yuji glances over his shoulder toward his death sentence. "Will you make it okay on your own?"

You get up slowly, as if to draw out the time he stands before you. A thousand questions run through your head: what if you never see him again? What if this kills him, not by body, but by his already damaged soul?

He must sense the racing of your mind, so he leans in to engulf you in his arms. In an instant, memories of those days spent lounging in his bed, shoveling your food onto his plate, and purposefully talking louder to tease Megumi come flooding.

A year you would never forget. You're sure it'll become a curse if you dwell, so you tell him: "I'll make it. You go on, they need you."

I need you, too. Stay. If only it were so simple.

He smiles at you, warm like the sun that's hidden behind the barrier. Itadori Yuji looks like a ghost of his former self, battle-worn and covered in scars where his skin used to be smooth. He kisses you again for good measure, making sure he remembers the way you sigh into his mouth.

When he pulls away, there's life gleaming in his eyes.

"Let's watch Human Earthworm 5 when I come back."

Your thumb brushes the corner of his lip. You open your mouth to speak, to finally tell him the truth after all this time. You'd rather not die regretting you never said it, after all.

But you stop.

"I prefer Titanic," you confess. He shakes his head and kisses your forehead. Then he’s gone, taking all the warmth with him.

You'll make up for lost time one day. It won’t be today. You can tell him all about your feelings when he comes back to you.

914 notes · View notes

cherubfae · 2 months

Note

I'm the anon who asked if you write for mammon and adam. I just sent the ask in, but regardless of your reply i was wondering of you could write the hazbin cast +helluva boss cast (the ones you write obviously) with a super sleepy slot like s/o? Like they sleep all the dam time and are still tired as hell, so tired they literally fall to the ground while walking in silence for too much, they sit down for a second and go out cold. They move so slow it's incredible, theyre always super clingy and always hanging on by their shoulder, It's very concerning.

lmao this made me cackle. Here ya go, sweets! Apologies if you wanted something serious, I literally couldn't 😭😭 just had lunch with my mama to celebrate her belated bday and I'm very full

sloth!like partner || hazbin/helluva boss x reader

tags: fluff, comedy, this is probably mostly crack lmao, established relationships

Alastor

Okay but remember him with the Egg Bois? That's essentially him waiting for you to get ready for your date. What feels like an eternity was only roughly thirty seconds. He hopes you haven't fallen asleep in the bathroom.

"Dearest... I could just teleport you to places with my shadow provided I'm somewhere near." He suggests. It takes him a while to get used to any sort of physical contact so he's not crazy about the clinginess and does what he can to establish boundaries if and when he feels comfortable doing so.

Lucifer

Haha! You're so adorable! He actually quite likes having you on his arm, though sometimes not literally. It's comical watching you climb him and then slowly lose your energy halfway to his shoulders and slow-motion crash land towards the ground. Rinse and repeat.

Husk

By now he's quite used to you falling asleep, especially on him. You tucker yourself out so easily, he wonders what tricks Belphegor has up their sleeves lately. Husk loves you for who you are, but he is rather curious if there's anything that can cure or at least lessen your narcoleptic behaviors.

Angel Dust

Constantly cracking jokes and puns. Some of them can come off as a little mean though it's never intended to hurt your feelings. Though, he does know not to make the 'slow-burn romance' jokes every time you guys have a date night.

Vox

He's gotten used to you being constantly sleepy and rather sluggish. He does wonder if you are, in fact, a Hellborn from Sloth instead of a Sinner sometimes or if you drew the short straw. Vox is typically okay if you're constantly sleepy and a bit sluggish, but he is a fast-paced guy and likes all aspects of his life to progress at a decent speed; romance included.

Blitzø

Deadass he's watching you slowly drag yourself face-down along the ground with a soft skrrrr skrrrr along the cement. Honestly he's surprised you made it on Earth as long as you did. This was amusing but the more you, literally, drag on Blitz isn't sure what he should do. He's probably gonna start driving everywhere. Gotta keep pollutin' bb.

Loona

With how often you sleep, Loona isn't sure how you still manage to be so tired all the time. It honestly perplexes her but she's learned to roll with it. If you're moving too slowly for her liking, she'll pick you up and carry you off like royalty-- or if you're small like Millie, Loona is gonna commit you to her backpack transit indefinitely.

Striker

|| I DON'T GIVE PERMISSION FOR MY WORKS TO BE REPOSTED, RESHARED, OR EDITED. TUMBLR IS MY ONLY ACCOUNT AND THE ONLY PLACE WHERE I POST MY WRITING. ALL CHARACTERS BELONG TO THEIR RIGHTFUL OWNERS, THE STORY BELONGS TO ME. || CHERUBFAE © 2024

"Ya'llright, darlin'?" He asked with a raised brow. You just ate shit and aren't currently really doing anything about getting back into the upright position. Striker's tail swishes curiously and he gently prods you with his boot, heaving a sigh when you move.

#hazbin hotel x reader #hazbin hotel imagines #hazbin imagines #hazbin hotel x you #helluva boss x you #helluva boss imagines #helluva boss x reader #alastor x reader #hazbin lucifer x reader #lucifer morningstar x reader #angel dust x reader #husk x reader #vox x reader #blitz x reader #loona x reader #cherubfae 2024

701 notes · View notes

mcflymemes · 5 days

Text

THE TORTURED POETS DEPARTMENT - THE ANTHOLOGY BY TAYLOR SWIFT PROMPT LIST * assorted lyrics from the album, some lines slightly adapted for meme purposes but feel free to adjust as necessary

even if it's handcuffed, i'm leaving here with you.

trust me. i can handle a dangerous man.

i love you. it's ruining my life.

does it feel all right to not know me?

i am who i am 'cause you trained me.

quick. tell me something awful.

i loved you the way that you were.

we were just kids, babe.

i can fix him.

you and i go from one kiss to getting married.

you said i'm the love of your life.

way up there, i actually love it.

i just don't understand how you don't miss me.

do you hate me?

did you think i had it in me?

what if i told you i'm back?

i still miss the smoke.

i'm not trying to exaggerate, but i think i might die if it happened.

you look like stevie nicks.

it's hell on earth to be heavenly.

i still can't believe it.

this happens once every few lifetimes.

didn't you hear? they called it all off.

it's happening again.

my friends say it isn't right to be scared.

i might just die.

fuck you if i can't have us.

tell me about the first time you saw me.

are you gonna marry, kiss, or kill me?

no one's ever had me... not like you.

stay away from her.

there wouldn't be this if there hadn't been you.

i don't think you've changed much.

that's where i was when i lost it all.

life was always easier on you than it was on me.

i hoped you'd return.

do you believe me now?

what if your eyes looked up and met mine one more time?

what are the chances you'd be downtown?

is it something i did?

oh, we must stop meeting like this.

they say what doesn't kill you makes you aware.

i'm not a donor, but i'd give you my heart if you needed it.

looking backwards might be the only way to move forwards.

the story isn't mine anymore.

what a charming saturday!

none of it is changing.

wild winds are death to the candle.

one bad seed kills the garden.

i'm bitter, but i swear i'm fine.

this place made me feel worthless.

i didn't want to come down.

everything had been above board.

blood's thick, but nothing like a payroll.

you can mark my words that i said it first.

the professor said to write what you know.

all of this to say, i hope you're okay.

your words are still just ringing in my head.

i built a legacy which you can't undo.

who do i have to speak to to change the prophecy?

the effects were temporary.

no, i'm not coming to my senses.

babe, you gotta fake it 'til you make it.

you know you're good when you can even do it with a broken heart.

i guess a lesser woman would've lost hope.

thought of calling you, but you won't pick up.

you're a professional.

long may you reign.

you're an animal. you are bloodthirsty.

now i seem to be scared to go outside.

i don't believe in good luck.

i hate it here.

if i'd been there, i'd hate it.

only the gentle survived.

i'm lonely, but i'm good.

you have no room in your dreams for regrets.

i thought it was just goodbye for now.

are you still a mind reader?

let it once be me.

i haven't decided yet.

i still dream of him.

i'm so afraid i sealed my fate.

it was always the same searing pain.

i can't forgive the way you made me feel.

it wasn't a fair fight or a clean kill.

she used to say she wished that you were dead.

tell me all your secrets.

they tried to warn you about me.

you're in terrible danger.

i'm the life you chose.

yes, i'm haunted, but i'm feeling just fine.

no one asks any questions here.

tell me i'm despicable. say it's unforgivable.

i'm running back home to you.

you should see your faces.

you knew the price going in.

was any of it true?

who the fuck was that guy?

i don't ever want you back.

did you sleep with a gun underneath out bed?

you don't get to tell me you feel bad.

you wouldn't last an hour in the asylum where they raised me.

am i allowed to cry?

there's no such thing as bad thoughts. only your actions talk.

they're going to crucify me anyway.

i know i'm just repeating myself.

that's the closest i've come to my heart exploding.

272 notes · View notes

ohisms · 3 months

Text

↪ 𝐹𝐼𝐿𝐿𝑂𝑅𝑌 ⅋ 𝐅𝐔𝐑𝐓𝐇𝐄𝐑 . ( a collection of sentence starters from season one of syfy's the magicians . adjust phrasing as necessary . this prompt will be updated as time goes on . )

it's always something with you , isn't it ? it's always an emergency .

look , this is your responsibility .

wow , nice trick . i'm sure you're a hit at parties .

so ... you think you're ready .

i called you . all weekend . where were you ?

okay , we have got to pull you together .

you can't run away hard enough , can you ?

i know where you were all weekend .

life is raw , everybody medicates .

i love you . call me , okay ?

am i hallucinating ?

come on , or you'll miss it .

can i start over ? please .

i'm going to make sure you don't remember a thing .

playing with time is such difficult magic .

don't bother trying to compare yourself .

it's good to be aware the world is blatantly unfair .

it's my fault that they said that .

if you think my family is some sort of advantage , you've been misinformed .

maybe i wouldn't let myself forget .

that was before i knew there was something else .

it's really okay if this is not your thing .

you're hurting yourself , & you're not okay .

i just needed to see if i was right .

we've been watching you for quite a while now .

hello ? do you need help ?

you feel right because you're starting towards your destiny .

for some reason , you're involved . so be involved .

look , hold that thought , okay ?

i'm obviously coming with you .

there's no such thing as safe magic .

what is this place exactly , besides a health hazard ?

you ask a lot of questions .

jesus , you didn't tell me you were dangerous .

it's a little bit bigger than messing up .

there's a bad story every few years around here .

can you just help me live with myself ?

i'm gonna tell you something deep & dark & personal now .

i'm trying to tell you , you are not alone here .

i don't know . i wanna be your friend , i guess .

you should hate me right now .

the last thing i wanted to do growing up was read fantasy .

let's just say life wasn't exactly non-stop fun growing up .

if you're guilty , i'm guilty .

come do something stupid with me before you go .

okay , you know what ? i'm not interested in your personal issues .

this isn't just some lark to me , just so you know .

i mean seriously , what do they expect , you know ?

look , you can't run away from you .

there's nothing i can do in this moment to stop the comet from crashing into the earth , is there ?

i keep trying to tell myself that this is somehow better .

you don't see color & want to go back to black & white .

you can't help , & i can't help you .

what the hell was that , you maniac ?

why would you ever trust anyone ?

i'm willing to teach the right people what i know . & i know a lot .

you're lucky i can fix this .

hey , have you heard of karma ? sometimes it's instant .

i'm generous with you , considering .

get me everything on this list . this week .

why even ask , if you'll just forget it again ?

that's not a real answer .

you're a much better liar than i expected you to be .

do you think you have a destiny ?

there is no destiny . no born heroes .

you can either step up to it or not , that's up to you .

this is your problem , that you should solve !

#rp meme #inbox prompt #rp inbox prompt

499 notes · View notes

ghostlywhiskey · 7 months

Text

John Price - Hell on Earth - Part 1

Pairing: Lawyer!John Price x Fem!Reader Word Count: 2,427 Warnings: None Summary: Your a paralegal at a law firm and John Price is a top attorney - but makes everyone's life a living hell. And it only gets worse when he decides to make you his primary paralegal. Notes: Going based of this prompt/blurb I wrote. There will 100% be more parts - you think I'm gonna have lawyer!price and not have smut at some point? Absolutely not. Also let the record show, I did not proofread teehee<3 ▸read part two here ▸find my masterlist here

The phone sat snug between your ear and shoulder as the contents of your bag were shifted around with one hand, the other holding a coffee. Where is the damn keycard? Your thoughts block out whatever Morgan was saying on the other end of the phone. As you push through the revolving door, the keycard finds a spot between your fingers as you say good morning to the guard and head for the elevator.

“Morgan.” The name coming out of you is rather monotone as you try to grab your friend's attention from her ongoing rant. “Morgan, take a breath would you?” Eyes looking at the lights above the elevators to make note of which one you would be getting into.

“I can’t take a breath! Who goes on five dates with someone and just poof! Hey, I don’t want a relationship?” her voice belted through the phone loud enough that you would think your phone had the speaker option selected. The sudden exclamation in her voice causes you to pull the phone from your ear, eyes glancing to see multiple emails come in from Price about various different cases that had been transferred to you in the past three weeks.

“Son of a bitch.” you mutter as you stand in the elevator, scrolling through twenty new emails, all delivered at 8AM. He fucking prepared them to be auto-sent. Is he fucking kidding?

“Hey, are you there?” Morgan’s voice echoes through the phone, quickly putting it to your ear.

“Sorry, work is already chaotic. Can I call you later? Or maybe drinks after work?” voice apologetic, but your anxiety is already focusing on what needs to get done for the day.

As you push through the doors of the firm, ‘good mornings’ are thrown around from your coworkers as you make your way to your cubicle. The door to his office is wide open, the lack of yelling and aggressive taps on the keyboard nowhere to be heard - He isn’t in yet, thank fuck.

Your bag drops onto the desk along with your coffee next to it, body dropping into the chair as you stare at the black screen. Eight hours to go. Hand grasping the mouse, you give it a shake as the dual monitors come to life and type your login quickly. The inbox rapidly catches up to what your phone already knows - 127 messages. Twenty of them are Price’s alone from this morning.

Monday, August 7, 2023 - 8:00 AM

Subject: K. Laswell - Deposition of Our Client

━━━━━━━━━━━━━━━━━━━━━━

Good Morning,

What is the status of getting the deposition set up? Why is no one agreeing? Call them and get answers. Tired of the emails flooding my inbox.

Very truly yours,

John Price, Esq.

Monday, August 7, 2023 - 8:00 AM

Subject: S. Riley - Motion to Compel Discovery

━━━━━━━━━━━━━━━━━━━━━━

Good Morning,

Prepare the exhibits for A to H. They are in the file under the exhibits folder for the motion. Want it filed today - discovery has been outstanding for over a year. No more good faith letters.

I want to see the final version before it is filed.

Very truly yours,

John Price, Esq.

Monday, August 7, 2023 - 8:00 AM

Subject: J. McTavish - Search Case Law

━━━━━━━━━━━━━━━━━━━━━━

Good Morning,

I don’t have time to look into this today - find me relevant cases that can be applied to the file. Preferably by tomorrow morning, get as specific as you can. Opposition is due 3 weeks from now and I’d rather not be stressing about it when it is due the week before the motion. Any questions, ask Mary. Thanks.

Very truly yours,

John Price, Esq.

Monday, August 7, 2023 - 8:00 AM

Subject: K. Garrick - CASE DISMISSED

━━━━━━━━━━━━━━━━━━━━━━

Good Morning Patrick,

No need to apologize, I hope the family is well. Glad we were able to resolve this.

Looping my paralegal in. She will provide you the document signed on behalf of me and have it to you by the end of the day.

Very truly yours,

John Price, Esq.

“I hope the family is well.” the mumble from your lips is a mocking one, as if that prick ever wishes anyone well. God forbid he ever wrote thank you instead while signing off on an email. The few emails are just the start of the tasks for the day. Happy Monday.

One more email catches your eye before you go to start from the bottom of where you left off the other day answering people. One email not sent exactly at 8 AM.

Monday, August 7, 2023 - 8:02 AM

Subject: Meeting about cases

━━━━━━━━━━━━━━━━━━━━━━

Morning,

When I’m in the office later we need to discuss more cases you are getting reassigned to. Let me know when you are free today. I’ll be in around 12 after court.

John

Get Outlook for IOS

You’ve got to be fucking kidding me.

And by the time the clock hits 12, you’ve barely made it through half of the emails. Completely zoning out as you chew on a pen cap, you scroll through the case law your searching for one of Price’s tasks - saving various memorandums into the file and your own notes on a word document. The sound of your desktop messenger goes off, the paralegal chat receiving a message from the firm secretary: Price is in.

Another paralegal, Ava, quickly sent a reply: Prayers up. Headphones in before the yelling in his office starts.

Fingers quickly typing your own response, you send yours: Fingers crossed today’s the day I can get fired and just collect unemployment instead.

You couldn’t help but chuckle quietly, closing the chat before Price would make his way to his office by your desk. Better off he didn’t see the alerts of his presence or everyones personal feelings about him. The sound of his shoes clicking against the floor caused your head to peek over your desktop setup, his phone already held up to his ear as he angrily spoke on the phone.

“Well, the judge doesn’t know his fucking ass from his elbow.” his eyes glanced over at you as he walked by, his hand holding up five fingers as he mouthed ‘five minutes’ to you.

So, you didn’t do anything for the next five minutes besides watch the clock on your computer. By the time four minutes hit, you stood up from the desk and stood outside his closed door. And right as five minutes hit, the door swung open and his breath caught in his throat as he was prepared to shout your name but saw you standing right there.

“Glad to see you can count.” he opted to say instead, turning to walk back towards his desk. “Door shut.” You nodded at his demand, closing the door and walking to stand at the front of his desk.

“Is the Laswell deposition set up?” he asked.

“Calendered for January 18th.”

“Exhibits on Riley…finished?” Another question as he scrolled through his emails.

“Prepared for your review.” The response leaving your lips quickly. “Document signed on Garrick. Still working on the case law for McTavish. And anything else you emailed me about.” You decided to finish off responses to any more questions he might have. He glanced up from his laptop, nodding.

“So, that leaves us with case reassignments.” Price stated and you simply nodded to acknowledge his comment. “Any file that Kelsey had with me is getting reassigned to you.” You knew Kelsey, she was a capable paralegal, she was Price’s go-to paralegal. Well, heavy emphasis on the ‘was’. She had quit the other week. Rumors spread, but the consensus seemed to be that Price might have driven her to a mental break.

Your brain did the math quickly - that would leave you hitting around over 250 files altogether. And before you could voice your concern, Price spoke again. “You’ll become my primary paralegal. Any case you have with another attorney is going to get reassigned to someone else.” Slight relief washed over you. At least that knocked your case load down a bit, but that still left you under Price’s reign of terror. Reporting to him about everything.

How soon am I gonna have a mental break? Your brain echoed, but again, you just nodded in response to what he just said. “Have you lost your voice?” He raised a brow. Quickly you shook your head ‘no’.

“No, sir. Understood. I’ll draft memos on any file I have getting transferred to someone else so they know the status.” You spoke, looking down at him as he sat at his desk.

“Good, get back to work.” was all he said, nodding towards his door. And with that, you hurriedly exited his office before he could mention anything else.

Once you sat down at your desk, you opened the paralegal chat.

Guess who is the new Kelsey :))

The hours this day seemed to drag. And for what felt like the hundredth time that day, your eyes glanced at the clock.

7:03 PM.

You let out a frustrated sigh, keeping it quiet. Anything you wanted to actually get done today for the most part didn’t, as you were handling forest fire after forest fire that Price would email about. But at this rate, you felt defeated. Not even a full 24 hours as his designated paralegal and you were one step away from a mental break of your own.

Price was long gone from the office. Every other paralegal was also gone at this rate, vanishing at 5 PM on the dot. The only other presence was the office cleaning lady who came in everyday. She came over to your desk, smiling at you as a greeting before she grabbed your trash can to dump the contents into her larger bin she pushed around. “Isn’t it late, love?” her voice soft and you smiled sadly at her.

“I guess it is.” you said, glancing back at your screen. The lady glanced at your computer screen and then her eyes went to Price’s door, reading his name on the door. And it was like something clicked.

“Oh, does Mr. Price, have you staying late?” she asked, voice laced with pity it sounded like. How did she know? And it was like she read your mind. “That blonde girl….hm, Kelsey!” she exclaimed as she remembered the name. “She was always staying later for that man.” The older lady spoke and you huffed.

“Yeah, Mr. Price.” you mumbled, reaching over to shut your laptop off. There was no way you were doing anything else tonight - besides burying yourself under your bed covers.

“Well, have a good night.” The lady said, walking away as she continued to empty trash cans throughout the office.

And by the time you were home, it felt like a chore to put yourself in the shower. But the water hitting your back acts as a cleanser of any stress of the day. Why was he such a prick? The inflated ego was understandable stemming from the fact he was a successful attorney. But, what was the point of treating everyone around you like shit? If he had a wife, you felt terrible for her. Though you never did notice a wedding ring, honestly, it wouldn’t surprise you if he took it off when he wasn’t around her. And if he wasn’t married, then you figured he was probably single and alone, because who the fuck would deal with that?

Two Months Later

If hell was on earth, it was right here in this very office. At your desk. Working directly for John Price.

The past two months felt like you were running a treadmill that wouldn’t stop and the only way to get off would be to stop running and just let the damn thing fling you into the wall. At least there was paid overtime, or you genuinely would have been on the next train to the unemployment line. But once again, the clock read 6:30 PM for the third time this week. The music from Price’s office blasting as his door had been shut the past four hours. First the sounds of him screaming on the phone, the next two hours followed by a conference call where you were almost positive you heard another attorney start crying and the past hour had been strictly music. You weren’t sure what to expect from his music taste, but the array of Mötley Crüe, Rolling Stones, Slipknot and a bunch of others you couldn’t even begin to name was driving you to the point of losing your mind.

Your body only jumped slightly in your seat when the door to his office abruptly opened, the music pouring into the rest of the empty office. But your eyes focused on Price as you made note of his appearance. In your months working here, nothing about him was ever disheveled. Every button done, tie aligning perfectly with the buttons on his shirt, his hair gel holding every hair on his head in place. Except right now, he looked like he actually just ran on a treadmill as opposed to you who had just felt like you had been on one. The first two buttons of his shirt undone and his tie sprawled on the desk in his office along with his suit jacket that hung off the back of his own chair. His face was slightly red and the gel in his hair looked like it lost his hold and as if his fingers had run through it.

The way his eyes locked on you made your body tense. It made you feel like you were in the wrong for still being in the office. “You’re still here?” he questioned, slightly caught off guard by your presence.

You hesitated for a minute, fingers on the keyboard coming to a stop as you looked at him. Well obviously I’m still fucking here. And the tiredness of the day hitting you, that you couldn’t help but reply with an attitude. “Well, unless I’m a ghost then yes, I’m still here.” The emphasis on the ‘still’ was strong. But your tone didn’t even seem to strike him like you thought it would, he just cleared his throat and nodded.

“I’m stepping out to grab something for dinner quickly. See you tomorrow if you’re gone by the time I’m back.” was all he left you with as he left the office. His demeanor and lack of response to your attitude caught you off guard as you stared blankly at your screen as he left the office. What the fuck is wrong with him?

#john price x reader #john price x you #john price #captain john price #john price x female reader #lawyer!price #captain price #john price cod #captain john price x reader #captain john price x you #call of duty #john price x y/n #captain john price x female reader #finally i write the first part for lawyer price the day has come

512 notes · View notes