WARNINGS / FAQ / REQUESTS
asks are open! check here before sending :) (updated 3/10/24)
banned from BLAST for being too sexy
CREATURE WARNING:
this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.
for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)
for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)
ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths.
FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly.
If I ever miss a tag or you'd like to request that I tag something, please send me a message.
FREQUENTLY ASKED QUESTIONS:
Are you a bot?:
no, just neurodivergent
How do you do this?:
i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.
Are you Italian?:
my lawyer has advised me not to answer this question
How do I request things?:
read the REQUESTS section of this post :)
Why are there so many bugs???:
1. insects make up almost 80% of all animal life on earth
2. they are relatively easy to study, so there's more bug DNA in the BLAST database.
Okay but why so many MOTHS???:
because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.
Do the punctuation marks/emojis mean anything to BLAST?:
no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.
Can I send in general questions?:
yes! but they may get BLASTed.
REQUESTS:
to request something, please read this section and then send an ask.
asks that don't follow these guidelines will be deleted, and may get you blocked.
For questions: make sure it hasn't been already answered in the FAQ, then send.
For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.
For Tumblr posts: send a link.
For other languages: make sure it's romanized (in latin script), then send.
REQUESTS I WILL NOT ANSWER:
things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.
private information (name, address, etc. YES people have tried this.)
images (including images in your text is fine, as long as there's enough text that i can search with it)
AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.
spam. you only have to send a request once.
homestuck
FREQUENTLY REQUESTED:
The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)
thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)
1K notes
·
View notes
Rosa's Cafe
Here's a longer Racial TF set in a coffee shop, Best! Occam
Matthew had clocked up more hours of overtime for his company than they were willing to pay him. He assumed that their guidelines weren’t so rigid and that he would be fine to get ahead early. These days you really need to go above and beyond to get ahead and Matthew was determined to get in the good graces of the big bosses.
Unfortunately working so hard was a misplay. His direct boss was forcing him to take Paid Time Off in lieu of the overtime pay for the past year. Now he sits at home with next to nothing to do, twiddling his thumbs until he can return to the grind. He loved back when he was a barista in college? Maybe he can get back to customer service?
Reflecting on this he takes to LinkedIn to see if there are any managerial spots open for a cafe. Something needs to scratch his itch for administration and he night as well pour coffee while doing so. In a stroke of luck, or perhaps something more deliberate, as soon as he logs in to check listings he sees a manager position at “Rosa’s Cafe.”
He auto-submits his resume to the restaurant assuming he’s overqualified before even reading the listing’s qualifications. Glancing through them he sees that they’d prefer someone fluent in Spanish. Matthew struggles to recall what if any Spanish remains in his head from taking it in both high school and college. He starts to pull up a language app on his phone before seeing that, jarringly fast, he has already been advanced to an interview for this cafe. Rosa herself sending him a message to come as soon as he’s ready.
Matthew then sprints to check himself in a mirror. He has certainly not slacked in his hygiene since he was asked to stop coming into work, partially in hopes that they’ll need him to come in any day. Today though he throws on some cologne and drives off to Rosa’s Cafe. He doesn’t stop to question how odd it is to already be on the way to an interview, minutes after submitting his resume. They must just really need someone?
As soon as he arrives Rosa is there at the door to greet him, smiling wide and welcoming him into her establishment.
“Hola Matthew! So glad for you to join us, your application was outstanding! Solamente, I was wondering why you wanted this job given your current one?”
Matthew blushes and explains his situation, struggling not to sound like a maniac for wanting to work despite the relatively cushy situation he is in. Although Rosa hears this and is impressed at his ethic, his crave to work. Rosa was more than happy to take advantage of his situation.
“Uhhh there was just one thing though, Miss. Oh uh, lo siento. Señora Rosa.”
“Sí, sí. You aren’t quite fluent en Español, are you Matthew?” He averts his eyes but before he can answer Rosa continues on, “Esta bien. You will just learn on the job sí?”
Putting on an air of determination Matthew pumps his fist
“Sí, Sra Rosa! Uh claro que sí,” he attempts, stepping to the limit of the Spanish remaining in his head. Rosa gives him a look like an owner watching a pet as it tries to show off, offering an ambiguous smile before explaining her stance.
“Claro que sí,” offering a knowing nod, “I’m sure you understand why I would want a manager to speak Español, yes? En esta ciudad, in this city, there are very few places where Español is the default. I would just like my cafe to be one of them. The job is of course yours, I would be a fool not to take the opportunity. But while you’re here, mientras estás aquí, please work on su Espanol,” tacking on, “I can’t imagine it will be too long before you’re called back to your job eh? Una estrella como tu”
To her point there are clearly not a lot of people speaking English in the cafe. Matthew would guess he is probably the only native English speaker present making him blush, although after being flattered by Rosa he was ready to accept. After all he had been meaning to practice his Spanish anyway. He puts his hand out to shake her hand, “when can I start?”
“Well, mi pequeño gerente, why not start training now?” Turning around she calls over the barista Juan to introduce the two, talking to Juan at a speed that made it clear to Matthew that she was quite dumbing down her language in their conversation. She then bids farewell to the two, “adios Matthew! Tengo que ah, cόmo se dice, file your paperwork. Hasta mañana!”
“Hola Matthew, it is nice to meet you! Rosa said to show you around,” Juan smiles offering him a cup of their house roast. “Espero que, ah, I hope you don’t mind but I added canella, cinnamon.” Matthew graciously accepts the cup. He may be a world removed from his time as a barista but instantly returns to his first coffee tasting.
It smelled quite strong, darker than he usually prefers and he can see cinnamon swirling through the cup as the cup steams in his hand. He begins to bring the cup up for a closer smell although as soon as the movement begins the allure of the drink overpowers him and he drinks almost too quickly. It was delicious. He always, almost performatively, drank black coffee at his old job. Or no, his real job?
Juan sees Matthew continue to gulp down the cup of coffee waiting for reaction, though he sees very little sign of his mind processing the drink at all. Matthew’s just staring ahead, his eyes ever so slightly glazing over as he finishes the cup. He grins as it almost looks like the coffee has stained Matthew’s upper lip, offering a napkin before asking, “te gusta hermano?”
Matthew snaps back to his senses, staring at Juan as a small ring of brown starts to stain the center of his icy blue eyes. He struggles to even find the words to describe how profoundly he enjoyed the coffee. It was a passion too great for him to even begin to capture in English. “Juan, that was, cómo se dice? Is there some word better than delicioso?”
Juan laughs putting his arm around his new manager, “Ay hermano! Maybe that’s what you should do now! You just go work on your Spanish and I’ll bring you some samples! Ah, aqui, the employee handbook is in Spanish, practica perfecta!” He brings over another cup and the handbook and Matthew starts struggling through it.
Matthew figuratively bashes his head into the handbook, it’s not dense but it is per cierto not written with beginners in mind. Smirking as he notices he just reflexively thought in Spanish, going to get another drink only to find the cup emptied once more. He hasn’t been drinking nearly as much since he left the office, bargaining with himself as Juan comes to refill his cup. He can cut back his intake later, he needs to get this through this work.
And work at it he does, caffeine is not making him feel wired as usual but sensual as he continues to page through the booklet. He starts to stretch just to feel the strain in his muscles and the tension in his clothes. He looks down and sees his shirt is fitting much better than he thought it did. It’s not tight but anyone who looks can see there is muscle under there. He stares at his own body feeling strength he does not remember cultivating. Suddenly he notices it’s not only his upper body that’s filling out, as a growing package begins to demand attention under the table. These jeans were clearly not designed to handle this and Matthew is barely able to stop himself from flexing to see just how much he truly can fill this outfit and he attempts to switch gears back to working. Urgently feeling adverse to thinking any further about his body.
Struggling to find any way to distract himself he remembers being historically shit at actually speaking in Spanish. This is as good a chance as any to practice his pronunciation. Matthew begins to mouth the words in the handbook, feeling his tongue in unfamiliar ways that he swears he has done a million times before. Matthew attempts to raise his practice to a whisper and immediately goes into a coughing fit. Hope that coffee didn’t burn my throat he thinks clearing his throat and finding a much deeper voice on the other side. One that announces his Spanish progress to the whole cafe shockingly loud for a whisper though Matthew doesn’t notice. What is immediately apparent to him is how expertly he rolled an R.
He knows he could never do that, and not without trying. He probably spent half an hour practicing it his sophomore year. He reflects back on how hard he worked on Spanish in the past as his eyes start to glaze over once more. Something is off here, his hand raising to his face not notice a moustache and sloppy goatee start to push out of his face. He foes feel itchy elsewhere though, scratching at his chest and stomach, averting the more animalistic urge to scratch his pits and crotch as Juan begins to walk over.
Matthew quickly tries to meet him halfway, standing to a height just taller than the one he thought he knew to be true. His bulge grazes the bottom of the table which causes his body to convulse in pleasure. His feet are caught on the table as he falls knocking his coffee all over himself and the floor. “Mierda!” He shouts before going dark.
He awakens to Juan wiping coffee off his face, his clothes now certainly stained brown and spelling of rich coffee and cinnamon. Helping him back to standing, Juan makes sure he is alright, “quite the fall amigo! Tal vez we call it a day?” Matthew hastily agrees feeling impossibly strained and weary for what little work he has actually done. Juan continues, “Rosa said the paperwork should be good for you to start tomorrow if you can!” Stumbling to his feet Matt knows he agrees but the rest of his night is little more than a blur.
He sees Juan wink at him and knows he is going to start tomorrow. He must drive home after that since he is now looking at himself in the mirror brushing his teeth. Something seems off, he is clearly too tired to put a finger on exactly what it is. He flexes his bicep noticing he must have completely disrobed. He thought he shaved his pits recently. He scratches at his crotch realizing that his now heavier cock is also out, pawing at his pubes and feeling his bulge expand even further into his hand before forcing it into some briefs and continuing his audit.
Didn’t he have a tan? Looking at himself up and down he feels like he isn’t supposed to be this pale right? Isn’t he from? Matthew feels lightheaded and begins to collapse once more before being jarred back to reality smelling the coffee and cinnamon scent still hugging his chest. Using this second wind he stumbles into bed, neglecting to change into his nightclothes and he quickly drifts to sleep.
Matt falls into a dream that feels realer than the reality of his previous life. It’s the middle of the rush and he sees himself working at an espresso machine with Juan. He looks down seeing his body expertly maneuver around the bar, tossing cinnamon into drinks, chatting with customers in truly fluent Spanish. He pauses in this dreamscape to notice the tan he was so sure he had earlier. He sees the tattooed arms he has known for years, he worked hard enough for them after all, might as well show them off on the clock. He raises the hairy arms to flex at Juan and say something clever in his native tongue before being jarred back to reality by a sunbeam.
Matt awakens hearing his morning wood stretch his briefs to their near limit barely able to keep himself together before seeing the time and once more shouting “mierda!” He is already so late for work, they’ve been open for hours. It’s his first real day and he has already jod- he’s already fucked it up! He quickly inspects himself once more, seeing the true version of himself he saw in his dream. Seeing his recently shaved chest he quickly realizes he doesn’t have time for a shower. He smells his pits just to see how bad the damage is. His voice rumbles in his chest, “joder…”
He smells again even deeper, it reminds him of? Oh it is just on the tip of his tongue, which he begins to reach out before remembering his predicament. He throws on a dress shirt before giving one last whiff to his pits, flexing his pecs as he does so. It is so fragrant, almost spicy. Matt postpones the mystery after concluding it should certainly be covered by the smell at Rosa’s and rushing out the door. Not seeing as his chest pops off the top button of his shirt and his neat goatee begins to grow even thicker.
Matt rushes into the door and is greeted like a regular, which he is of course to be now, as the new manager. He feels a warmth in his chest as Juan brings over his first cup of the day. “Buenos días Juan!” Matt offers before going to meet the chef, Benito, as the plan was today.
Making his way back to the kitchen he smells something even more distracting to him than his body odor this morning. Benito runs over with a plate full of arepas that Matt recognizes instantly before Benito greets him, “buenos dias jefe! Rosa said you wanted us to start serving arepas sí?”
“Rosa? She said, I asked for these?”
“Si! Desde su ciudad natal no?”
Matt’s mouth is overcome as he starts to clearly drool for the plate in front of him. He has no choice but to tear into one which immediately brings him back. He loved these when he was a kid, but? Didn’t he grow up en los estados? Wasn’t he from? He fails to finish the thought in his head before it is wiped away as if fireworks are going of in his mind.
He beams at Benito as his eyes glaze over and fully darken to brown. He feels an urge to burp which he chokes down with another cup of coffee. “Ay this takes me back amigo, estos son exactamente como, like the ones mi abuela había before nos pequeños…” Matt pauses as he feels a pervasive warmth starts to grow distracting in his chest as a similar itch begins on the outside.
He doesn’t notice as his inner monologue begins to entirely shift away from English, as it should of course. He may live in los Estados hoy, but he was colombiano born and bred. He remembers how hard he worked as a child learning English as his biceps start to clearly strain the already tight dress shirt.
Matt remembers fighting for his place to get a degree at a university that did not respect his native country or tongue as he feels his voice deepen beyond baritone and into a strong bass. He remembers trying to find a place in this mierda ciudad before meeting Rosa as his chest bursts open shooting any buttons remaining off his shirt.
Rosa then enters the kitchen to see how her new hire has progressed and slyly smiles seeing his progress. She tosses a shirt at him saying in Spanish now effortlessly understood “Oi Matteo! You’re in the kitchen put some clothes on!”
Matteo shuffles to the restroom to change as he looks one last time in the mirror and sees the flawless trajabador he sees every time he checks himself out. He puts on his nametag flexing to see just how much he can strain his shirt before returning to the cafe, ready to conquer another day in the life he has worked so hard for.
646 notes
·
View notes
!!!MODERN YANDERE IDOL!GENSHIN/READER MATCH-UP EVENT!!! (Masterlist)
"Oh no... another poor unfortunate soul."
Slots available: "CLOSED. 22 ANONS HAVE SUBMITTED. THANK YOU FOR YOUR TIME, I'M GLAD WE HAD THIS INTERVIEW" - Exec. Producer Alice
"It was supposed to be 20 but I forgot to close it." - Producer Lumine
"And who's fault is that, exactly?" - CEO Alhaitham
"... I know..." - Producer Lumine
LIST OF ANONS THAT GOT IN
THANK YOU POSTERS
=============
SENDER: (Executive Producer) Alice ||
WELCOME TO TEYVAT PRODUCTIONS.
PLEASE READ THE GUIDELINES BEFORE ACKNOWLEDGING THE LIST OF IDOL GROUPS YOU MIGHT GET ASSIGNED TO.
HERE IS THE LIST:
ADDICKTZ
ADDICKTZ, formerly known as DCKZ, is an idol group formed in 20XX. They are incredibly well-known in the industry and their singles frequently top the charts. All the members previously worked as fashion models and half of the members (Dainsleif, Arataki Itto, Kaeya Alberich, and Childe) took movie and theatre roles. They are currently the number #1 unit in terms of presenting satisfactory fanservice.
Ayato || Diluc || Dainsleif || Itto || Childe || Kaeya || Thoma || Zhongli
["For your sake, I advise you to start praying for the God you believe in so that you won't end up producing ADDICKTZ. Unlike me, they might just listen to you. Why won't they listen to me? Hmm. Well, that's because I've never been a devotee. Still, be wary." - Dainsleif]
5WIRL
5WIRL, formally known as 4NEMO before Shikanoin Heizou's debut, is an idol group formed in 20XX. They often experiment with multiple genres of music and present multicultural aesthetics. The group consistently adds their thematic light green and wind motifs in their albums, poetry, and other media. 5WIRL's lyrics have often discussed mental health, stages of grief, nature, and other self-reflections.
Venti || Xiao || Kazuha || Heizou
Note: Aether is under Producer Lumine's management.
["Ohohoho, a lost guest! It's always nice to see a new face around here! Can I get you something to drink? I promise you can trust me!... Geez, what's with that look? I don't spike drinks. Is that sooo hard to believe?" - Venti]
Kreideprinz
Dr. Albedo operates a solo unit more professionally known as "Kreideprinz." He debuted in 20XX before his major label debut album "The Chalk Prince and the Dragon" in 20XX under his previous producer "Alice". His unit work focuses on commercials, modeling for magazines, and talk shows. The unit rarely goes on tours since Dr. Albedo prioritizes his scientific research more than idol work.
Dr. Albedo || (Student) Gorou
["You must have a strong body and you must also stay on top of your game in this industry. Although, if you do get assigned to Kreideprinz, leave the heavy lifting to us!... Or me. Just. Only rely on me. Y-You don't have to keep your eyes on him 24/7." - Gorou]
I HEREBY AGREE TO THE TERMS AND CONDITIONS OUTLINED IN THIS AGREEMENT AND SUCH IS DEMONSTRATED THROUGHOUT BY MY SIGNATURE BELOW
____________________________________
SIGNATURE OVER PRINTED NAME
=============
"So, which unit will Mx. (Y/n) end up working with? Ooh, Paimon can't wait!"
"I don't know kid, but something tells me that something bad is going to happen..."
=============
"Pwah! It's fiiine! They may be a total newbie, but Paimon thinks they can handle it!... Right?"
PERSONS OF INTEREST (SECRET MATCH-UPS)
Teyvat Productions' logo's made by ESTHER anon!!!
CEO Alhaitham
Manga Shop Owner Cyno
Music Composer Tighnari
Creative Director Zandik (ADDICKTZ)
Creative Director Baizhu (5wirl)
Stylist & Model Scaramouche (Affiliated w/ 5wirl)
Trainee Kaveh
Pantalone
"Interesting... So these are the people that didn't become producers, huh? But why do you keep a record of them, miss Alice?"
"Isn't it obvious Lumine? It's because they're interesting, duh~"
=========================
EXTRAS:
ADDICKTZ video shtpost: "Tonight on the real ADDICKTZ at TeyvatPro"
[READ AFTER KAEYA'S FIC] Dottore's always watching.
[GENERAL SPOILERS] Incorrect Quotes, P2, P3
TIGHNARI'S TAPES (voice lines):
[AFTER KAEYA'S FIC] Qiqi and Xingqiu during Childe's recording
[BEFORE AYATO'S FIC] Beidou and Sucrose in front of Albedo's room
4K notes
·
View notes
Welcome to the HOT AND VINTAGE MOVIE STARS tournament! We are now finished with the Hot & Vintage Men Tournament; The Hot & Vintage Movie Women Tournament is ongoing. Submissions for hot vintage women are now closed, but we are accepting propaganda for those already in the bracket.
Round 1 of the Hot & Vintage Women Tournament began with 540 hot women in prelims. Round 1 starts Saturday, March 2nd, with posts going up over several days. All polls—including ongoing polls, previous rounds, old tournaments, the various shadow brackets, and fun mini polls—can be found in the #hotvintagepoll tag. Every poll in the Hot & Vintage Women Tournament will be tagged with the hot woman in it if you need to search for a hot woman in particular.
FAQs:
“Where is [my favorite hot woman]?” It depends. Are all the Round 1 polls up yet? Have you checked all the polls in the tag? Have you done a tag search for her? If you still haven’t found her, either nobody submitted her or she did not fit the criteria of being a movie woman from 1910-1970.
“Can I still submit hot women?” No, the submission window has closed. Please do not send in women you wish had made it into the bracket. I can’t do anything with those asks and they just make me sad.
“I have additional propaganda for the hot women!” Great! Send me an ask or reblog the poll and add your propaganda to it. If you see a separate post that relates to your hot woman, like a fancam or a gifset, you can tag me in it. I don’t boost all the propaganda I see or receive, but I try to boost the best of the best.
If you’re submitting propaganda for your hot lady, I don’t accept propaganda that’s from beyond the end of this tournament’s era (ie don’t send me pics of them from before 1910 or after 1970). I also don’t accept propaganda of TV appearances unless it’s clearly a cameo where they’re playing themselves. If you have a TON of photos to submit, please send a few asks instead of one long one. I watch every video I receive so I can add trigger warnings, so please don't send long videos—I don't have time to review them.
I don’t post or boost negative propaganda about any hot woman. If you really hate that a certain hot woman is winning, send me positive propaganda for their hot opponent. If you think a hot woman shouldn’t even be included in the tournaments because of scummy things she did in her lifetime, please read my take on it here.
If I see repetitive, trolling, and/or bigoted remarks in the comments, I may block you from this bracket. If you want to point out a hot woman’s flaws or misdemeanors, that’s fine, but if I see consistent bad-faith trolling, you will be blocked.
The views expressed in the propaganda are not my own. I don’t submit my own propaganda, and I don’t change what’s submitted beyond fixing spelling mistakes. If you hate a poll bio or a pic, let me know and send me something I can use instead. Thoughtless bitching will get blocked.
"Where are the hot men?" Most of them are in the shadow realm! Toshiro Mifune was crowned the winner of the Hot & Vintage Men Tournament, and the rest were banished where the sun never shines. You can find all the round 1 matchups here (thank you @markwatnae!), or you can search the archive by tag to find out more about what happened to all the different hot men.
"Why didn't my propaganda make it into the poll post?" Either I couldn't open the link, or there was so much submitted I could only pick a few. Because this tournament is so much bigger than the Hot & Vintage Men one, I'm limiting propaganda to 5 pics per hot lady for Round 1. I know, a bummer! I have to do it this way to keep myself sane. If you have a photo you really want the world to see, follow the propaganda guidelines above.
“My FAQ isn’t on here :(” send me an ask! I love hearing from you guys—just please check these basics first.
Thank you for being here! Enjoy the tournament.
156 notes
·
View notes
We're hosting NSFW Gojo Week 2023!!!
Hosted by: @lemonlover1110 @violetsaffron5 @septembersums @ayyy-pee @xo2dee
Hellooooooo! With season 2 of Jujutsu Kaisen quickly approaching, we're excited to announce we are hosting a NSFW Gojo Week and would love for you to join us this September in participating!!! This includes:
Fanfics
Drabbles
Fanart
Cosplay
And more!
Check out the links below for more info!
Carrd - For guidelines/rules, AO3 Collection, etc.
Twitter - Give us a follow!
CuriousCat - For any questions you may have!
Prompts list:
Please make sure to read the rules on our Carrd before joining as this is an 18+ event!!!!
** EDIT: WE ARE STILL ACCEPTING ENTRIES TO GOJO WEEK!!! Please either tag a mod, use the hashtag on here or submit to the collection!** We will add your name to this post. When you post your work, @ one of us so we can link your work here as well!
Check out the Collection of fics on AO3 as well! Some fics will only be available there! Link here -> Gojo NSFW Week 2023 Collection!!!
Participants:
To see the Day's prompt/summaries, check out the writer's masterlist/link!
konigbabe:
KALEIDOSCOPE OF SIN (Gojo week masterlist)
❥ Day 1 - never define you
❥ Day 2 - when we play
❥ Day 3 - the great war
❥ Day 4 - the fruits of my labor
❥ Day 5 - frosting of my cake
❥ Day 6 - pearls before swine
❥ Day 7 - eleusinian mysteries
libroparaiso:
❥ Day 1 - break the cycle (69)
❥ Day 2 - palm of your hand (bondage)
❥ Day 4 - behind the curtain (masturbation)
blckbookbbe:
❥ Day 1 - Double Date
❥ Day 2 - Throat Goat
❥ Day 3 - Bad Communication Skills
❥ Day 4 - Actions Have Consequences
ayyypee:
Gojo NSFW Week Masterlist
❥ Day 1 - Crave You
❥ Day 2 - Ten Minutes
❥ Day 3 - A Taste of You
❥ Day 4 - Back to You
❥ Day 5 - A Taste of Me
violetsaffron:
Gojo NSFW Week Masterlist
❥ Day 1 - Exhibitionism
❥ Day 2 - Bondage
❥ Day 3 - Lingerie
❥ Day 4 - Power Dynamic
❥ Day 5 - Breeding
❥ Day 6 - Gunplay
❥ Day 7 - Free Day
lemonlover1110:
Gojo NSFW Week Masterlist
❥ Day 1 - What You Need
❥ Day 2 - Heard You've Moved On
❥ Day 3 - The Babysitter's Crush
❥ Day 4 - Office Duties
❥ Day 5 - Date Night
❥ Day 6 - Early Dessert
❥ Day 7 - Cum Slut
578 notes
·
View notes
๋࣭ ⭑⚝ — 100 FOLLOWER EVENT!
⊹˚₊‧─────────────────────‧₊˚⊹
: YOU'VE BEEN OFFERED A SCHOLARSHIP!
by getting me to 100 followers, you're being offered a scholarship to my fashion school! request slots close on the 15th of february. all you need to do is select your favorite garment!
(please read the whole document before submitting your application!)
all orders should be sent to my asks!
-> masterlist. will/won't write.
₊˚꒰🎀꒱‧ BABYDOLL DRESSES : send me a character, song & prompt and i'll write a oneshot!
₊˚꒰🪽꒱‧ SILK SLIPS : send me a character & colour and i'll write some headcanons! (single, platonic, romantic)
₊˚꒰🩰꒱‧ LACY BRALETTES : send me an nsfw prompt & character and i'll write a drabble!
₊˚꒰💒꒱‧ CLUTCH PURSES : send me a character & trope and i'll make a moodboard!
please refer to my will/won't write and the character list below for this event to run as smoothly as possible! i have every right to refuse to do a request if it goes against my guidelines and/or makes me uncomfortable.
₊˚⊹♡ CHARACTERS FOR THIS EVENT:
konig, simon "ghost" riley, johnny "soap" mactavish, kyle "gaz" garrick, john price, alejandro vargas, ethan landry, billy loomis, rafe cameron, jj maybank, tom riddle, mattheo riddle, theodore nott, lorenzo berkshire, rodrick heffley, dallas winston + possibly more - send me a message or ask if you would like to know if i'll write for a specific character that is not listed!
╰┈➤ love, river! ★
160 notes
·
View notes
Applications Open for Better Heroes: A Justice Society Zine
Better Heroes is a fanmade zine dedicated to the Justice Society of America. We are looking for contributors to help make this zine as spectacular as the team it's representing!
Better Heroes will be a digital zine, with a later physical release. We're hoping the physical release can be bundled with potential merchandise, but that will be dependent on applications and on fundraising.
Any proceeds that exceed our production costs will go directly to aid for Gazans and for Palestine. We are currently weighing different charities, and intend to be as transparent as possible if and when we reach our funding goal. We're hoping we can raise enough with your help!
Will you join us?
Read on for guidelines that will help with your contributor application. And if you have any questions, drop an ask! We're happy to talk to you.
What Are We Looking For?
Writers: obviously fanfiction, but ALSO, if you have an original essay (personal or academic) or a nonfictional historical piece, we are more than happy to consider it
Artists: we're looking for cover artists, splashpage artists, artists to be paired with writers, and general. splashpage and pairing might end up more hand in hand, but that is tbd!
MERCHANDISE Artists: we are CONSIDERING, based on the interest check, making merchandise to go with the physical zine, including but not limited to stickers, pins, charms, and prints. For the integrity of the zine, please do NOT submit any merchandise ideas for THIS zine. if we move forward with merchandise, we will work with you. this is NOT the same as applying to be a zine artist, but you can apply for both! however, if you apply and are selected for both, please understand artist and merchandise artist as 2 separate jobs.
Pinch Hitters: if a contributor defaults up to 1 month before the turn-in date, a pinch hitters will be tapped. this means a pinch hitter could have anywhere from several months (if the contributor defaults early in the process) to only one month. if you are chosen to contribute AND you want to opt in to pinch hitting, there is a VERY small chance you will be asked to do both - we'd like to include as many creators as possible.
Additional Information: We are heavily considering offering a smaller zine-within-a-zine of NSFW content. this zine is not automatically included with the regular one, and buyers will have to opt in. you are welcome to apply for only sfw contributions, only nsfw contributions, or sfw AND nsfw contributions. if there is a want for additional merch to go with the nsfw zine, or a want for an nsfw-only package, we will consider it based on finances. NSFW proceeds will be bundled into our charitable donations.
152 notes
·
View notes
OLD MAN YAOI/OLD WOMAN YURI TOURNAMENT
Do you love old man yaoi? Old woman yuri? Do you want to see your favorite old man yaoi and old woman yuri couples fight each other? to the death? Well here we are now.
(Btw we only do real gay elders here we are NOT calling dudes in their 30s old man yaoi. more info is in the form and under the read more)
This is my third time running a tournament; I also did @worstcharacterpoll and @youngersiblingstournament & both times i have gained more insight on how to run these properly LOL
well anyway ACCEPTING SUBMISSIONS NOW vvv
submissions will close Jul 19 at 8:00 pm CST/Jul 20 at 1:00 UTC
Guidelines and stuff is below, but it's copy pasted in the submission form. Also please submit yuri
SUBMISSION GUIDELINES (Please read):
No real people even if it's really funny
No characters based on real people
Couples must be gay; if one of them is canonically nonbinary though, they will be allowed
No incest or abusive ships
I'll be vetting source material on a case-by-case basis, but just so we're clear I'm not putting Harry Potter or OFMD in the poll
There will be a maximum of one ship per source material in the poll. You can submit multiple ships from the same material, but only one will be allowed if it gets in
AGE GUIDELINES SECTION (because I keep seeing people use the term "old man yaoi" for couples in their 30s or even 20s):
THESE GO FOR BOTH PARTIES IN THE RELATIONSHIP
Human characters with a canon age must be at least 50. This also goes for characters that aren't human but age at the same rate as humans. Please double-check your characters' ages before you submit to save me some headache
If they don't have a canon age, they must look elderly.
No characters that have been de-aged (ex. Purah from Zelda).
For nonhuman characters that age at a different rate than humans: they must be old for their species (ex. Ravenpaw and Barley from Warrior Cats; Ravenpaw is the younger one, and is around the same age as Graystripe, who becomes old enough to retire as an elder).
For immortals/characters with very very long lifespans, they must look old (ex. Gandalf from Lord of the Rings would count; Hythlodaeus from Final Fantasy XIV would not).
Couples that will already be in the poll, so you don't need to submit them:
Fiddleford McGucket/Stanford Pines (Gravity Falls)
Hanayo Nishida/Yoshiko Dojima (Hanamonogatari)
Ravenpaw/Barley (Warriors)
Eda Clawthorne/Raine Whispers (The Owl House)
Couples already under consideration, but will depend on the other submissions if they get in the poll or not; you may submit your support for them if you want to see them:
Walter White/Mike Ehrmantraut (Breaking Bad) (keep in mind this one is mostly a joke)
Ms. Bitters/Countess von Verminstrassen (Invader Zim) (minor characters but I invented this one and I'm partial to it)
The Once-ler/The Lorax (Lorax 2012)
521 notes
·
View notes
hi everyone! the small online art publication i work with (art currently) is always looking for writers/contributors and underrepresented artists to write about and things like that (it's free!). so if you want to be written about or write about an artist, we are looking for you!!!!!
if you are interested in submitting a story/writing with us, please head to this link. please be sure to read all the guidelines and feel free to ask me any questions you have before submitting.
if you are a contemporary artist (particularily of an underrepresented group) and you're interested in being written about/working with us, contact us on our instagram or contact me directly!
we are still a growing publication, so we are always looking for new eyes and fresh faces to contribute to our world! thanks for reading.
130 notes
·
View notes
POLAROID MEMORIES EVENT
— an enhypen collab by @lilacnini & @nishions .
# ABOUT — as the embrace of spring envelops the earth, it beckons forth a season adorned with love and beauty. with a quarter of the year tenderly tucked away, memories, like delicate petals, unfurl, weaving together moments shared with cherished ones. The memories of dates, laughter echoing through time, and the gentle caress of affection intertwine to form warmth and nostalgia. Spring, with its soft whispers of renewal, unfurls a new chapter, inviting us to wander through the gardens of cherished memories once more.
# NOTE — new collab with @nishions, or liz!! im so excited to see everyone's works and ideas into this beautiful collab project! i hope everyone enjoys it <3
GUIDELINES —
ONE. STATUS —all entries are full
TWO. to participate, please send an ask to either liz (@nishions) or nini (@lilacnini) with your chosen member and the two keywords that are hidden in the rules. there will be two slots available for each member (excluding me and liz's pieces) please like & reblog this post to help boost this. first keyword is nostalgia
THREE. your work must have synopsis, genre, warnings, and word count before the main content. works with over 500 words must have a read more cut. use the tag "# ⋆.˚nin-liz event" in the first five tags for both me and liz to find it. you may either tag me or liz in your work as an alternative method.
FOUR. the written piece may be a oneshot, timestamp, long fic, and etc. (if writing any timestamp, it must be 400+ word count) and must be member x reader or member x oc. no drabbles, thoughts, series, or smaus!
FIVE. theme of this event is memories of being together. this can be in any form like angst or fluff. it can be any moment as well, but note to keep it sfw. second keyword is love.
SIX. please submit your work by 11 MAY 2024! drop outs are 30 APR 2024
SEVEN. plagiarism is strictly prohibited & will not be tolerated.
EIGHT. strictly no smut. suggestive or mature themes (death, violence, substance use, etc.) are not permitted. no racism, ableism, homophobia or similar prejudices. you will be removed from the collab.
NINE. please don’t be afraid to reach out to either of us if you have any questions or concerns! have fun writing !!
SLOTS & FICS — ENTRIES IN RED MEANS THEY'RE FULL
HEESEUNG · @lilacnini @enhasver
JAY · (2 person claimed but not finished)
JAKE · (2 person claimed, but not finished)
SUNGHOON · (2 ppl claimed, but not finished)
SUNOO · @stariikis (1 person claimed but not finished)
JUNGWON · @wonifullove
RIKI · @nishions @ms-no1kpopstan
O1. PAINTING DAY - LHS (@lilacnini)
you have many favorite moments with heeseung but your favorite is especially when you paint your boyfriend's nails for fun
O2. LUCKY GIRL - KSN (@stariikis
sure, you're already well known as enhypen member kim sunoo's girlfriend, but that doesn't hinder the thrill of tossing a coin and landing on heads when sunoo chooses you, in the midst of the crowd.
O3. PRIZE - LHS ( @enhasver)
you have lots of memories with your boyfriend heeseung, but one of the most cherished memories that you hold dear with your boyfriend heeseung is the day when you both visited the amusement park.
O4. STRANGERS - NRK ( @ms-no1kpopstan)
you break up with your ex and soon meet a stranger who comforts you throughout the night. but that stranger would be your "future" boyfriend, riki.
O5. THE BOY I LOVE BEFORE - YJW ( @wonifullove)
you discover the gifts your ex once gifted you on every date
93 notes
·
View notes
Welcome to Corroded Coffin Fest!
This is a fanworks challenge/event that is all about Corroded Coffin. It will take place from July 1st thru July 31st.
Thanks so much for showing interest in this event during this post! If you have friends that you think would like to participate, please considering reblogging this announcement!
The calendar of prompts is located here:
Since there are so many events going on (and we love to see it!) we've decided to set a word count range for this event, so the love can be spread around to more events.
GUIDELINES:
Ideas for works include: fic, art, gifsets, fanvids, moodboards, edits, playlists, or anything else you can think of to celebrate Corroded Coffin!
For fics, there is a word count minimum/maximum of between 300-1000 words per drabble. We'll use wordcounter.net to check the word counts before reblogging, so make sure you stick to that range!
Do one prompt, do them all. Hell, do them all twice! It's totally up to you. You can pick and choose what you're interested in. And we're not going to police how you interpret the prompt. Just use them as a jumping off point to be inspired by the boys of Corroded Coffin, and then share that inspiration with us! (Not everything has to be band related, we encourage you to explore other parts of their lives, too!)
Submissions can absolutely be connected to other prompts from the event, or even past works, but should still be able to stand alone each day.
Every morning a new prompt card will go up, reminding everyone of what that day's prompt will be.
All submissions should include any pairings featured, content rating and any content warnings (CW) or tags that you think are appropriate. Please put the prompt you are fulfilling as well, just to keep things straightforward. A sample could look something like this:
Prompt Day 9: The Hideout, Word Count: 666, Rating: M, Pairing: None, CW: Underage Drinking, Recreational Drug Use, Tags: Corroded Coffin, First Gig, Partying, Eddie, Gareth, Jeff, Freak, The Hideout
Also, please consider putting any explicit material under a read more cut, because anything rated E that's not hidden under a cut will not be reblogged.
For the artists! Your art submission must be posted on the same day as the current prompt in order to be reblogged by this blog. Your piece of art (or other creation) must be Corroded Coffin focused, using any combination of the guys, together or solo. Of course, other characters can be included, too! But you need to have at least one of the CC band members in it for it to count for this event. Thank you!
All ships are welcome, as long as they include at least one member of Corroded Coffin: Eddie, Jeff, Gareth & Freak. (Who I look forward to learning the name of from you all, time and time again!)
Please tag us here @corrodedcoffinfest when you post your work for the day so we can reblog it!
Be respectful of your fellow participants and readers. We're all here to have fun and share the love of all parts of Corroded Coffin.
Definitely feel free to ask me anything if the rules weren't clear in places, or if I straight up forgot something (or if you just have anything else you'd like to ask). You can send an ask/message to this blog or reach out to @thisapplepielife.
Please submit your post by 11:59 PM EDT on the day of the prompt in order to not be missed for reblogging.
If posting on AO3, please feel free to use the collection associated with this event: Corroded Coffin Fest AO3 Collection after your submission has been reblogged by this account.
Most importantly, have fun! We can't wait to see what Corroded Coffin fanworks come out of this new event!
More info below, including full prompt list with jumping off suggestions, the warm-up rounds for April, May & June, and a spreadsheet you're free to use:
PROMPTS:
JULY 1ST - FIRSTS
First gig, first check, first award, first...anything.
JULY 2ND - IN THE BEGINNING
How did Corroded Coffin come to be?
JULY 3RD - BEST FRIENDS
Who are the best friends in the band in your head? Let's find out.
JULY 4TH - EDDIE
We all know Eddie. Let's hear some more about him today.
JULY 5TH - ON THE ROAD AGAIN
Get them out on the road, in any way you see fit.
JULY 6TH - HEARD IT IN A LOVE SONG
Let's have some romance. Any pairing(s) that tickle your fancy.
JULY 7TH - CELEBRATE GOOD TIMES, C'MON
Let them celebrate! Maybe that's a birthday/holiday/celebration show. Maybe it's a wedding, etc.
JULY 8TH - BAND POLITICS
Fight! Fight! Fight! Not everything goes smoothly all the time.
JULY 9TH - THE HIDEOUT
Catch them there, every Tuesday, playing for five drunks.
JULY 10TH - PRIDE
Let's see them celebrate Pride! Or let's see them be proud, etc.
JULY 11TH - JEFF
Let's spend some time with the guitarist of Corroded Coffin.
JULY 12TH - OW!
Injuries happen. Tell me more.
JULY 13TH - SEX, DRUGS & ROCK N ROLL
Tell us about the seedier parts of being in a band! 18+ for adult content, please!
JULY 14TH - AND THE WINNER IS...
It's time for awards season. Do they win? Lose? Let us know.
JULY 15TH - LET'S TALK ABOUT THAT
Press Tour/Interviews. Sometimes they need to promote themselves.
JULY 16TH - STRUGGLING
They're working their asses off, grinding it out, but they haven't hit the big time yet. Or they're struggling in other ways...
JULY 17TH - "THIS ONE'S FOR YOU"
Dedicate a song to someone special.
JULY 18TH - FREAK (GRANT, FRANK, GOODIE, ETC.)
Whatever name you given him, let's all focus on the bassist of Corroded Coffin.
JULY 19TH - IN THE GARAGE
Get them in the garage. Band practice, fixing the van, etc.
JULY 20TH - UNDER THE COVERS
Let them cover some real songs. Or, you know, get under the covers in another way...
JULY 21ST - HATE THIS TOWN
Hawkins. How was it dragging them down? Or, maybe they hate LA...
JULY 22ND - ALTERNATE UNIVERSE (AU)
Use your imaginations and put them into a whole new world!
JULY 23RD - UP AND COMING
They're finally gaining a little traction. Or maybe they're up...and coming. *wink wink, nudge nudge*
JULY 24TH - BEHIND THE SCENES
What's it take to get this show on the road? Or, what are they really like, off-stage? Let's get a peek behind the curtain.
JULY 25TH - GARETH
Bang them sticks! Let's catch up with the drummer of Corroded Coffin.
JULY 26TH - TOUR DATE
Let's focus on a specific show.
JULY 27TH - YOU'LL BE IN MY HEART
Navigating love while on the road.
JULY 28TH - BACK TO INDIANA
Let's go back to Hawkins and/or Indiana. Send these boys home.
JULY 29TH - BEHIND THE MUSIC
You know there's drama. A story. Probably enough for VH1 to come knocking.
JULY 30TH - FAME & FORTUNE
They've made it big! Now what?
JULY 31ST - YOUR SONG
A Corroded Coffin song? A work inspired by a song? A song that makes you think of Corroded Coffin?
WARM-UP ROUNDS:
Let's get a little practice before the full event in July!
Here's a prompt each month leading up to the event to work out the kinks and get in the rhythm of it all!
APRIL 15TH - TAXED
It's tax day. Do they need to pay their taxes? Is this a write-off? Or, are they just taxed from being on the road? Tax them.
MAY 15TH - GET A JOB
Put 'em to work. First jobs, side hustles, etc. Surely they've had some other jobs besides being in the band. Tell us about them.
JUNE 15TH - BAND ON THE RUN
Are they late for a gig? Running from monsters in the Upside Down? On a tour from hell?
Same guidelines as the full event will apply.
SPREADSHEET:
If you'd like a spreadsheet to help you keep track of the prompts and your progress, here's the one I personally use for other events, and will be using myself for this event. If you'd like to use it yourself, just go to File>Make a Copy and you'll get a version you can edit in your own Google Sheets.
Thanks for showing interest in having a Corroded Coffin event this year! ❤️🦇🖤 - @thisapplepielife (and thanks for the help and adding to the prompt list, @wormdebut!)
101 notes
·
View notes
Did you know...
...That WritingWithColor is answering anime fanfic-related questions again?
That's right! It's true that we have banned these questions previously for a few reasons which you can read in this post. However, Mod Rina is temporarily reversing the ban, with a few restrictions:
Only asks where Rina or a close source is familiar with the original material, and
the ask contains topics that have not been discussed before, or has other educational value for the blog.
We still believe that fanfic is the place to experiment, make mistakes, and learn. We still think that you don't need WWC at all to write fanfic that is by yourself, for yourself. But we also acknowledge that great original ideas can come from derivative works!
If you want to submit a question, go to our masterpost here and read our guidelines to find the link!
(Image IDs can be found in alt text for each GIF. If not using a screenreader, please click "ALT" icon at the bottom left corner of the GIF.)
175 notes
·
View notes
March Palette Game: CLOSED 🌈
Somewhere, over the rainbow...
I felt inspired to do a game based on my huge stack of palette cards. I have 700+ palette cards to shuffle through, multiple stacks that take an hour to shuffle at least lol. I remove any duplicates, so 99% of these cards are different, which leaves much room for exploration.
All participants for this game will receive one palette card which will be read like an aura. What is your current energy? What kind of aura are you radiating? I will not reuse cards, so everyone will have a chance to get a unique card drawn! I will also pull one tarot card from the Spectrowhirl deck to give you additional insight as to why your palette card was selected along with additional guidance if needed. Images will be provided.
RULES to Play:
☼ 1 Follow this blog if you're not already a follower: VitaminSeeTarot
☼ 2 Reblog this post with the tag #vitaminseetarotgame
☼ 3 Send me an Ask (not DM) along w/ two different signature emojis of your choice 🌈🎨
☼ 4 Asks will be accepted starting 3/18, deadline is 3/21 @ 5pm EST. Be sure to check the open/closed status before submitting. Asks submitted before 3/21 may receive their reading after the deadline has passed. Asks submitted after the deadline will not. Make sure to submit your Ask before the deadline if you want to participate.
☼ 5 Please be kind & patient while I finish your reading, as I don't know how many will play.
☼ 6 This game is for your specific energy/aura reading only. I will not do palette card readings for your friends, family, or other people in your life. I will not do readings for celebrities, events, or situations here.
☼ 7 Remember that energy is always changing and your aura reading is not meant to be interpreted as a permanent, fixed state. Free will is yours.
☼ 8 I reserve the right to refuse a reading for any reason (I may refuse only because certain guidelines weren't met. You are free to resubmit your Ask before the deadline, provided the above guidelines are followed).
☼ 9 You must agree to the above rules before playing.
☼ 10 If you would like to leave a tip, you can do so on my Ko-Fi page. Check back to my page soon if you're interested in paid readings as I will be opening up for personal sessions very shortly.
Thank you for your donations, likes, reblogs, feedback, and follows. Thank you for your support! 🙂
This reading has not been evaluated by the FDA to diagnose, prevent, treat, or cure any disease or infection. Please ask your physician before going online.
2024, @VitaminseeTarot ™
109 notes
·
View notes
One Piece Crack Ship War - Submission post!
Welcome to the One Piece Ship War - crack edition!
What is a crack ship?
A crack ship is a (in this case romantic/sexual) ship that has little to no basis in canon.
When will my ship qualify for this tournament?
They will automatically qualify (after having been submitted) when:
The characters involved have NO canon interaction*, and are not part of the same crew (no matter how popular the ship is).
The characters involved have 1 short canon interaction and less than 10 fics for them on AO3 (as a side pairing counts too)
They might qualify if:**
They have no canon interaction but are part of the same crew or organisation.
They have 1 short canon interaction but more than 10 fics on AO3
They have 1 long canon interactions or 2/3 short ones and less than 10 fics on AO3
They have multiple canon interactions but NO fics on AO3
It's an incredibly funny ship (but you gotta convince me it's crack!)
These ships will not qualify on principal:
ANY ship between Strawhats (honorary Strawhats don't count if they haven't met a certain Strawhat - examples: BrookNami does not qualify, SanjiVivi does not qualify, but BrookVivi would qualify)
The top 25 ships (or something, be sensible) on AO3.
*canon interactions include fillers, cover stories, specials, and movies (though I haven't seen the last 2 yet and I don't remember much of the other ones, so these might slip through, but I'm counting on you to honor this rule). Also, I won't know nor check interactions in the manga (that haven't been animated yet), so something might slip through there as well. Just honor the rules, please.
**Any ships in the 'might qualify' category will be judged on crackyness by me first, and when I'm in doubt, I will put them up for a vote - so expect a few polls for this.
Rules!
All characters must be from One Piece (no OCs).
Must be a crack ship according to above guidelines.
Ships that were in the previous shipping war tournament are allowed in this one too, as long as they follow the previous rule.
No moral limitations. These are fictional characters, not real people. Go wild. (But be prepared for 'problematic' ships to be voted out in round 1 or 2.) I will not start discourse/moral discussions about any ships! (messages about morally questionable ship are likely to be ignored and deleted)
Poly ships are allowed! I will cap them at 5 characters, however, and at least 1 character should follow the interaction rules stated above. (examples: JinbeRobinBrook or KidLawLu are not allowed. RobinNamiKiller would be allowed, on grounds of Killer having no interactions with the other 2 (I think? 😂)) Again, be sensible here.
All characters involved have to be humanoid. No concepts, objects, or full animals (fishmen/merfolk, minks, and Chopper are allowed).
You can submit multiple ships, but use a new form for each ship.
Do not hate on other ships, just support your own.
You are allowed and encouraged to submit fanart! As a lot of these ship won't have official art with all characters in it, it will come down to fanart for the most of it ((bad) edits are also very much allowed). However, it needs to be your own or you need permission from the artist before submitting it! However, if you haven't gotten permission yet when submitting, you can always send me a link to the fanart later. Without picture submitted, there might be a chance your ship will have to compete without a picture.
Keep the main images SFW and spoiler free. Propaganda can contain nsfw stuff and manga spoilers, as long as it's announced up front (eg: [Spoilers ahead]/[nsfw ahead])
Submit only through the google form below. Submisions through asks or reblogs will not be accepted.
Read the rules? Go ahead and submit those ships! (<you can click on that)
Oh yeah, and in case you're wondering... All submitted ships that pass the crack ship bar will make it into the tournament! No limitation on how many contestants there will be or how many submissions a ship needs. I want this to be an opportunity for all to discover new fun and silly ships!
Closing date is april 8 at 10AM CET.
100 notes
·
View notes
☀️ Application Tips 🌙
Applying to a fanzine can be a pretty nerve-wracking experience, especially if this could potentially be your first zine! This set of tips has been made in the hopes of easing any potential anxiety and making the application process smoother for everyone!
Please read on to find out more and see some cute little puppets!
Read the FAQ and guidelines carefully
The FAQ and guidelines explain the theme of the zine as well as what we’re looking for when it comes to contributor applications. Reading these will help strengthen your application when you come to apply!
Make sure the zine schedule matches your availability
Please verify you’ll be able to keep up with the zine’s schedule if you’re selected to contribute a piece for the zine! For this zine, once selected, you’ll have about three months to complete your piece, with check-ins every month. Life happens, and unexpected things can make us all busy at the last moment (and our mods will try our very best to work with you to get things sorted!), but please be mindful when applying to check that your availability matches with the schedule.
Step one: Follow the guidelines carefully when submitting your application(s).
Please pay careful attention when reading and answering the application questions to ensure that your application follows the guidelines and answers everything as clearly as it can. Applications will stay open for a month - there’s no rush if you need time to complete your application in detail! If there is a maximum number of samples, a word count range, or a specific theme requested on the application form, please make sure your application adheres to these so we can properly evaluate your application. If you’re unsure about anything, please feel free to ask, as our mod team is only too happy to help!
Step two: Make sure we can see your samples.
Once contributor applications open, we’ll be asking to see existing samples of your work so we can see if you’re a good fit for the zine! Please be sure to link specific examples of your work that you think fit the zine’s theming as well as the style and quality level you’re hoping to meet when contributing to the zine. Bear in mind the mod team are likely going to be looking at a lot of entries, so if you link to a gallery that has a huge number of examples, we might not be able to give a fair amount of time looking at the pieces that best showcase your work! These don’t have to be posted publicly on social media, but please ensure we can see them for the duration of the application period (e.g., the links work, the links aren’t set to private or followers only, and the links don’t expire before the application period ends).
Step three: Make sure your application samples fit the theme of the zine.
In this case, we’re looking for examples of your work featuring the DCA. The zine will primarily focus on canon-adjacent depictions of the DCA, with some slots available for AU content made by the AU’s own creator or with express given permission from the creator of that AU. Your application should ideally provide one or more samples depicting the DCA, with at least one of those preferably depicting the DCA in a canon-adjacent form or setting.**Canon-adjacent here doesn’t mean the depiction has to be biblically accurate, just that the design should not differ so substantially from what would typically be recognised as the DCA to essentially be a separate character. This fandom is intensely creative and we love and applaud the originality of the many different variants of the DCA, but this zine aims to focus primarily on canon-adjacent depictions, with a limited number of slots for AU content as well. Having canon-adjacent depictions of the DCA will massively help round out your application for this zine!
Step four: This one’s for the merch artists - please don’t apply with the same samples you’d use for a page/spot artist application!
Including actual merch designs for your samples helps a lot, as prior experience making merch is a massive advantage for a merch artist application!
Bear in mind, you don’t strictly need to follow all of these steps to a tee when completing your application - the mod team will try to accommodate where we can. However, it will really help your application to take these things into consideration!
And most importantly …
Step five: If you get rejected this time, please don’t let it discourage you!
Zines often get a huge number of applications vs contributor spots, and a lot of tough decisions (often taking hours or even days) will likely have to be made between several really good applicants.
Being rejected from a zine in no way means you’re bad at what you do, or in any way less worthy or skilled than anyone else. You deserve to be here just as much as anyone else does, and there are people who adore what you do, so keep doing it! In some cases, certain applications might fit the theme of the zine better, particular applicants explained themselves more clearly in their application, or it was just all in all an extremely close call with one lucky winner. So please don’t ever let a rejection email discourage you from trying, and bear in mind rejection happens to the best of us at some point!
We appreciate every single application we get, so good luck out there!
120 notes
·
View notes
What Is A Bang?
A Big Bang, often referred to as a Bang, is a fandom event where writers and artists collaborate. Writers will write a story and artists will create a piece of artwork to go with the story.
You can finder a deeper history on Bangs here.
How Does It Work?
Once authors sign up, they can begin writing. The minimum word count is 5000 words. There is no maximum, but please try to be realistic as the idea is for the fic to be finished before artists claim them. The author will write a short summary of their fic which the artists will read and then submit a claim. Claims are on a first come, first serve basis. If multiple people claim a fic, whoever does so first will be the artists to draw for it.
Once paired, the artist will then read the fic and begin to create art for the fic. At the end of the event, the stories and the art will be posted during the same week. This creates an influx of content for the fandom for everyone to enjoy.
When Is it?
Writer Sign Ups Open: March 15th, 2024
Writer Sign Ups Close: April 12th, 2024
Artist Sign Ups Start: June 21st, 2024
Artist Sign Ups Close: July 5th, 2024
Posting Week: September 20th, 2024 - September 27th, 2024
A more detailed timeline can be found here.
How Do I Sign Up?
There is a google sign up form. At the end of the form will be a Discord link that will take you to the Discord Server for the event. In order to participate, you must have a Discord account.
Please see the Ghouls and Gangs Guidelines Document for more information on the event. This post has our Frequent Asked Questions and this one has our Event Schedule.
If you still have any questions, please send an ask to the blog.
122 notes
·
View notes