#all requests i get after this is posted will be deleted!! | Explore Tumblr Posts and Blogs

satoruwiki · 2 months

Text

ᶻ 𝗓 ‎𐰁 SOMNO! ꒰੭

MINORS FOR THE LOVE OF GOD DNI!!

content: nsfw; smut; jjk drabbles; porn w no plot; somnophilia; dubcon? ig so; afab!reader; fem!reader; implied relationship; multi headcanon w jjk men; cunilingus; thigh fucking; cockwarming

w.c: 0.3k - 0.2k - 0.2k - 0.3k

n/a: i was supposed to put suguru and hiromi here but i ran out of ideas, i’ll make a part two when i come up w something lol. english isn’t my first language and im still a rookie at writing so bear with me please! any feedback/request/interaction supporting this post is very much appreciated :b repost bc i may or may not have deleted it during my breakdown rip 1k notes

SUKUNA

"...Who even sleeps like that?" Sukuna groaned quietly, catching a glimpse of your bare pussy under your nightgown. "If it isn't just begging to be fucked," he says, lifting the gown covering your cunt up to your stomach.

He must've hit the jackpot, he thinks. Having a cute girlfriend who's a heavy sleeper and happens to have a habit of sleeping with no panties on.

"it's good for the body," you said when he asked about it the first time. Then you told him about the properties of sleeping naked, which he couldn't bring himself to care and didn't pay attention to the rest of your words; though he did understand one thing between you chattering--he had free access to your pretty little pussy.

Sukuna spread your legs apart with care - he didn't want to wake you up after all - and sunk his head between your thighs, his mouth already watering, eager to eat your pussy. He dropped soft kisses on your inner thighs, leaving marks that he was there with his teeth.

A smug smirk crept up his face, listening to your soft mewls spilling out your lips while asleep. You must be having one hell of a dream, he thinks - he can tell by the way your cunt seeps out your essence. Sukuna gathers some of your arousal with his thumb up to your sensitive nub, playing with it gently in eight before he finally feasts on you.

He fucked you with his tongue, lapping and sucking at your folds until he had his mouth and chin glistening in your slick. Sukuna found it endearing that you’d respond to his touch just like you would awake. He could tell you were close; your hips jerked and your legs quivered at every broad stroke of his tongue on your core. A gasp left your lips as you reached your peak, soaking the sheets underneath you. His thick fingers rubbed your clit aggressively, riding you out of your high until he finally left you alone. The next morning, he made you think you peed yourself while sleeping and teased you about it.

TOJI

"Wake up, doll," he whispered to your ear, his hand trailing down your thigh. "Wake up, you damn sleepyhead."

Toji had tried to wake you up a few times with little success. His hard-on pressed against your ass, Toji attempted to wake you up the romantic way, peppering you with kisses down to your neck, talking to you oh-so sweetly, hoping to maybe coax you into an early quick fuck. Y'know, to start the day.

He hadn't expected that those melatonin gummies you took the night prior worked so well, though. You were asleep as a log.

"Fuck, you leave me to no choice, doll cakes," Toji muttered, tugging down your underwear and spitting on his hand to lube himself up with his spit and pre that leaked down his shaft. He gave himself a few tugs and eased his way between your thighs, rutting himself between them lazily.

He snuggled his head into the crook of your neck, his dark bangs falling down his eyes, quiet groans leaving his lips.

He smirked to himself as he felt your cunt getting wet, making it easier for him to fuck your thighs— he assumed that his cock stroking your folds at each thrust subconsciously made you feel good, small noises replacing your quiet snores from earlier.

“Shit, you like that, huh?” He hissed, consumed by pleasure, nipping your earlobe, his hand wandering to stimulate your clit in circular motions, his gentle touch contrasting the roughness of his hands.

A fine coat of sweat glistened on Toji as he rocked into your thighs, drawing moans from you in your sleep. Until his dick pulses, spurting thick ropes of cum on your thighs.

SATORU

"You promise we're going to sleep now?" You asked, struggling to keep your eyes open, too tired to keep going one more round.

Satoru brought you closer to his chest, nuzzling into your neck. "Yeah, I promise, baby. I just wanted to sleep with you like this," he says, pressing a soft kiss on your shoulder, "You're warm inside, by the way. It lulls me to sleep."

"Shut up," you mumble, embarrassed, slowly dozing off to sleep. You were a little reluctant to let him sleep still fully sheathed inside you. Something told you he wouldn't keep his promise of not coaxing you into another round. The damn stamina of this man. But he was your boyfriend, so you had to trust his words.

"Sorry," he whispers, closing his eyes to fall asleep with you, already hearing your quiet snores.

He can't sleep.

'Holy shit, how many minutes has it been already? 10? 15?' Satoru thinks. He can't seem to doze off, not when you feel so good around him, his cock already pulsing and twitching inside you.

"I'm so sorry, baby, I lied," Satoru murmurs, heat rushing to his cheeks as he starts to move inside you, letting breathy moans escape from his throat from how good your pussy makes him feel.

NANAMI

Nanami is an upright and correct man. He has never done anything you don't want and respects your boundaries.

However, today, he couldn't resist the urge.

Nanami panted as he ground over your cunt, soaking your underwear in his pre. You were asleep when he got home from work, later than usual. The reason for his delay was his white-haired coworker, who had nagged him into going out for some drinks until he begrudgingly agreed.

His teeth latched onto his bottom lip to stifle his groans, his abs clenching at every thrust. As much as he tried to keep quiet and not wake you up, unfortunately for him, it did not work.

"…Kento?" You mumbled, stirring out of your sleep, your eyes blinking a few times and adjusting to the room's darkness.

"Fuck, I'm- I'm sorry," Nanami huffs bashfully, the pink colour on his cheek blooming into a darker one up to the tip of his ears. He was about to pull away when you stopped him, wrapping your fingers around his wrist.

"No, don't be. I think it's cute," you smiled drowsily. "I find it endearing you got so worked up you couldn't help yourself. It's kinda hot if you ask me," you giggled, your hand wandering up to trail on Kento's abs.

Nanami shuddered under your touch, his cock throbbing and aching for some release. He gulped, swallowing his saliva thickly, "are you sure?" he asked, caressing the side of your thighs. You answered with a nod, humming a soft 'mhm'.

"Wanna keep up what you were doing?" You asked with anticipation, grabbing his cock onto your hand and teasing him by rubbing his tip up and down across your slit.

Nanami hissed, his face scrunching like he was in pain even though he was not and leaned to cup your cheek in his hand, murmuring, "You know how much I love you, right?"

2K notes · View notes

glitterypinkconverse · 10 months

Text

─ ⊹ ⊱ IN THE HEAT OF IT ALL

e-42!miles x fem!reader

summary after having an argument with miles, you get mad as to why he always brings up your plushies while you guys are arguing. so, you threw them all away.

request by @friedturtlewhispers ! i accidentally posted this without writing actual story, so sorry your request got deleted 😭

a/n this is a continuation of the 42!miles headcanon from these headcanons! i’m a sucker for angst so ofc i has to write this 🤷‍♀️

warnings angst to fluff, cursing

“Ma, you’re the one who sleeps with stuffed animals at night.”

You two have been fighting over God knows what for at least 30 minutes, and whenever he brought up the fact that you sleep with stuffed animals at night pisses you off. You scoffed, stuck your middle finger up at him, and went to his doorway.

“Fuck you, Miles.” That was all you said before you walked out of his bedroom, and out his apartment door.

New York at night was chilly, so as you left the building you silently cursed to yourself. You forgot your jacket again, as it was hot during the day but then it cooled down. Luckily, your apartment building was only a block away, so it wasn’t that bad of a walk.

His words still rang through your head. That was his only comeback nowadays ever since he found out. You thought he hated it, for how much he teased you about sleeping with the stuffed animals. But secretly, though he would never admit it, he found it cute that you do. It made him happy seeing you happy, although you weren’t feeling it right now.

You thought actually sleeping with them bothered him, so as your mind was overflowing with rage, you did the petty thing.

You threw them all away.

Well, not really. You just stuffed them all in a bag and put it in your closet. But, it felt like you did because your once overfilled bed was now empty, the only thing on it was your clothes, pillows, and obvious blankets.

Your phone was blowing from texts and calls from Miles. You looked over at it and rolled your eyes. You put your phone on do not disturb, charged it, and then got in bed. All you needed right now was some rest, so you closed your eyes and tried to fall asleep. Though, it was hard without at least one thing to hold.

Miles on the other hand, was freaking out. He was pacing around his room angrily, you guys never ended on bad terms. You would always make up, because he knew how important it was for you to have closure. He wanted to make this relationship work, and right now he felt like he was failing it.

“Pick up the phone, Y/N,” he mumbled, silently cursing everytime it went straight to voicemail. He groaned and left his room, saying a quick goodbye to his mom before leaving the apartment.

He walked, practically ran to your apartment where he barged in because you forgot to lock the door. Your parents were out on a work trip right now, so he reminded himself to scold you later on this. But for now, his only priority was to set things right and make it up to you.

He slowly opened your bedroom door, from the light being off he figured you were asleep. That was all until you turned around to look at the light that was entering your room, and groaned when you saw Miles standing in your doorway. “Fuck off.”

He scoffed and made his way towards you, “That’s no way to talk to me, now is it?” He joked, though you weren’t having it.

“What the hell are you doing here, Miles.” You turned away from him, so he couldn’t see the anger that was still looming on your face.

“Whatchu think I’m here for? I’m here to make it up to you. We’re not leaving on bad terms, and I swear by that.”

You didn’t respond, and that left Miles quiet. He observed the position you were in, and noticed your bed looked different.

“Ma, where’s all your stuffed animals?” He asked, concern in his voice. He shuffled around your bed, looking over you and looking at the end of your bed.

“Gone,” you mumbled. He paused in his tracks, looking over at you even though you couldn’t see him. Your back was facing the wall, so he immediately turned you around to face him.

“Fuck you mean gone?”

“I mean, gone, Miles. Like, they’re not here.” He was shocked, you loved those things more than anything. He looked around your room, for any sign of them.

None.

“I’ll be right back,” he mumbled before hurrying out of the room. You rolled your eyes and turned around in your bed again, feeling slightly bad that you lied to him.

However, Miles was going to the nearest store to get you something. He walked down the aisles of the store, searching for the perfect plushie. He grimaced at all of them, as they all looked unintentionally creepy. He decided on a pink teddy bear, as it looked the most tame and he knew how much you liked teddy bears. He went up to the register and paid for it, then rushed back to your apartment.

You were almost asleep when he barged in once again and sat on your bed. “Turn around.” When you didn’t, he turned you around himself and what you saw in his hands shocked you.

You sat up to face him, you didn’t expect him to buy you a teddy bear. You took it from his hands, admiring it slightly. “I’m sorry, Y/N. Y’know, I actually find it cute how you sleep with these.” You looked up at him and smiled, then fell into his arms.

“It’s alright, I guess. Thanks for the bear,” he hummed in response, to which you continued, “there’s a bag in my closet, do you think you can get it?” He pulled away slightly and raised an eyebrow at you, watching as you giggled against his chest.

He peeled away from you and walked to your closet, silently cursing when he saw the bag full of stuffed animals. “You’re full of shit, y’know that right?”

You laughed as he threw the bag at you, you throwing one of your pillows back at him in response. “You loooove me though.”

He walked back to your bed and put the pillow you threw at him back on the bed, and laid down with you. “You got one thing right,” he said as you adjusted in his arms.

“Oh, and also, don’t forget to lock your door. Can’t let anyone taking m’ girl away.”

“Go to sleep, Miles.”

TAGS ↣ @xx-all-purpose-nerd-xx

#across the spiderverse #spider man: across the spider verse #x reader #miles molares #atsv #miles morales x reader #spiderman atsv #42 miles morales #earth 42 miles morales x reader #earth 42 miles x reader #earth 42 miles morales #earth 42 #miles g morales #miles morales fanfiction #earth 42 miles x you #earth 42 miles

8K notes · View notes

lewisvinga · 3 months

Text

my mistake | lando norris x fem! reader

summary; lando had been chasing after oscar’s friend, y/n for a couple months now. he’s confused on why she keeps dismissing him until he finally got his answer

fc; nailea devora

warnings; cursing

taglist; @namgification

note; requested !

masterlist !

liked by oscarpiastri, landonorris, and others

yourusername: thank u mclaren n oscar for having me 🧡

tagged; oscarpiastri, mclaren

mclaren: always a joy to have you😎🧡

username: pretty girls stan y/n

oscarpiastri: ur annoying

yourusername: god forbid a girl ask for food

oscarpiastri: i kept getting weird stares bc you made me get you 4 plates of food.

yourusername: THE CHICKEN PASTA WAS GOOD🙎‍♀️🙎‍♀️🙎‍♀️🙎‍♀️

username: her friendship w oscar is everything

username: PAPAYAAA

landonorris: you’re forgetting someone 🤔

yourusername: no i don’t think so

landonorris: a handsome brit? 😁

yourusername: oh! lewis😁

landonorris: i meant me…

yourusername: ok !

username: lando😭

Y/N L/N ANSWERS YOUR FAN QUESTIONS!

lando👍

y/n

y/n🌷

what now lando

lando👍

what happened to u and why’d u distance yourself from f1😁

y/n🌷

none of ur business

lando👍

pleaseeee

aren’t we bffs😁😁😁

y/n🌷

no we are not

you just got my number from osc

lando 👍

well i’m not leaving you alone until you tell me

y/n

y/nnnnnn

answer

pleaseeeeeee🙏

y/n🌷

you really don’t remember?

lando👍

no?

y/n🌷

2019

i was starting to gain a following but nothing like what i have now

and i went to a race and i was so excited to be there and then i saw you

of course i was happy to see you but then when i smiled, you just rolled your eyes at me and looked really annoyed at me

and that hurt , lando

lando👍

shit

y/n i honestly don’t remember

but fuck i’m sorry

y/n🌷

whatever im over it

just sucks when someone you’re a fan of acts annoyed by u xx

but then i met osc and now he’s my friend so now i’m back into this f1 shit

lando👍

y/n seriously i’m so sorry

it was my mistake, i must’ve thought you were someone else

let me make it up to you

y/n🌷

it’s fine lando

past is past but just wanted you to know

lando👍

no i wanna make it up

y/n🌷

i said it’s fine

lando👍

nope!

not until i can make u laugh

at least let me take you out for lunch

y/n🌷

hmmmmm

fine

but i’m gonna order a feast

lando👍

fine by me😁

liked by landonorris, oscarpiastri, and others

yourusername: how does 1 live knowing that u invited someone out for food only to steal their fries ….. #landonorrisisover

tagged; landonorris

landonorris: u got full after 3 bites of your burger

yourusername: wrong it was 4! and it was a very big n filling burger!!

landonorris: omg u finally posted me 🥺🥺🥺🥺🥺🥺🥺

yourusername: don’t make me delete this post, lando norris 😒

username: i just know lando is giggling knowing he finally made it to a y/n post

username: did months of lando norizz flirting in her comments actually pay off??

oscarpiastri: wow.

yourusername: omw w fries for u don’t worry pooks

landonorris: worry if i eat them all

oscarpiastri: shut up lando norizz

lilyzneimer: miss u sm🥹🥹

yourusername: i miss u more💔 lmk when ur going to a race 😞

username: y/n gorgeous omg

username: wait who is that???

username: f1 driver and teammates w y/n friend oscar!

liked by yourusername, carlossainz55, and others

lando.jpg: the gf chronicles

tagged; yourusername

yourusername: fuck u and those stupid burgers and ur stupid jokes and ur stupid cute smile and the latte u bought me

lando.jpg: don’t worry guys she just hasn’t had her afternoon nap yet

yourusername: i’m so tired 😞😞

yourusername: bf🔥

lando.jpg: gf🔥

username: oh hello

username: wHEN DID THIS HAPPEN?

username: she’s scute i love her sm

username: idk who i want more him or her

carlossainz55: about time ! i didn’t know how many more calls of you talking about y/n i could handle!😂😂

yourusername: awh he talks abt me??

lando.jpg: not you exposing me, carlos 😒

oscarpiastri: fuck you you left me with half of my fries that time

lando.jpg: they were good sorry not sorry

yourusername: bro he’s such a fries stealer, i can’t ever eat my fries in peace

lando.jpg: tomato tomato

#formula one x reader #f1 x reader #f1 smau #f1 scenario #formula one scenarios #f1 imagine #formula one imagines #formula one imagine #f1 scenarios #formula one social media au #lando norris smau #lando norris x y/n #lando norris x reader #lando norris imagine #lando norris scenarios

2K notes · View notes

dragon-ascent · 1 month

Text

Zhongli makes you mad after an argument, so he endeavors to cheer you up.

this is for an anonymous request that I accidentally deleted, I'M SO SORRY ANON, I hope you see this post ;u;

Lovers' quarrels are part and parcel of life, though for you and Zhongli, they're generally few and far between (thanks to Zhongli's patience doing the heavy-lifting). So when an argument does break out, you get terribly upset.

Your husband has won the argument, but he's mature enough not to rub it in your face. As apology for the quarrel in the first place, Zhongli promises to bring you back your favorite sweets from the market. Still pouty, you merely shrug and curl up.

The minutes pass, and then an hour, and you're still curled up and moping in bed - but why hasn't Zhongli returned yet? It's not like him to take this much time.

Worry grips your heart as you sit up, yet another hour drifting by in silence. Could something have happened..? No, your husband is perfectly capable of defending himself given who he really is.

Before an even worse thought can seed itself in your heart, a large glowing amber eye peers at you through the window. "Ack!" You jump backwards, clutching your chest, before you realise it's your own husband in his dragon form watching you.

You hurry outside to see him holding up a bag of the sweets he'd promised in one claw, but that's not the point here. Why the hell is there a huge glittering pile of gold, gemstones, and jewellery of all shapes and sizes right next to him?

"What on earth..?" You stare at him in utter bewilderment, but your lover merely purrs as he sifts through all the valuables he's procured for you from obscure places perhaps only he knows.

The dragon tenderly and happily places a glimmering emerald tiara on your head, his tail thwacking the ground as it wiggles with great affection and enthusiasm.

Now you're staring at him in utter bewilderment while wearing an emerald tiara.

#sini writes #zhongli #genshin impact #zhongli x reader #fluff #drabble #dragon

1K notes · View notes

hellsitegenetics · 2 months

Text

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing. for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.) for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.) ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?: no, just neurodivergent

How do you do this?: i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?: my lawyer has advised me not to answer this question

How do I request things?: read the REQUESTS section of this post :)

Why are there so many bugs???: 1. insects make up almost 80% of all animal life on earth 2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???: because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?: no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?: yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask. asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

#hellsitegenetics #faq #intro post #flowers #plants #requests #birds of paradise #asks #remember to keep checking back!

1K notes · View notes

cheeseceli · 8 months

Text

SKZ arguing over the bill

Pairing: ot8!skz × gn!reader (individually)

Genre: fluff

Request: yes!

Warning: mentions of food, reader never pays lmao. Changbin, Chan, Seungmin's were heavily inspired by "Telling your Stray Kids boyfriend you can’t afford to eat out with them" by @ronnierites . If you don't allow this pls lemme know and I'll delete this post. Not proofread

A/n: that's kinda a new format, hope you guys like it! And this have been on my to do list since forever lol sorry for the wait

Bang Chan

Doesn't want you to feel uncomfortable

But he wants to spoil you so badly

Would let you pay if you were uncomfortable but he wants to make sure you get it he would love to pay for you as well

"You know Chris, I can pay for it."

"I know."

"So?"

"I'd rather do it. But thank you baby."

"But-" you stopped talking once you saw his card swiping. You truly should be used at this point "oh."

"Why do I feel like you're unhappy?"

"It's not that I am not happy, it's just that you always pay."

"It's my pleasure."

"But I don't know, I don't want you to think you're being pressured or something like that."

"Babe, I don't feel like that at all. Don't you worry. You're always doing so much for me, that's just a little 'thank you' of mine."

You gave him a little smile and proceeded to hug him, feeling safe in his warmth.

"I'm so lucky to have you."

"I should be the one saying it."

Lee Know

Bro you don't even spare a chance

He's paying before you even have a chance to take your wallet out of your pocket

I'm surprised you even try tbh

"Should we ask for the bill?"

"Oh, I already paid for it, don't worry."

You looked dumbfounded at him while he was finishing his food. You didn't see him talk to a waiter and you're sure he didn't pay for it before you two had your meal.

"What? When?"

"When we were asking for the dishes. Didn't you see it?"

"No?" you tried to recall the moment with no success "Why would you pay? I feel bad that you pay for everything all the time. I don't feel like reciprocating enough."

His eyes soften and a little smile comes to his lips while he watches you pout. If only you knew how much you did for him.

"Hey, look at me. It's okay. You already reciprocate with everything you do. That's already perfect"

Changbin

He pays with the money, you pay back with kisses

Sorry but that's his boyfriend duty

He is physically incapable of not paying for everything

"Hey baby. I'm off work in 40 minutes. I'll pick you up so we can have lunch, okay?"

You were glad that for once you were on a voice call with him instead of being in a face time like you'd usually do. This way he didn't see the way your smile dropped so quickly.

"Um, I don't think I'll be able to."

"Oh? Why?"

"I'm kinda... broke right now. I haven't received my last payment yet."

"Okay? What does that have to do with anything?"

"I don't want you to be the one who always pays for our things. I should be able to pay sometimes."

"You don't need to. That's my boyfriend duty. You know I don't mind, I actually enjoy it quite a lot."

"Still bothers me though. I'd hate to not contribute at all."

"You can always cuddle with me and shower me with kisses. That will make me happier than anything money can buy."

Hyunjin

Stop he'll be like genuinely so sad if he can't pay

He would let you pay if you were really insistent

But then he'll go like :( and you would let him take the bill out of pity lmao

"Hyunjin, stop looking at me like that."

"But darling, I can pay. You know it doesn't bother me."

"Just this once, let me pay, okay?"

"Okay"

"...Jinnie I really need you to stop that."

"I'm not even doing anything."

"Oh God" you sigh and let your head fall, knowing the man beside you won the argument once more "Fine. You can pay."

He didn't waste a second, swiping his card as fast as possible just so you couldn't have the time to change your mind. After he payed the meal, he took your hand in his and started to walk in the direction of the restaurant's exit with a triumphant (and really sweet) smile.

"I swear I don't get why you like to pay so much."

"My love should be treated as royalty, and that includes me paying for everything you wish for."

Han

Bro is offended

Believes with all his heart that he should be the one paying

Tries to distract you when the time to pay comes

"Were you paying while I was in the restroom?"

"... perhaps."

"Han."

"Baby. You know I like to pay for you."

"But you do that all the time."

"It's my way of showing love! If you ask me, I actually don't think it's enough. It's the least I can do."

He could see in your eyes that you weren't convinced. Unfortunately (for you), he only saw that as an opportunity to spend even more money. Maybe then you would believe him.

"C'mon, lemme show you a little bit of love. You can pay me back with thousands of kisses if that's what's bothering you."

Felix

He loves to pay.

If he could, he would pay for absolutely everything that you could ever want or need.

But if that's something which really bothers you, he will let you pay as well

Tries to do that "the one who invites is the one who pays" thing and fails

"Felix. Don't even dare."

He looked at you confused until he realised you were staring at the credit card in his hand, probably hoping that it could disappear before the waiter came back with the bill.

"C'mon, it's just a small lunch. I can pay for it."

"No. I invited you. I pay."

"Actually, if you think about it, I'm the one who suggested this place."

"Two years ago."

"Still counts."

"Not as an invitation though. I'm the one who asked if you wanted to come here."

Felix sighed, knowing he wouldn't be able to convince you of otherwise. If only he could.

"Okay. Next time it's on me."

Seungmin

LMAO sorry you're 100% not paying

Don't even try

Boyfriend duty pt 2 except he is even more dedicated somehow

"Why did you bring your wallet?"

"I wanted to pay for this one."

"... why?"

"You always pay for everything."

"And I don't plan on stopping so you can take your wallet away."

"Minnie, please. I don't want you to be the one who always end up paying for everything."

"But I want to. I wouldn't mind paying for every single thing for the rest of our lives. So you can't take your money away of my sight because I'm paying."

"For the rest of our lives huh?"

"Don't tease." But you didn't miss how the corners of his lips lifted once he thought you weren't looking anymore.

I.N

Rock, paper, scissors. The winner is the one who pays

It's funny and neither of you can complain about the outcome of it because it's technically fair

Except you always throw scissors first and never noticed it

And Jeongin doesn't have the heart to tell you

"We should change this game."

"No way" he said while giving the money to the cashier whilst trying to hide his grin from you "Not my fault you are horrible at this."

"Seriously though, I think you're cheating. It's impossible for you to win every single time."

"How does one cheat at 'rock, paper, scissors'? Besides, you won yesterday."

"After losing at least 50 times. And I got to pay for some ice cream. It's not the same as paying for a whole meal."

"Get better at this and maybe you get to pay for a whole meal one day. C'mon, we can have some milkshake now. Maybe you'll win this time."

You had a feeling you wouldn't though. He was sure you wouldn't.

Reblogs and feedback are appreciated!

Dividers by @cafekitsune

3K notes · View notes

goldsainz · 6 months

Text

YOU BELONG WITH ME — one shot.

pairing: lando norris x reader

MASTERLIST.

taglist: @lorarri @lpab @noncannonships @lunnnix @elliegrey2803 @racingtrack @saintslewis @leoramage @toomuchdelusion @anthonykatebridgerton @enhacolor @gulabjamoon @forza55 @goldenleclerc @ravisinghs-wife @ferrarirace @hobiismyhopeu @celestialpierre

request: “can i please request for a 📀 with lando and the song you belong with me :)”

NOTE: purely self-indulgent in the sense that lando pines for the reader😭 gotta live my love dreams through my fics. hope you all enjoy and pls don’t forget to reblog/comment it helps a lot (also love seeing what you think) 🫶

liked by lailahasanovic, ursulolita and 305,821 others

yourusername missing the summer :(

view all 4,587 comments

landonorris Missing you

this comment has been deleted

landonorris Cool pictures

ynfan1 yeah… still don’t like her bf😭

⤷ ynfan2 what? why?

⤷ ynfan1 gives off weird vibes also liked some lando hate comments pretty recently

landofan1 LANDO’S DELETED COMMENT

ynfan3 prettiest woman alive fr

landofan2 y/n ignoring lando hurts my soul

⤷ ynfan4 after that comment it makes sense

ynfan5 she’s everything and he’s just… there

ynfan6 I CAN’T DEAL WITH THE SILENCE BETWEEN HER AND LANDO

landofan3 bye her boyfriend doesn’t even like or comment🙄

⤷ landofan4 i’m convinced he doesn’t even like her

⤷ landofan3 lando WORSHIPS the lane she walks on and they’re not even together!!!!!

ynfan7 no hot girl summer, but she’s still a hot girl

yourusername posted an instagram story!

liked by ynfan21, landofan21 and 67,358 others

f1wags Y/N Y/L/N and her best friend have been spotted at the Abu Dhabi Grand Priz! This is her first public appearance in the F1 paddock since the Miami Grand prix.

view all 1,013 comments

ynfan22 SHE IS GLOWING

ynfan23 oh she came to slay

landofan22 lando’s lucky charm is back🥹

⤷ ynfan24 AND WE ARE GLAD ABOUT THAT!!!

landofan23 praying that she’s there for lando🙏🙏

ynfan25 the dress is so stunning

ynfan26 we finally have y/n content😩

⤷ ynfan27 the drought has ended!!!!!

landofan24 NEED HER IN THE MCLAREN MOTORHOME OR HOSPITALITY‼️ I’M NOT PICKY

landonorris posted an instagram story!

liked by maxfewtrell, carlossainz55 and 754,063 others

yourusername better than the summer 🤍❄️

view all 11,310 comments

landonorris I promise I take better pictures

⤷ yourusername we know. you have a whole account about it.

⤷ landonorris Is that complaining I hear?

⤷ yourusername nope 🫶

landofan31 WAR IS OVER!!!

ynfan31 i’ve waited a lifetime for this

ynfan32 THE SHADE IN THE CAPTION???

⤷ landofan32 BEST THING EVERRRRR

ynfan33 the difference in likes from her last post to this one is absurd😭

riabish Finallyyyyy

liked by landonorris, yourusername and 5,027 others

ynfan34 mother is in her lover era

⤷ landofan33 i once believed love would be burning red, but it’s golden like daylight ✨

ynfan35 i’m never getting over them!!!!!

2K notes · View notes

astonmartinii · 5 months

Text

ballad of lovebirds and puppy dogs | lando norris social media au

pairing: lando norris x fem actress!reader

face claim: rachel zegler

everyone is a hunger games fan, even if you say you're not a hunger games fan you are. this includes lando norris.

based on this request: could you please do a lando norris smau with rachel zegler as the fc!! where the ballad of songbirds and snakes recently came out, twitter could be freaking out over it, and then someone spots her with lando or something!! take it from there queen that’s just my like base plot‼️‼️ - @inejghafawifesblog

MASTERLIST | BUY ME A KO-FI?

yourusername

liked by tomblyth, landonorris and 1,231,866 others

tagged: tomblyth

yourusername: kinda have a movie coming out, have yall seen it?

view all comments

user1: ANNOUNCE RELATIONSHIP NOW

user2: friendships can exist between men and women you know?

user3: look at her holding his arm though that shit ain't platonic

hunterschafer: my favourite girl in the whole world

yourusername: that's crazy because you're my favourite girl in the whole world too

hunterschafer: crazy when that happens huh

tomblyth: does that mean i'm your favourite man in the whole world

yourusername: my lawyer said i can't answer this question

tomblyth: god you get a boyfriend and all of a sudden i don't mean shit

this comment has been deleted

tomblyth: does our frolicks in the woods mean nothing to you?

user4: WE SAW THAT GRANDPA

user5: sooooo. there is a man.

user6: and it's not tom :( so disappointing their chemistry was insane

user7: babe that's called acting

user8: lando norris in the likes i knew my man had TASTE

user9: i knew there was a reason i liked that man

f1gossipandtea

liked by user13, user14 and 12,309 others

tagged: yourusername, landonorris

f1gossipandtea: lando norris was spotted multiple times out in monaco with y/n y/ln !! this comes after his appearance at the premiere of her new film the ballad of songbirds and snakes. do you think they're a cute couple?

view all comments

user15: try not to say parents challenge (impossible)

user16: has someone looked into my brain and pulled out my dream threesome and made them a couple

user17: i need them to give me a chance for real

user18: i am defo anti-paparazzi but thank you for these absolute gems xx

user19: those motherfuckers must've been camped out cause literally got the whole itinerary

user20: this feels like such a random couple but after watching the BTS of tbosas they defo have very similar personalities

user21: i did a lil bit of sleuthing and tom has posts of him at races? so do we think he suggested lando? or showed him to y/n?

user22: i also had a wee look and y/n follows basically all of the grid and a couple of the retired drivers so that tells me she likes the sport? like if she just liked lando surely she'd only follow him and maybe some of his friends?

user23: so like my vision is y/n y/ln either performing or singing the national anthem at one of the american races

user24: someone get this gal in the fia stat

user25: who is this girl? she's too irrelevant for lando ...

user26: and who are YOU? he's not going to pick you girly

user27: she's in the top film in the world for weeks now ... let's not be silly

landonorris

liked by danielricciardo, yourusername and 1,833,209 others

tagged: yourusername

landonorris: what the paps didn't get ...

view all comments

user28: screaming, crying, throwing up i did not know i needed this so much

user29: i am so unwell this is so cute

user30: i was so on the y/n and tom train but i am happy to say it has been hijacked by lando

yourusername: paps didn't get our good angles :(

landonorris: i'd like to keep the best angles to ourselves

yourusername: no for real, for MY eyes only

maxfewtrell: god you people are obnoxious...

landonorris: you literally told me to stop complaining about being lonely and now i'm being attacked 🤨

maxfewtrell: NOT LIKE THIS THERE ARE CHILDREN HERE

yourusername: fuck them kids

landonorris: what y/n said

danielricciardo: free enchante promotion, y/n you're invited to my wedding

yourusername: the girlfriend effect x enchante goes crazy tbf

landonorris: are you saying i didn't dress well?

yourusername: you either didn't dress well or can't pack for shit you came to GEORGIA IN THE SUMMER WITH A SUITCASE FULL OF HOODIES

landonorris: but that's my brand :(

georgerussell63: the twitch quartet formally announce our disappointment about finding out about this relationship via @f1gossipandtea, we expect a big apology and perhaps and visit from tom

tomblyth: i am THERE

yourusername: eh i think that's on lando .... but real question is who follows @f1gossipandtea

georgerussell63: me duh, i need to check for potential GDPA incidents

alexalbon: i also follow it 👍 no real reason i just like the drama thanks @charles_leclerc and @carlossainz55

yourusername: LMAO

charles_leclerc: i am disappointed in you lando. ALEX WHAT IS THAT SUPPOSED TO MEAN

carlossainz55: ???

landonorris: lol would you have even believed me ?

georgerussell63: no

alexalbon: no

charles_leclerc: no

yourusername

liked by hunterschafer, landonorris and 1,339,309 others

tagged: landonorris

yourusername: some cheeky behind the scenes pics, including lando demanding to be pampered while i was in hair and make up

view all comments

user31: i hope lando can fight (i have brass knuckles on, sorry not sorry)

landonorris: UMMMM ???

yourusername: soz babe they're just passionate

user32: HE WAS ON SET? HOW LONG HAS THIS BEEN GOING?

landonorris: how dare you !! the makeup girlies LOVE ME

yourusername: sure, if that's what you wanna believe

landonorris: they liked me better than you they said so :p

yourusername: they were just being nice i told them you're fragile

landonorris: i am NOT FRAGILE I AM SOFT THERE IS A DIFFERENCE

user33: okay now i get them 100%

maxverstappen1: so this is why you didn't play fifa with me 🤨

oscarpiastri: so this is why you abandoned me at the airport 🤨

danielricciardo: so this is why you blocked me after i called you seven times in a row it was an emergency you ASSHOLE 🤨

carlossainz55: so this is why you've ditched golf dates the last couple months 🤨

alexalbon: so this is why you didn't come to watch tbosas with me and lily 🤨

georgerussell63: so this is why the GDPA chat was muted on your phone 🤨

yourusername: i ain't reading alla that, i'm happy for you or i'm sorry that happened, i'll see you all in the parking lot at the vegas gp

landonorris: ...sorry?

user34: Y/N IS GOING TO THE VEGAS GP?

maxfewtrell: actually could you have him more often?

landonorris: AHAHAHAA :(

yourusername: gladly :)

landonorris: :)

liked by landonorris, maxverstappen1 and 1,441,723 others

tagged: landonorris

f1: lando's new helmet for vegas... we wonder where this inspiration came from?

view all comments

user38: IS THAT A BALLAD OF SONGBIRDS AND SNAKES HELMET

user39: maybe men do deserve rights

landonorris: the ballad of songbirds and snakes is out in cinemas everywhere now !!

yourusername: i knew they should've given you a cameo

landonorris: THERE WAS A CHANCE OF THAT?

yourusername: no, but it would've been funny tho

landonorris: don't get me excited like that :(

danielricciardo: maybe you could have a cameo in snow white, you are what the kids call a short king... sorry

yourusername: LMAO

landonorris: can we stop bullying me on my special post :(

yourusername: sorry babe, i love you and i love your helmet, thank you xxx

landonorris: THANK YOU :)))))

maxverstappen1: so you're telling me i sat through whatever the fuck that opening ceremony was when you could've had y/n perform the whole time?

yourusername: new agent incoming?

landonorris: I KNEW YOU WATCHED THE FILM

maxverstappen1: i am a supportive friend?

landonorris: you didn't even know her?

maxverstappen1: i saw you at the premiere, went through your instagram, saw you only followed her, put two and two together, went to see the film because we're friends by proxy now 👍

yourusername: i am scared and impressed

landonorris: fine... that's kinda cute

user40: okay soz i love this relationship and all the friendships starting

user41: okay but @yourusername who is winning the games

yourusername: fernando or valterri they scare me

fernandoalo_oficial: compliment!

valterribottas: i'll take it

landonorris

liked by maxfewtrell, yourusername and 1,723,990 others

tagged: yourusername

landonorris: i wanted to impress her :( she's a lot better at her day job

view all comments

user46: (i'm glad he's okay) lando really was the 'this one is for you babe' and misses meme this weekend

landonorris: not wrong

yourusername: GET OFF YOUR PHONE AND STOP TALKING DOWN TO YOURSELF

user47: currently picturing y/n whisper yelling positive affirmations at lando

yourusername: yes !! baby boy is way too hard on himself and NOT on my watch

landonorris: :)))

yourusername: you did so well this weekend, i loved watching you do what you love - don't be too hard on yourself !!

landonorris: i just wanted to do your helmet proud :(

yourusername: i am more than proud

landonorris: can you sing to me in your country accent again?

yourusername: of course

maxverstappen1: is this a kink?

landonorris: 1. no it's not a kink 2. ASK ME IF I'M OKAY BEFORE YOU TRY TO KINK SHAME ME

maxverstappen1: you're actually spelling even better maybe a concussion was what you needed

yourusername: TOO SOON MAX

maxverstappen1: did you just send me a picture of lando pouting

yourusername: yes ! say sorry now !!!!!

maxverstappen1: fine. i'm sorry lando. i'm glad you aren't hurt and that you don't have a country accent fetish

user48: are these the new terror trio?

yourusername

liked by alexalbon, landonorris and 1,552,589 others

tagged: landonorris

yourusername: don't listen to this bozo, he's the most talented boy in the world

view all comments

user49: THEY HAVE A CHILD?

user50: that's a dog...

yourusername: just because i didn't birth him, doesn't mean mr. fluffy isn't my biological child

landonorris: i'm not a step dad i'm the dad who stepped up 🆙

tomblyth: tom blyth erasure

yourusername: boo you whore

tomblyth: ermmm EXCUSE ME?

yourusername: lando appreciation post must be mean to all other men, sorry !!

tomblyth: understandable, continue.

landonorris: the most talented??? coming from you??? this is high praise

yourusername: and you BETTER take it

landonorris: yes ma'am

maxverstappen1: is this another kink?

landonorris: MAX?

maxverstappen1: it's winter break i'm bored and you have a GIRLFRIEND so i can't terrorise you in person :(

yourusername: attempt to kink shame us one more time and i'm sending mr fluffy at your ankles

yourusername: fuck it i'll send ankle biter yuki in as well

yukitsunoda0511: i'll do it

yourusername: @landonorris i see why he's your favourite now

landonorris: yuki-san!! can we give mr. fluffy a brother?

yukitsunoda0511: i love you guys but i see you way too much as it is

yourusername: harsh crowd

landonorris: at least you have me?

yourusername: TRUE

user51: my life pre and post y/nxlando was so vastly different - i love them

note: thank you for the request !! i have been swamped with work... and recovering from my birthday weekend. i hope you enjoyed it!! i love the hunger games and i can't wait to see tbosas !!

#f1 imagine #f1 x reader #f1 instagram au #f1 x you #f1 #f1 social media au #lando norris insta au #lando norris x you #lando norris x reader #lando norris imagine #lando norris #the ballad of songbirds and snakes

2K notes · View notes

yeagerfate · 10 months

Text

big spoon or little spoon?

characters: miles morales (earth-1610), miguel o’hara, hobie brown, gwen stacy, pavitr prabhakar

warnings: none lol

notes: i didn’t proofread this because i’m exhausted from a bunch of irl stuff, so i’ll come check this out later and see if i need to fix anything. don’t really like how this went at all but i need something to post so oh well <3 might delete this later kinda depends. also i got my first writing request which i am very excited about hehe

Honestly, it all really depends on Miles’ mood. If he’s had a good day, then he’ll definitely be spooning you. However, if something went wrong, he will be seeking your comfort and attention. One of your most memorable moments with Miles’ was spooning him for the first time. He’d completely flunked an exam because he was out on a really dangerous mission the night before. In shambles, Miles had told you that he hadn’t slept at all and fell asleep during the test. He was really nervous to tell his parents about it because he didn’t know what his excuse would be. The last thing he wanted was for them to think he was out at some party, or just being irresponsible. He slept like a baby after you consoled him, his head resting on your chest as you ran your hand up and down his back with the other holding his head. Although it was a bittersweet moment, you enjoyed it, and the way Miles had drooled in his sleep had you trying not to wake him up from your sweet giggling.

Miguel’s in denial, but he’s a little spoon. The feeling of your hands running through his wavy hair at the end of a stressful day at work is something he’s grown addicted to. He’s a bit ashamed of it, as he thinks he should be the one holding you, but you quickly snap him out of it. Miguel finds solace in your arms, and for a couple hours it’s nice to forget about all of the emotional turmoil from work. Though, if you ever ask for it, Miguel will absolutely hold you. Sometimes, it’s nice to feel your head resting on his muscular chest and your warmth on him. In the mornings, it’s especially hard for Miguel to get up. Your arms are just so comfy and snug, and he feels like he’s at home when he’s with you. Lyla makes fun of him for it, calling him a “simp” (he doesn’t know what it means), but he doesn’t care. The way your face lights up when you feel his toned arms wrapped tightly around your face is something he’d never want to give up.

Hobie is a big spoon. He’s not big into snuggling, as he likes his personal space, but once you get into it, you get into it. (He is very affectionate with the people he cares about, though!) He’s found that the most comfortable position would be with your back against his chest and his arm wrapped around your stomach, his face hidden in your neck sweetly. It can get a little irritating, since Hobie is a big snorer. He also has a warmer body temperature, so in the summer, you’ll have to resolve to holding each other’s hands. It’s both endearing and frustrating, but it’s for Hobie, and that makes it worth it. During cuddling, the bonnet he wears tickles your neck. It’s hard to hold in the automatic laugh you have from it because he’s trying to sleep. Cuddling with Hobie is messy, fun, and enjoyable. It’s just so… Hobie.

Gwen, despite her average height, is a big spoon. She likes the feeling of being able to just hold and protect you. Gwen has lost so much, and so she feels she has to make sure you’re safe at all times. One of the way she does this is by holding you close to her her neck, your head resting on her shoulder as she runs her hands down your back. It doesn’t matter how tall you are. Even if you’re a foot taller than her, you’ll still be held by her. However, Gwen occasionally has nightmares, and so when she wakes up she’d like to be embraced by you. When she has her head pressed against you chest, and she can hear the sound of your heartbeat, it really makes her feel better. It reassures her panicking brain that you’re alive, you’re here, and you’re fine. It’s a soothing feeling, one that’s hard to describe. All she knows is that she really treasures it.

Pavitr is very enthusiastic about all types of physical affection, and that includes cuddling. He is a big spoon, though he doesn’t mind trading places at all. While you’re cuddling, he loves to tell you about how his day went. If you know that he’s spider-man, he’ll tell you all about the adventures he went on with his friends. Sometimes, he’ll even rant about Miguel, which is very amusing. However, if you don’t know that he’s spider-man, Pavitr will take a much different approach. Instead, he’ll ask you to tell him about your day. He asks you if you saw anything you liked at the stores nearby, or if you tried any new food. He likes to take note of these revelations because they make for great gifts. Pavitr is a very talkative cuddler, but on tiring days, he’ll be out like a light after 5 minutes. It all depends on how his day went.

#atsv fluff #atsv x reader #itsv x reader #itsv fluff #miguel o’hara fluff #miguel o’hara x reader #miles morales fluff #miles morales x reader #across the spiderverse x reader #into the spiderverse x reader #hobie brown fluff #hobie brown x reader #gwen stacy fluff #gwen stacy x reader #pavitr prabhakar x reader #pavitr prabhakar fluff #slept from 3am to 12pm today kinda regret it kinda dont #i hate tagging bruh

2K notes · View notes

f1goat · 5 months

Text

more than friends + lando norris x part five

In which your best friend wants to help you so you get more sexual experience, but he discovers quickly that he never wants to share you and your new sexual experience with others.

masterlist - playlist

warnings: smut with a plot or a plot with smut? :) minors dni! i never proofread so probably grammar or spelling errors

requested: yes, based on: something with a driver sister that’s still a virgin & lando (her bestfriend) suggests to teach her things (ofc pretending for it to bot mean anything), while he’s actually in love with her

part one / part two / part three / part four

You can’t help yourself and stare at Lando, just like a lot of others are doing right now. He’s absolutely glowing and taking in the attention he’s getting. After his deleted lap time from yesterday, he came back stronger then ever. Right now he’s standing on the podium claiming his well deserved trophy for the second place in the race. You smile while staring at him. Podiums look good on him. Insanely good.

“You did so good!” You almost scream when Lando comes to you later day afternoon. He’s still glowing from his podium. You can smell the faint odor from the champagne. You wonder about kissing Lando, will you taste it then? Lando doesn’t talk at first, he just hugs you. You continue to praise him in the mean time.

“You know what this means, right baby?” Lando eventually whispers into your ear. You think back at his words from yesterday. Is he serious? “I want you to get into my drivers room, so I can get my celebration right after debriefing,” Lando tells you.

You feel your cheeks heating up and reddening. Fuck.

“Can you wait there for me babygirl?” Lando asks you. You can only nod as response, if you even knew what to say right now you’re sure the words would get lost on your tongue. Lando makes things even worse by pressing a kiss against your forehead. You wish you could feel his lips on yours right now, but you’re fully aware of all the cameras around you. Tomorrow - or maybe this afternoon already - you will see this fragment of your life all over your socials.

Lando walks away from you. You know what to do now. Lando was clear about his wishes, and who are you to deny them from him? Without giving it a second thought, you walk towards the McLaren motorhome. It’s not hard to get into Lando his drivers room, probably because everyone around you knows who you are. Instead of talking to the mechanics who are still here instead of getting ready to party, you walk directly towards Lando his drivers room. They let you.

In Lando his drivers room you suddenly start to feel a bit nervous. What does Lando expect from you? He made his wishes clear yesterday and today. Apparently he wants to eat you out? The thought alone makes you feel more nervous. Although you have no idea why. Lando is probably pretty good at it, so it will be more of a celebration for you then him. Right? Maybe it’s the thought of Lando coming this close to your private parts. What if they don’t look good enough? You try to shake off those thoughts.

You know that a debrief can cost some time, so you try to kill the time by scrolling on your socials. You like every post about Lando his podium. When you see a notification from Lando popping up on your screen, you almost drop your phone on the floor. Is he serious?

Lando: 5 minutes babe

Lando: maybe you can already lose some clothes ;)

The thought of waiting for Lando while being in your lingerie only - or maybe even naked, makes you feel all kind of things. Your stomach is tightening by only the thought already. You don’t even realize that you’re already kicking of your sneakers. It feels like everything is happening on some sort of automatic pilot. You don’t even think about the possibility of other people walking in to this room. Even though the possibility is kinda high. You don’t care about things like that right now. In no time is the floor covered in the clothes you were wearing earlier. The only thing left on your body is your lingerie. It’s a black set, nothing to exciting, but it does look nice. You doubt a bit if you want to keep it on or off. Eventually you decide to take it off as well.

Thank god for the warm weather today, because you’re already shivering from only the thought that Lando can come in any second. It feels weird to wait here for him while being naked. You realize that Lando never saw you naked before. All the cons are weighting up, but you can’t stop thinking about Lando finding you like this. Will this be what he expected? Or will this be a surprise for him?

When the door opens you start to feel extremely aware of your surroundings and your own bareness. You’re relieved when you see that Lando is the one to open the door. He is quick to close the door when he sees you waiting for him. After that he’s even quicker to get towards you.

Lando can’t tear his eyes away from you. He realizes that he’s staring and that there’s a chance that it makes you feel uncomfortable right now. But he really can’t look away from you. He never saw you like this before. All the things that happened between the two of you before, happened with you in clothes. He can’t say he didn’t imagine about your body before, but in some way it’s even more beautiful then he already thought. He lets his gaze go over every small detail of your body.

He looks at your breasts and notices the way your nipples resemble small pebbles. He wants nothing more then to shower them in kisses right now. He wants to take your nipple into his mouth until he felt the hardness of it on his tongue, only to switch over to your other nipple after that. He lets his stare slide towards your most private part. You’re sitting with your legs crossed over each other, causing him to imagine the way your pussy will look.

It can’t be right that you’re without a doubt the girl who has the most impact on him. Seeing you like this has made him rock hard in only seconds. His dick is throbbing painfully. He remembers himself that this is about you - and not about him. You’re the most beautiful girl he has ever seen, with and without clothes.

You feel uncomfortable when Lando doesn’t say anything. Was it a mistake to undress this far already? When you start to think about questioning him about it, Lando lets out a soft sound. You look at him. Lando is still taking in your body. You notice that he’s looking at you full with adoration, or are you making that up?

Lando comes closer and closer to you. When he’s finally close enough, he eagerly puts his mouth onto your lips. He gives you a soft peck on the lips before moving the two of you towards the couch in the drivers room. Lando pulls you onto his lap, instead of normally this time he makes sure you face him. He doesn’t want your body to get out of his sight right now.

He presses a kiss against your neck. “Fucking hell babygirl,” he finally mutters. Then he presses another kiss against your body, this time it’s to your collarbone. “I didn’t expect to walk into you being naked already,” Lando continues to say to you, “Such a beautiful surprise,” he adds before pressing his lips against your body again. He presses multiple kisses against your body, at first closely to your collarbone again but after a bit he moves his lips down. He’s getting close to your breasts.

You’re already trembling under Lando his touch. Lando grunts. “Can I touch you babygirl?” He asks you. You’re quick to tell him yes. Lando takes on of your breasts into his hand, he kneads it while looking at you.

“You’re such a good girl,” he tells you.

Your stomach tightens. You feel your cheeks reddening. Why are those small words doing so much to you? You’re glad that Lando isn’t paying attention to your face, because you’re sure that it’s reddish from blushing this much. Lando is busy paying attention to your breasts. He lowers his face to get closer to your tits. He is still kneading on of them. You almost jump up when you feel his lips against the other tit. He presses soft kisses against it, before sucking on the skin. You quietly follow Lando his movements with your eyes. It doesn’t take him long before pressing a kiss against your hardened nipple. After that he takes your nipple inside his mouth. Softly you feel him suck onto it.

When Lando pulls back, you let out a soft whimper. Lando switches his movements. He moves his hand away from your breast, to put it back onto the other one. He presses kisses against your tit that he was kneading earlier. Before you realize it, your other nipple is in his mouth.

It surprises you when you feel your pussy clenching. It amazes you that you even start to feel that you’re getting pretty wet. Lando his mouth is doing all kind of things to you, but you can’t complain about one tiny part of it.

Lando removes his lips and hand from your breasts again. This time he moves his hands downwards, he is quick to get close to your private parts. It annoys you when he doesn’t touch you where you need him, but keeps a bit above of the place. Suddenly without realizing it, you let out a soft whine.

“What’s wrong babygirl?” Lando asks you. You notice the small smirk on his face. It makes you realize that he’s doing this on purpose. What a tease. You can’t tell him that, every word that leaves your mouth is begging Lando to do something about the way you’re feeling.

“I need you,” you softly whimper.

Lando lets out a low groan. Fuck, what you just told him makes him even harder. That’s actually insane. He moves his hands away from your vagina even further. He softly lifts you up and puts you next to himself onto the couch. Only to get of the couch himself after that. He takes your legs into his hands. Slowly he spreads your legs for him.

You look at Lando. He doesn’t look back at you. All his attention is onto your slit. Before you can feel uncomfortable about it, Lando starts to shower you with compliments about it.

“Such a pretty pussy,” Lando tells you with a low voice. He lets his hand slide around it carefully. He makes sure that he isn’t already touching your clit or entrance, he focuses himself onto your lips. He enjoys teasing you a bit. This is his celebration after all, right? He looks at the frustrated emotions that you’re displaying on your face. He realizes that you really need him. Lando never wants you to need anyone else.

He softly spreads your lips a bit with his hands.

“So beautiful,” he continues to tell you.

This time he slides his finger through your slit. It surprises him how wet you’re already are. He coats his finger in your slick.

“So wet already,” he murmurs to you.

He presses a soft kiss against the inside of your thighs.

“Is that all for me babygirl?” He asks you.

“Yes,” you tell him eagerly.

“Who’s the one who made you this wet?” Lando continues to ask you. He needs to hear you say it. He needs to hear it that this is all because of him.

“You Lando,” you softly confess, “It’s all for you.”

Lando lets out a soft moan after hearing your words. He presses a few more kisses against your thighs. He moves a bit closer to your pussy, but makes sure that he isn’t coming closer then your lips. You let out a frustrated whine.

“I need more Lando,” you tell Lando a bit ashamed.

Lando presses a soft kiss against your clit this time. He’s quick to move away from it after making his move.

“More,” you whimper.

Lando grins. He softly slides his finger over your clit a couple times, but makes sure that it’s not enough. He presses more kisses against your inner thighs. Suddenly he starts to think about you begging him. The thought is making him even harder. He looks at you. How hot would it be if you ask him to lick you?

“What do you need baby?” Lando asks you.

He makes sure that his finger is laying dangerously close to your clit right now. Almost onto it, but still a bit too far away.

“You,” you whimper.

“No, no,” Lando tuts, “I asked you, what do you need? What do you want me to do babygirl?”

You stay silent for a bit. Lando moves his finger even closer to your clit. Softly he touches it. It makes you tremble under his touch. It’s unfair what he’s doing to you. It’s even more unfair how fast he can make you feel like this. For a few seconds you wonder if anyone else can make you ever feels like this, you highly doubt it.

“If you don’t tell me baby, I can’t make you feel any better,” Lando teases you.

“Fuck,” you groan, “Tease.”

“Just tell me babygirl,” Lando continues to tease you.

“I want you to, fuck,” you stutter, “I want you to lick me.”

Lando doesn’t reply verbally anymore. He presses a soft kiss against your clit before starting to do what you asked from him. Slowly he licks around your pussy. He makes sure to lick every tiny part of it, before coming back to your clit. He presses another kiss against it, before using soft licks onto it. He makes sure that he’s not going to fast, but also not to slow. He wants you to enjoy this as much as he’s enjoying it right now. He increases his pace a bit after hearing you letting out multiple moans.

In the mean time he slides his finger around your slit. He slowly brings it to your entrance, but doesn’t push it inside. Yet. Lando knows it’s teasing and maybe even a bit mean, but he needs to hear you beg even more for him right now. He has fallen in love with the desperate voice you used earlier with him. He wants to know that he’s the one who makes you feel like this and that you need him to come.

You buck your hips. Hopefully Lando gets the hint. You want his finger inside of you. Maybe even more then one now that you think of it. Lando doesn’t response to your movement. You open your eyes to look at him. To your surprise he’s already looking back at you. Before speaking up, you admire the way he looks between your legs.

He’s still making short licks onto your clitoris. Sometimes he switches and licks around your whole slit. But the things he’s doing to your clit right now, are the things that feel the best. Although, you can use a bit more.

“More,” you softly say.

“More?” Lando asks you. You let out a soft whimper when he removes his mouth from your pussy. He looks at you. His finger replaces the movements his tongue made earlier. It still feels good, but not as good as before.

“Please,” you beg Lando.

“Tell me what you want baby,” Lando states. He increases his pace with his finger. He likes looking at you while you look like this. You’re shaking underneath his touch. Moans are falling out your mouth like they’re your new language. Lando wishes he could save this memory so he could look back at it to see all the small details, again and again. His cock is throbbing even more painfully then before. He needs release as well.

“How longer you take, how longer you will miss my tongue onto your pussy,” Lando tells you. He hears a soft whine leaving your lips.

“I need your fingers,” you eventually confess.

“Ask me,” Lando tells you sternly. He can’t help himself. He has fallen in love with your pleads.

“Can you finger me?” You ask Lando softly with red cheeks, before Lando can say anything you add another word. “Please Lan?”

His boner almost explodes when hearing the soft please Lan coming from your lips. He doesn’t say anything anymore, he’s quick to move his lips back to your clit and to move his fingers to your entrance again. This time he licks your clit even faster. He hears moans coming from you. Is it bad that he’s getting addicted to that sound? He realizes that he wants to hear you like this forever. No one else should ever hear you like this he even thinks.

Lando pushes one of his fingers softly inside of you. He feels your walls clenching around his finger. Easily he pushes in and out of your pussy. It doesn’t take him long before using another finger. He starts to finger fuck you with two of his fingers. In the mean time he focusses on eating you out. He softly sucks onto you clit. It makes you almost scream.

“Lan,” you loudly moan when he sucks a bit harder onto your clit.

He doesn’t response verbally, he just keeps increasing his pace. Waiting for you to come. Your walls are starting to clench even more around his fingers. Lando feels how your clit is starting to throb inside his mouth. You feel your stomach tighten. Moans keep coming out of your mouth. You can’t stop yourself.

“I’m close,” you tell Lando. He reacts by sucking harder on your clit. He moves his fingers faster inside of you. He notices a soft spongy spot inside of you and gives it all his attention from now on. You let out a hard moan.

“Can I come?” You suddenly ask Lando.

He’s overwhelmed by your question. Fuck. It’s insane how it feels that you’re asking him for permission to come. In the mean time you have more trouble with holding back your orgasm. You feel waves of pleasure hitting over you.

“Lan?” You quickly ask.

Lando removes his lips from your clit for a couple seconds. No longer then necessary. “Of course babygirl,” he tells you before sucking harshly onto your clit again. He repeats his movements from earlier, but his eyes are focused on your face. He looks at the way you close your eyes when the first waves of your orgasm are washing over you. He notices the way your lips are partly open, only to let out a couple of soft moans. When you press your legs closer together, Lando stops his movements and pulls back. He doesn’t want to overstimulate you. At least, not today. It would be a nice thing to do in the future.

Lando waits for you to say something. In the mean time he sucks your slit of his own fingers. He takes place next to you on the couch. You quickly lay down against him.

“Fuck,” you mutter, “that was really good.”

“Glad that you liked it,” Lando replies with a small grin. His cock is still throbbing inside of his racesuit. “You tasted better then that champagne,” Lando tells you. You let out a laugh. Without thinking about it you press a kiss against Lando his lips, he is quick to turn it into more. When his tongue slides into your mouth, you taste the faint taste of yourself on his tongue.

“Do you want me to do something for you as well?” You ask Lando softly.

“I wished,” Lando grunts, “but we have a dinner and a party to get ready for.”

“Maybe later tonight?” You suggest.

“I like the way you’re thinking babygirl,” Lando replies to you.

“I just want to feel your lips on my clit again,” you confess laughingly.

“Next time I won’t stop after your orgasm.”

“You think I can come more then once?” You ask surprised.

“You can add a lesson about overstimulation to the teaching plan babe,” Lando tells you jokingly, but none of his words are a joke. He wants to spend a whole evening between your legs and pull everything orgasm out of you that you have.

part six

this is my favorite part so far :)) hope everyone liked it!

taglist: @booksandplushies @dinodumbass @formula1mount @words-are-cheap @allywthsr @inejghafawifesblog @chonkybonky @formulas-bitch @harrysdimple05 @vildetry06 @wherethefuckisthething @nonameishere @lauralarsen@meadhbhcavanagh @obliviatevamps @shy4turcs @fix5idiots @nightlockcornucopia @marialovesf1 @kapsylia @im-an-overthinker @jule239 @lanando4 @lauralarsen @leclercdream @agentadhd @rewmuslupin @allsouls-emma @iamshiningeuw @teenagedreams-cl@kiskso @loxbbg @vellicora @thomaslefteyebrow @avg-golden-retriever @amorydsmt @killjoynotes @barelytolerabled @starmanv @changetyre @kami10471633 @2bormaybenot @httpmrklee @buendiabebeta @aliceespector

#lando norris #lando norris x reader #lando norris x y/n #lando norris fanfiction #lando norris imagine #ln4 #formula one #f1 #lando norris imagines #lando norris smut

1K notes · View notes

popamolly · 2 months

Note

I HAVE A REQ FOR VAL

reader will be a one of the employees who works the cameras at the studio, the rumor that she has a huge crush on val gets out and he confronts her.. in the end having a few drinks which loosens her up and makes her confess how much she wants him and val shows her the time of her life 🤗🤗 (bonus points for overstim and degrading/ praise)

៸៸ ﹟CUT THE CAMERAS!

pairing. valentino x fem!reader

warnings. valentino exists, valentino x fem!employee!reader, smut, oneshot, rough sex, degradation/praise (best of both worlds), overstimulation, reader is a bit tipsy, vouyerism (?), Valentino doesn’t get to cum >:)

author’s note. thank you for the idea anon! this is kinda long because i got carried away but i hope you enjoy <3 (I also want to note that i do not condone Valentine’s actions toward Angel in the show) and as always, request are open!

𖤐 MASTERLIST

“Oh no! I’m a bad boy and I need a real hunk daddy to put me in my place!” Angel acted out the script well, his voice clearly blurring the lines of authenticity as you focused the camera on him and the four large demons that surrounded him. The demons were definitely jocks on Earth because they towered over Angel with ease, their swollen cocks in hand dripping with precum, ready to snap the poor spider like a twig, “Yes, daddy! Stuff me full of your cock!”

All you could think about was how lucky you were to be on the opposite side of the camera. You couldn’t even imagine taking someone or something as large as a forearm, not even to mention the girth— and there was four of them. Angel Dust truly was a wonder and you commended him for his bravery. Little did you know that he was under a contract that practically forced him to do the things he was doing. Did he want to be a pornstar? Not really. Did he want to be a druggie? Who’s to say. Hell was definitely that, Hell.

You focused on your job with a sigh. Which was to work your camera to get all the right angles, preferably with Angel’s fucked out face or holes in the shot. The workers behind the camera wouldn’t dare move from their post on set. Everyone was in their respective roles under Valentino’s watchful gaze.

‘Valentino,’ Just his name in your thoughts had your heart beat quickening. Everything about him was so alluring that you couldn’t help but be intrigued by him. You glanced over in his direction which was across the set from you, giving you a good view of the man you’ve had a crush on since the moment you got this job. He sat tall in his directors chair, right leg crossed over his left elegantly to expose his fish net tights and smooth toned legs. The sight alone could make you drool and he wasn’t doing anything else than just sitting there, ��Fuck, he is so hot’.

But your thoughts were only just that, thoughts. A silly crush that you told yourself you would grow out of eventually.

You blinked out of your thoughts suddenly at the sound of Angel’s pleasurable scream of ecstasy. After a few more cheesy lines exchanged from the script the scene was officially over.

“And scene! Good job everyone, wrap it up!” Your manager claps before walking Valentino over to my camera to look at the still shots I took and a preview of the video. The lights in the studio came on just as the pair came to stand next to you. Your manager nearly shoves you to the side to take credit of the knowledge of videography like you weren’t just the one that stood behind the camera for hours. If anything you should be the one showcasing your work to Valentino and present him all the best stills you took during the scene— it was your work after all. But atlas you were nothing more than a lowly employee that can’t even draw the attention of the Boss.

“We will delete these as the light is a bit off and to the left, not really highlighting Angel,” Your manager clicked an arrow to scroll through the picture, “Whoever was on light duty needs to be fired.”

“Just trash the ones we can’t use,” Valentino lets out a puff of pink smoke in annoyance, “I only want the best shots of Angel.”

You looked toward the screen, speaking before actually thinking, “Well if you adjust the lighting and contrast on the photos it should be salvageable.”

“Excuse me?” Your manager glares at you, “You aren’t a professional. Your job is to hold a camera, that is it—!”

Valentino covers your managers mouth with one of his four hands before tilting his head at you in curiosity, “You can fix the photos, darling?”

You nearly jump out of your skin with excitement. Valentino was talking to you— actually talking to you and looking in your direction. All you could do was nod at his question before turning toward the computer that was next to the camera, fixing the problem in less than five minutes and presenting the stills to Valentino in anticipation.

Valentino looks them over with a grin, “Perfect, caro. You just potentially saved me thousands of dollars.” Now that he was standing in front you the tall moth man had a chance to take a good look at you. A wicked smile on his face as he had countless of thoughts in his head on just how he could use that perfect body of yours. Something about you had him twitching in want and it wasn’t like Valentino ignore his urges.

Valentino outstretched his arm to extend his body down to be able to take your hand in one of his, his lips brushing against your knuckles gently in a sweet affectionate kiss that had you swooning, “Follow me to my office? I wish to discuss something with you.”

“Oh—I—Um—Okay!” You agreed, stumbling over your words as you tried to ignore the feeling of your manager burning a hole into your head. Without complaint you follow Valentino up some steps and into his large office that just so happened to have a king size bed conveniently placed in the middle of the room, “Did I do something wrong, Valentino?”

“Nonsense! Quite the opposite,” Valentino gestures you to sit on one of his gaudy plush animal print chairs as he walks over to his alcohol table to pour you and himself a drink, “You captured my attention for the time being, how lucky for you, principessa.”

“I-I guess so,“ You gladly take the wine glass Valentino offers you, gliding your fingertips along the rim nervously. Your heart was pounding so much you felt as if it would burst out your chest. Now that you were prey under his gaze you felt as though he would pounce on you at any moment. And the crazy part was that you’d let him. You would let him do every dirty deed to you in the book if he wanted.

To calm your nerves you quickly downed your first glass of wine before letting Valentino offer you another glass. And then another. It wasn’t long before your head was spinning slightly from the buzz the alcohol gave you due to your lightweight nature. It for sure made this interaction easier and even loosened your tongue.

“Can I be honest with you?” You at least still had a clear mind to confess what has been on your mind for weeks now. It was now or never right? “I secretly hoped for this… for you to notice me.”

“Oh?” Valentino raised his eyebrow teasingly, “How naughty of you.”

“Naughty or not..” You sat on the edge of your chair, your knees brushing up against his, “You’re an inspiration Val, truly. I admire you and the work that you do.”

Valentino smiles wide, his gold tooth shining in the light, before taking a small sip of his wine before setting down the glass on a side table. You were giving him such an ego boost that he was starting to like you more and more.

“(Y/N), was it? What a pretty name,” Valentino wasn’t fooled by your innocent persona. If anything, he knew you were the exact opposite. He never breathed down any of his employees necks but he always did an intense research on them and of course nothing happened on his side of Pride Ring without him knowing. Every conversation you had with your fellow coworkers was something he heard about verbatim. This little crush you had on him was flattering to say the least and Valentino wanted to see how far you would take your feelings for him, “Have you ever thought about being in front of the camera instead of behind it? I could make you a star, sweetheart.”

That being said he was good at reading people, and it was quite clear that you were shrinking under his gaze. But it wasn’t from fear— no, it was from something more sensual. Valentino couldn’t help but smirk at you and think how turned on you were and how you did such a terrible job of hiding it.

“Really?” You looked up to meet Valentino’s gaze with such hopeful and naive eyes that your boss felt his cock twitch, “I’m not very photogenic…”

“Oh mio caro, that is an easy fix,” Valentino brought his finger under your glass to slowly tip it up, forcing you to finish your drink down to the last drop. Once you were finished he delicately takes the glass from your hands and sets it aside, “All you have to do it just find a perfect angle that suits you just right.”

With your mind slightly a buzz, you lookedup at Valentino’s looming figure with a soft look, “Valentino—”

“Show me, darling.” Valentino clicks his tongue, fluffing the fur around his neck collar as his heart shaped glasses fell to the bridge of his nose, “Show me how you touch yourself and I promise to find that perfect angle for you.”

With that you are gently pushed down onto the bed, Valentino’s soft hands gliding along your inner thigh before spreading your legs apart, which in turn raises your skirt you were wearing to your waist. A pleased hum falling from his lips as he noticed your pink colored thong you were wearing that had a wet patch beginning to form right in the middle.

“I-I have never..don’t this before,” You admit, “In front of a camera I mean.”

“Oh my darling, there will be no camera, just us.” Valentino took a long drag from his cigarette, “I can find your perfect angle through my eyes alone. Now..show me.”

You got comfortable on the bed, trying to relax your mind and invision yourself in the comfort of your own home. You felt so small under Valentino’s gaze and it caused nothing but a pleasurable shiver to go down your spine as you removed your panties which Valentino was quick to take from your hands so he could sniff them with a deep inhale.

“So obedient,�� Valentino smirks at the whimpers that left your lips, eyes fixed on the way your fingers messily rubbed over your clit, “Aren’t you, principessa?”

You nod wordlessly, so caught up in chasing your orgasm, you didn’t even notice Valentino sauntering closer to you. Your fingers began to move faster and faster before they’re pulled away from you suddenly, a whine leaving your lips from your denied orgasm. “You’ll cum when I say slut,” Valentino orders, his fingers rubbing through your soaked pussy at an agonizingly slow pace. You gasp, hips rising for more contact.

“Patience, darling, is a virtue.” You bit down on your bottom lip at Valentino’s words, “You’re so wet for me, i just want to make a mess of you.”

A light moan leaves your lips when you feel the tips of his fingers dip into your needy cunt. You don’t even get a chance to respond before his lips are pressed roughly onto yours, his tongue instantly invading your mouth, your moans now muffled as his fingers continued to skillfully move against your aching pussy. Valentino bites your lip, tugging on the flesh before plunging his fingers back into you, your back arching off the bed at the pleasure.

“V-Valentino! F-Fuck..!”

“Such a good girl for being so patient,” His praises only turn you on even more, if all was possible. “A dirty, fucking girl who wants nothing more than to cum, hm? i feel you tightening around my fingers mio caro.” Valentino is amused by the way your pussy sucks his fingers in with every thrust, “Oh you have such a pretty pussy.”

You whine from the way his thumb ghosts over your clit, “P-Please!”

“Please what, darling? Use that pretty voice of yours hm?”

“P-Please…can I cum?”

Valentino chuckles darkly, thumb rubbing your clit roughly as his fingers continue to pump in and out of you in a fast pace, “Cum for me slut.” You clench your eyes shut from the pleasure, loud, sultry moans leaving your lips with each pump of his fingers. You feel the knot in your stomach begin to tighten, your walls clenching around his digits desperately.

“Ah—! Fuck!” You’re too caught up in finally catching your orgasm. That intense wave crashing over you, leaving your fluttering hole clenching around Valentino’s slender fingers as he continued to pistol them in and out of you at fast pace so you could ride out your mindboggling orgasm.

“There it is! Good fucking girl,” Valentino positions himself between your legs, placing hot kisses onto your neck as your body continues to writhe beneath him, your back arches from the feeling of his tip rubbing between your sensitive folds, a whimper falling from your lips from the overstimulation you felt, “Oh I am not finished with you yet.”

“W-wait! Val—!” You nearly cry out when he pushes himself into you roughly.

“Shhhh,” Valentino’s fingers curl around your throat, his mouth lowering to your ear as his other two hands pin your legs to your chest, putting you in a deep folding press that allowed him to go impossibly deeper, “You’re doing so well for me, sweetheart. Look how this slutty hole takes my cock with ease.”

His thrusts start off slow and deep, each thrust nearing you to yet another orgasm. Everything about him was starting to become addicting. You wanted it all, his touch, his breath, his tongue— you wanted him to use you like his own personal fuck toy. You try to move your hips to match his thrusts, only for his grip to tighten around your throat, a low growl leaving his lips.

“You’re a natural at this, aren’t you dear? You want to get fucked like a slut that bad huh?” Tears began to escape your eyes as Valentino begins to pick up the pace, the tip of his dick kissing your cervix with every thrust. The overstimulation was too much and you couldn’t help but cry from the overwhelming pleasure, “Look at you, such a perfect whore for me.”

You wrap your hands around his wrist to leverage yourself, his grip around your throat nearly sending you over the edge. You felt the sudden desperate need to cum again and you couldn’t hold it back anymore.

Valentino groans from the feeling of your cunt clenching around his dick sporadically, “You going to cum again for me, mio caro? Fucking do it.” He licks his lips at the sight of your tear stained face contorted with pleasure, bringing down his free hand to circle around your clit roughly, your loud moans bouncing off the walls of the dimly lit room, “Do it, slut.”

You release the moment the words left his mouth, Valentino’s thrust coming to a halt as his fingers continue to make a mess of your clit, the clear liquid squirting all over your legs and his pelvis.

Fuck, did he love this. You were falling right into his hands like a moth to a flame and he planned on using that against you. Your naivety and love for him was going to be your downfall and he would be right there with sweet words to guide your hand into signing your soul to him. You would be another star in the making, another flower ready to bloom under the sparkling light. And Valentino couldn’t wait to use that to his advantage.

“That’s my good little whore,” He didn’t even give you a moment to catch your breath before moving his hips once again, “Now you’re going get that slutty pussy to squirt for me again.”

#𖤐popamollyposts #𖤐popamolly #hazbin hotel fiction #hazbin hotel valentino #hazbin hotel smut #hazbin hotel characters #hazbin #hazbin hotel #smut #valentino x reader #valentino x reader hazbin hotel

518 notes · View notes